Your browser is old and dusty. Try Google Chrome!

Details for NP_441895.1_10

Name NP_441895.1_10
Length 20
Regular expression AATTGGGAAAAATGGTGAAG
Central No

Motif logo

Genes containing this motif

554 unique genes found. Note that a gene can occur multiple times in the table below since a motif can be assigned to more than one position in its promoter.

Table filtering
ORF Direction Start Stop Score q-value
sll0558 Forward -239 -220 -27.6315 0.282
sll1212 Forward -317 -298 -19.1751 0.282
slr1311 Reverse -290 -309 -19.1751 0.282
sll1408 Reverse -222 -241 -18.5851 0.282
slr1484 Forward -393 -374 -18.1918 0.282
slr1485 Forward -305 -286 -27.8282 0.299
sll1056 Reverse -256 -275 -8.55534 0.147
slr1122 Forward -160 -141 -27.5332 0.282
sll1054 Forward -230 -211 -18.1918 0.282
slr0722 Forward -290 -271 -19.0768 0.282
slr0731 Forward -155 -136 -18.5851 0.282
sll0703 Reverse -232 -251 -27.6315 0.282
slr1006 Forward -194 -175 -27.7299 0.29
ssl1326 Reverse -206 -225 -27.7299 0.29
slr0734 Forward -91 -72 -27.7299 0.29
sll0698 Reverse -96 -115 -18.8801 0.282
slr0737 Forward -100 -81 -18.8801 0.282
slr0243 Forward -158 -139 -18.4868 0.282
sml0003 Reverse -354 -373 -18.5851 0.282
slr0251 Reverse -71 -90 -27.3366 0.282
ssr0390 Forward -278 -259 -18.0934 0.281
sll0223 Forward -351 -332 -27.5332 0.282
sgl0002 Reverse -189 -208 -18.8801 0.282
sml0004 Reverse -57 -76 -18.8801 0.282
slr0254 Forward -108 -89 -18.8801 0.282
sll0220 Forward -69 -50 -27.8282 0.299
sll0218 Reverse -238 -257 -27.3366 0.282
slr1095 Reverse -296 -315 -19.0768 0.282
sll1031 Reverse -58 -77 -17.8968 0.281
slr1776 Reverse -323 -342 -27.7299 0.29
sll1683 Forward -52 -33 -18.5851 0.282
sll1682 Reverse -334 -353 -18.6834 0.282
slr1783 Forward -289 -270 -27.8282 0.299
sll1675 Forward -111 -92 -18.3884 0.282
slr1789 Forward -362 -343 -19.1751 0.282
slr1793 Reverse -365 -384 -27.6315 0.282
slr1794 Reverse -70 -89 -18.6834 0.282
slr1796 Forward -85 -66 -27.6315 0.282
sll1665 Reverse -182 -201 -27.6315 0.282
sll1662 Forward -170 -151 -9.047 0.281
slr1798 Reverse -61 -80 -9.047 0.281
slr1291 Reverse -374 -393 -27.8282 0.299
slr1301 Reverse -159 -178 -19.2734 0.282
slr1306 Forward -127 -108 -27.6315 0.282
sll1184 Reverse -154 -173 -19.1751 0.282
slr0967 Forward -391 -372 -27.5332 0.282
ssl1792 Forward -161 -142 -18.2901 0.282
ssl1784 Reverse -332 -351 -27.4349 0.282
sll0925 Reverse -191 -210 -18.4868 0.282
slr0974 Forward -76 -57 -18.4868 0.282
slr0977 Reverse -290 -309 -27.7299 0.29
slr1064 Forward -112 -93 -18.6834 0.282
slr1073 Forward -99 -80 -18.8801 0.282
ssr1765 Forward -181 -162 -27.4349 0.282
slr1084 Reverse -60 -79 -18.4868 0.282
sll1023 Reverse -343 -362 -18.2901 0.282
sll1022 Forward -390 -371 -18.1918 0.282
sll1022 Reverse -85 -104 -27.5332 0.282
sll1018 Reverse -239 -258 -27.8282 0.299
sll0643 Reverse -17 -36 -18.6834 0.282
slr0687 Forward -289 -270 -18.6834 0.282
slr0688 Forward -289 -270 -27.8282 0.299
sll0635 Reverse -12 -31 -27.8282 0.299
slr1592 Reverse -350 -369 -27.6315 0.282
sll1514 Reverse -197 -216 -9.34199 0.281
sll1512 Forward -159 -140 -18.6834 0.282
slr1598 Reverse -96 -115 -18.6834 0.282
sll1510 Reverse -326 -345 -18.5851 0.282
ssr2699 Forward -366 -347 39.0369 0.000000369
ssr2699 Forward -139 -120 -18.8801 0.282
ssl2920 Forward -310 -291 -18.6834 0.282
sll1011 Reverse -208 -227 -27.6315 0.282
slr1050 Forward -116 -97 -27.6315 0.282
ssl1922 Forward -228 -209 39.0369 0.000000369
ssl1920 Forward -40 -21 39.0369 0.000000369
sll1001 Forward -287 -268 -18.9784 0.282
slr1753 Reverse -261 -280 -18.9784 0.282
slr1760 Forward -292 -273 -18.1918 0.282
slr1761 Forward -82 -63 -17.7985 0.281
sll1640 Forward -308 -289 -27.6315 0.282
sll1636 Forward -350 -331 -18.6834 0.282
sll1635 Reverse -8 -27 -27.7299 0.29
sll1945 Reverse -143 -162 -27.8282 0.299
slr2033 Forward -93 -74 -27.8282 0.299
slr2038 Reverse -98 -117 -9.14533 0.281
sll1942 Forward -272 -253 -8.85033 0.278
sll1937 Reverse -205 -224 0.786102 0.0417
slr2044 Forward -318 -299 -19.0768 0.282
ssr3467 Reverse -340 -359 -8.35868 0.119
slr2047 Forward -73 -54 -27.4349 0.282
slr2052 Forward -152 -133 -18.7818 0.282
sll1929 Reverse -292 -311 -27.7299 0.29
slr1914 Reverse -324 -343 -27.6315 0.282
slr1917 Forward -200 -181 -27.7299 0.29
sll1833 Forward -323 -304 -18.0934 0.281
slr1920 Reverse -343 -362 -27.6315 0.282
sll0997 Forward -97 -78 -18.3884 0.282
slr1020 Forward -128 -109 -17.9951 0.281
ssr1698 Forward -393 -374 -18.6834 0.282
slr1022 Forward -382 -363 -19.0768 0.282
slr1025 Forward -92 -73 -18.1918 0.282
sll1298 Reverse -261 -280 -19.3717 0.282
sll1291 Forward -208 -189 -18.2901 0.282
slr1390 Forward -134 -115 -27.6315 0.282
sll1283 Reverse -77 -96 -18.6834 0.282
slr1699 Forward -71 -52 -18.6834 0.282
sll1584 Reverse -210 -229 -27.7299 0.29
sll1568 Forward -50 -31 -18.2901 0.282
slr2005 Forward -194 -175 -9.73531 0.281
sll1925 Forward -21 -2 -18.9784 0.282
slr2006 Reverse -194 -213 -18.9784 0.282
sll1912 Forward -128 -109 -27.7299 0.29
slr2031 Forward -71 -52 -19.3717 0.282
slr1138 Forward -385 -366 -27.6315 0.282
sll1082 Reverse -287 -306 -18.1918 0.282
sll1080 Forward -336 -317 -18.2901 0.282
slr1145 Forward -254 -235 -18.0934 0.281
slr1148 Forward -148 -129 -27.6315 0.282
ssl3451 Reverse -130 -149 -18.6834 0.282
sll1825 Forward -168 -149 -18.6834 0.282
ssl3441 Forward -145 -126 -18.8801 0.282
sll1812 Forward -176 -157 -27.7299 0.29
sll1810 Reverse -134 -153 -18.4868 0.282
sll1796 Reverse -103 -122 -18.5851 0.282
slr1897 Forward -78 -59 -18.5851 0.282
slr1899 Reverse -337 -356 -18.2901 0.282
slr1903 Forward -75 -56 -27.7299 0.29
sll1789 Reverse -87 -106 -18.1918 0.282
sll1786 Reverse -288 -307 -27.5332 0.282
sll1124 Reverse -287 -306 -18.2901 0.282
slr1205 Forward -160 -141 -27.5332 0.282
slr1206 Forward -316 -297 -27.5332 0.282
slr1212 Forward -140 -121 -19.3717 0.282
slr2074 Reverse -228 -247 -18.4868 0.282
slr2076 Reverse -39 -58 -19.1751 0.282
slr2077 Reverse -39 -58 -18.8801 0.282
ssl3712 Reverse -95 -114 -27.6315 0.282
sll1740 Forward -193 -174 -27.8282 0.299
slr1826 Forward -358 -339 -27.4349 0.282
slr1828 Forward -400 -381 -27.7299 0.29
slr1830 Forward -224 -205 -19.2734 0.282
sll1736 Reverse -339 -358 -18.9784 0.282
sll1734 Reverse -351 -370 -18.1918 0.282
sll1723 Reverse -370 -389 -17.9951 0.281
sll1721 Reverse -178 -197 -17.9951 0.281
slr1838 Forward -200 -181 -17.9951 0.281
slr1844 Forward -36 -17 -18.7818 0.282
sll1716 Forward -44 -25 -18.5851 0.282
sll1716 Forward -61 -42 -27.8282 0.299
slr1535 Reverse -154 -173 -18.2901 0.282
slr1537 Forward -262 -243 -18.6834 0.282
slr1540 Forward -47 -28 -27.6315 0.282
slr1544 Reverse -195 -214 -27.5332 0.282
slr1545 Forward -127 -108 -27.4349 0.282
slr1549 Reverse -288 -307 -18.8801 0.282
slr1550 Reverse -9 -28 -18.4868 0.282
sll1453 Reverse -173 -192 -18.2901 0.282
sll1144 Reverse -242 -261 -27.7299 0.29
slr1220 Reverse -249 -268 -18.3884 0.282
slr1230 Forward -70 -51 -18.2901 0.282
slr1236 Reverse -134 -153 -27.7299 0.29
sll1130 Forward -93 -74 -27.3366 0.282
slr1437 Forward -234 -215 -18.3884 0.282
slr1441 Forward -35 -16 -18.7818 0.282
slr1450 Reverse -208 -227 -27.7299 0.29
sll1281 Forward -382 -363 -18.0934 0.281
sll1275 Forward -162 -143 -18.9784 0.282
slr1362 Reverse -26 -45 -18.9784 0.282
slr1362 Forward -318 -299 -27.7299 0.29
slr1362 Forward -222 -203 -27.8282 0.299
sll0877 Forward -256 -237 -18.8801 0.282
sll0871 Forward -181 -162 -18.5851 0.282
sll0871 Forward -200 -181 -18.7818 0.282
sll0871 Forward -256 -237 -19.2734 0.282
slr0884 Reverse -135 -154 -18.5851 0.282
slr0884 Reverse -116 -135 -18.7818 0.282
slr0884 Reverse -60 -79 -19.2734 0.282
sll0869 Forward -143 -124 -18.4868 0.282
sll0868 Forward -102 -83 -18.9784 0.282
sll0864 Reverse -148 -167 -19.1751 0.282
sll0860 Reverse -231 -250 -18.6834 0.282
slr1853 Forward -342 -323 -27.8282 0.299
slr1859 Reverse -13 -32 -19.1751 0.282
slr1859 Reverse -109 -128 -27.0416 0.282
slr1864 Reverse -354 -373 -18.8801 0.282
sll1776 Forward -283 -264 -27.8282 0.299
sll1775 Reverse -53 -72 -17.9951 0.281
sll1774 Forward -84 -65 -18.4868 0.282
slr1869 Reverse -96 -115 -18.4868 0.282
slr1869 Reverse -328 -347 -27.8282 0.299
slr1878 Forward -180 -161 -17.9951 0.281
slr1878 Forward -96 -77 -27.8282 0.299
sll1762 Reverse -339 -358 -18.7818 0.282
sll2012 Reverse -127 -146 -27.7299 0.29
sll2011 Forward -50 -31 -27.4349 0.282
sll2011 Forward -40 -21 -27.8282 0.299
slr2144 Reverse -209 -228 -27.5332 0.282
sll1710 Forward -44 -25 -18.5851 0.282
sll1710 Forward -61 -42 -27.8282 0.299
sll1709 Forward -367 -348 -27.7299 0.29
slr1807 Forward -63 -44 -18.4868 0.282
slr1818 Reverse -321 -340 -27.8282 0.299
sll1692 Forward -78 -59 -27.5332 0.282
sll1620 Reverse -6 -25 -18.9784 0.282
slr1739 Forward -248 -229 -18.9784 0.282
slr1744 Reverse -362 -381 -27.8282 0.299
slr0852 Reverse -135 -154 -27.4349 0.282
sll0838 Forward -240 -221 -27.6315 0.282
slr0868 Reverse -256 -275 -18.7818 0.282
slr0872 Reverse -49 -68 -18.3884 0.282
sll1157 Forward -75 -56 -27.7299 0.29
slr1251 Reverse -339 -358 -27.8282 0.299
slr1986 Reverse -27 -46 -18.8801 0.282
slr1994 Reverse -15 -34 -18.7818 0.282
slr1994 Reverse -24 -43 -19.0768 0.282
slr1994 Reverse -69 -88 -27.7299 0.29
slr2000 Reverse -191 -210 -27.6315 0.282
sll1902 Forward -179 -160 -18.7818 0.282
ssr3402 Reverse -175 -194 -18.7818 0.282
slr2004 Reverse -311 -330 -18.5851 0.282
slr1722 Reverse -300 -319 -27.7299 0.29
sll1600 Reverse -122 -141 -27.5332 0.282
slr1729 Reverse -98 -117 -8.65367 0.177
slr0265 Forward -44 -25 -18.5851 0.282
slr0265 Forward -61 -42 -27.8282 0.299
sll0244 Forward -219 -200 -27.7299 0.29
ssl0453 Reverse -36 -55 -18.9784 0.282
slr0272 Forward -52 -33 -19.0768 0.282
slr2079 Forward -53 -34 -27.7299 0.29
slr2083 Reverse -356 -375 -27.6315 0.282
sll1982 Reverse -371 -390 -18.0934 0.281
slr2096 Forward -75 -56 -27.7299 0.29
slr2098 Reverse -208 -227 -18.4868 0.282
slr2099 Reverse -259 -278 -18.5851 0.282
slr2099 Reverse -94 -113 -27.6315 0.282
slr2099 Forward -258 -239 -27.6315 0.282
slr2103 Forward -180 -161 -27.6315 0.282
slr2104 Forward -316 -297 -18.2901 0.282
sll1425 Forward -346 -327 -19.2734 0.282
sll1423 Forward -240 -221 -19.1751 0.282
slr1506 Reverse -195 -214 -19.1751 0.282
slr1509 Reverse -86 -105 -27.8282 0.299
sll1418 Reverse -6 -25 -27.8282 0.299
ssr2551 Reverse -18 -37 -19.1751 0.282
slr1522 Forward -131 -112 -17.9951 0.281
slr2122 Reverse -366 -385 -27.2382 0.282
slr2127 Forward -354 -335 -19.1751 0.282
ssr2194 Forward -174 -155 -27.8282 0.299
sll1232 Forward -154 -135 -19.1751 0.282
sll1223 Reverse -25 -44 -19.1751 0.282
sll1220 Forward -143 -124 -27.7299 0.29
sll0819 Reverse -177 -196 -18.7818 0.282
sll0819 Reverse -210 -229 -19.1751 0.282
sll0810 Forward -205 -186 -9.44032 0.281
sll0810 Forward -228 -209 -27.6315 0.282
slr0820 Forward -363 -344 -19.0768 0.282
sll0803 Forward -142 -123 -27.3366 0.282
sll1255 Forward -240 -221 -18.3884 0.282
slr1343 Reverse -249 -268 -17.7985 0.281
sll1249 Forward -293 -274 -18.4868 0.282
slr1350 Reverse -240 -259 -27.8282 0.299
sll1247 Forward -240 -221 -27.8282 0.299
slr1351 Forward -330 -311 -27.6315 0.282
slr1351 Reverse -13 -32 -27.8282 0.299
slr1958 Forward -76 -57 -19.0768 0.282
ssl3573 Forward -258 -239 -18.4868 0.282
sll1894 Forward -273 -254 -27.6315 0.282
sll1890 Forward -214 -195 -27.6315 0.282
ssl3549 Reverse -91 -110 -18.6834 0.282
ssl3549 Forward -225 -206 -27.5332 0.282
slr1972 Forward -92 -73 -18.6834 0.282
sll1882 Forward -107 -88 -19.2734 0.282
slr1975 Reverse -137 -156 -19.2734 0.282
slr1979 Reverse -201 -220 -18.4868 0.282
slr1979 Forward -149 -130 -18.8801 0.282
sll1874 Forward -165 -146 -27.8282 0.299
sll1387 Reverse -73 -92 -27.8282 0.299
sll1386 Reverse -79 -98 -17.9951 0.281
sll1386 Reverse -70 -89 -27.8282 0.299
slr1467 Reverse -277 -296 -27.7299 0.29
slr1467 Forward -20 -1 -27.8282 0.299
slr1471 Forward -285 -266 -18.9784 0.282
sll1384 Forward -54 -35 -27.7299 0.29
sll1180 Forward -105 -86 -27.8282 0.299
slr1265 Reverse -255 -274 -27.8282 0.299
sll1178 Reverse -152 -171 -27.5332 0.282
slr1270 Reverse -344 -363 -18.3884 0.282
slr1272 Forward -196 -177 -18.4868 0.282
slr1272 Forward -186 -167 -18.5851 0.282
slr1278 Forward -263 -244 -27.6315 0.282
slr1288 Reverse -336 -355 -27.7299 0.29
sll1166 Reverse -16 -35 -18.9784 0.282
sll1435 Reverse -66 -85 -27.6315 0.282
sll1432 Reverse -100 -119 -27.7299 0.29
slr1533 Forward -83 -64 -27.7299 0.29
sll1096 Forward -208 -189 -19.0768 0.282
sll1095 Reverse -267 -286 -18.5851 0.282
ssl2153 Forward -198 -179 -18.7818 0.282
slr1163 Reverse -27 -46 -18.9784 0.282
slr1168 Reverse -145 -164 -9.047 0.281
sll1558 Reverse -315 -334 -18.1918 0.282
sll0920 Reverse -8 -27 -27.7299 0.29
slr0937 Reverse -162 -181 -27.4349 0.282
slr0944 Reverse -228 -247 -19.4701 0.282
slr0947 Reverse -101 -120 -27.8282 0.299
slr0950 Forward -376 -357 -27.6315 0.282
sll0911 Forward -281 -262 -27.8282 0.299
slr0951 Reverse -261 -280 -19.1751 0.282
slr0955 Reverse -207 -226 -27.7299 0.29
slr0960 Forward -157 -138 -18.8801 0.282
slr1623 Forward -355 -336 -18.3884 0.282
sll1530 Reverse -72 -91 -27.8282 0.299
sll1521 Reverse -30 -49 -27.5332 0.282
ssr0761 Reverse -308 -327 -17.9951 0.281
sll0424 Reverse -73 -92 -18.4868 0.282
slr0445 Reverse -135 -154 -18.5851 0.282
slr0445 Forward -338 -319 -27.8282 0.299
sll0271 Reverse -56 -75 -19.2734 0.282
sll0270 Forward -31 -12 -18.5851 0.282
sll0264 Reverse -236 -255 -19.2734 0.282
sll0263 Forward -171 -152 -9.63698 0.281
slr0285 Reverse -210 -229 -18.4868 0.282
slr0285 Reverse -87 -106 -27.5332 0.282
sll0260 Reverse -313 -332 -18.5851 0.282
slr0287 Forward -266 -247 -18.5851 0.282
slr0287 Reverse -70 -89 -27.8282 0.299
sll0257 Forward -189 -170 -17.8968 0.281
slr0394 Forward -141 -122 -27.5332 0.282
sll0361 Reverse -96 -115 -27.7299 0.29
slr0398 Reverse -96 -115 -18.4868 0.282
slr0401 Reverse -197 -216 -18.6834 0.282
sll0356 Reverse -62 -81 -18.8801 0.282
sll0354 Forward -308 -289 -19.1751 0.282
slr0406 Reverse -173 -192 -19.1751 0.282
slr0408 Forward -340 -321 -19.0768 0.282
slr0142 Reverse -355 -374 -18.6834 0.282
sll0145 Reverse -160 -179 -18.1918 0.282
slr0165 Reverse -342 -361 -27.5332 0.282
ssl0242 Reverse -355 -374 39.0369 0.000000369
slr1001 Reverse -133 -152 39.0369 0.000000369
ssr0256 Forward -157 -138 39.0369 0.000000369
slr0166 Forward -332 -313 39.0369 0.000000369
slr1924 Reverse -136 -155 -27.8282 0.299
sll1861 Forward -44 -25 -18.5851 0.282
sll1861 Forward -61 -42 -27.8282 0.299
sll1860 Forward -44 -25 -18.5851 0.282
sll1860 Forward -61 -42 -27.8282 0.299
slr1933 Reverse -381 -400 -18.5851 0.282
slr1933 Reverse -364 -383 -27.8282 0.299
ssr3307 Forward -210 -191 -18.1918 0.282
slr1949 Reverse -294 -313 -27.8282 0.299
slr0990 Reverse -53 -72 -27.7299 0.29
slr0992 Forward -346 -327 -18.9784 0.282
slr0993 Reverse -261 -280 -9.24366 0.281
sll0300 Reverse -364 -383 -27.8282 0.299
slr0327 Forward -198 -179 -27.8282 0.299
ssl0564 Reverse -225 -244 -18.1918 0.282
slr0334 Reverse -28 -47 -19.1751 0.282
ssr0536 Reverse -32 -51 -18.8801 0.282
slr0337 Forward -133 -114 -27.7299 0.29
sll0171 Reverse -291 -310 -18.6834 0.282
sll0163 Forward -66 -47 -19.0768 0.282
sll0161 Forward -332 -313 39.0369 0.000000369
ssl0296 Forward -157 -138 39.0369 0.000000369
slr0181 Reverse -277 -296 39.0369 0.000000369
ssl0294 Forward -70 -51 -18.2901 0.282
sll0157 Reverse -157 -176 -27.4349 0.282
slr0362 Forward -175 -156 -18.0934 0.281
sml0001 Forward -95 -76 -18.3884 0.282
slr0363 Reverse -21 -40 -18.3884 0.282
slr0364 Forward -247 -228 -18.2901 0.282
slr0370 Forward -185 -166 -27.0416 0.282
slr0370 Forward -184 -165 -27.3366 0.282
slr0380 Reverse -86 -105 -18.9784 0.282
sll0327 Forward -218 -199 -27.5332 0.282
slr0386 Reverse -98 -117 -27.5332 0.282
slr0387 Forward -292 -273 -27.7299 0.29
slr1003 Forward -310 -291 -18.4868 0.282
sll0318 Reverse -121 -140 -18.5851 0.282
sll0318 Reverse -104 -123 -27.8282 0.299
slr0350 Forward -44 -25 -18.5851 0.282
slr0350 Forward -61 -42 -27.8282 0.299
sll0022 Reverse -64 -83 -19.5684 0.282
slr0001 Forward -159 -140 -19.5684 0.282
sll0021 Forward -162 -143 -27.7299 0.29
sll0018 Forward -107 -88 -19.2734 0.282
slr0014 Forward -193 -174 -18.0934 0.281
slr0014 Reverse -371 -390 -18.5851 0.282
sll0012 Forward -44 -25 -18.5851 0.282
sll0012 Forward -61 -42 -27.8282 0.299
slr0015 Reverse -71 -90 -18.5851 0.282
slr0015 Reverse -54 -73 -27.8282 0.299
slr0021 Forward -375 -356 -18.0934 0.281
slr0230 Forward -391 -372 -27.8282 0.299
sll0191 Reverse -116 -135 -27.6315 0.282
ssl0788 Forward -120 -101 -18.0934 0.281
ssl0788 Forward -119 -100 -27.5332 0.282
sll0413 Forward -339 -320 -19.1751 0.282
sll0409 Reverse -278 -297 -18.5851 0.282
sll0405 Reverse -222 -241 -19.0768 0.282
sll0404 Forward -153 -134 -18.5851 0.282
slr0438 Reverse -1 -20 -18.5851 0.282
slr0438 Forward -163 -144 -27.6315 0.282
sll0402 Reverse -25 -44 -18.8801 0.282
slr0049 Forward -214 -195 -9.53865 0.281
ssr0102 Forward -90 -71 -18.1918 0.282
slr0050 Forward -380 -361 -18.1918 0.282
slr0055 Forward -47 -28 -27.7299 0.29
sll0058 Forward -142 -123 -27.4349 0.282
slr0069 Forward -235 -216 -27.7299 0.29
slr0070 Reverse -312 -331 -18.4868 0.282
slr0468 Forward -137 -118 -9.14533 0.281
slr0469 Forward -361 -342 -8.85033 0.278
slr0487 Reverse -333 -352 -18.9784 0.282
slr0489 Forward -356 -337 -27.8282 0.299
slr0492 Forward -69 -50 -27.8282 0.299
sll0690 Reverse -91 -110 -27.4349 0.282
sll0689 Forward -392 -373 -27.8282 0.299
sll0688 Reverse -229 -248 0.294447 0.0967
sll0684 Forward -212 -193 -27.7299 0.29
sll0679 Reverse -304 -323 -18.8801 0.282
slr0634 Forward -279 -260 39.0369 0.000000369
slr0634 Reverse -230 -249 -18.5851 0.282
slr0634 Reverse -213 -232 -27.8282 0.299
sll0602 Reverse -259 -278 -18.5851 0.282
slr0646 Reverse -322 -341 -18.8801 0.282
slr0415 Forward -137 -118 -18.0934 0.281
slr0418 Forward -34 -15 -18.7818 0.282
ssr0693 Reverse -343 -362 -18.8801 0.282
sll0373 Reverse -368 -387 -18.3884 0.282
ssl0738 Reverse -368 -387 -19.4701 0.282
sll0370 Forward -236 -217 -27.7299 0.29
sll0189 Forward -129 -110 -18.4868 0.282
slr0192 Reverse -378 -397 -18.5851 0.282
sll0185 Reverse -97 -116 -27.6315 0.282
sll0182 Forward -218 -199 -19.2734 0.282
sll0180 Forward -167 -148 -19.1751 0.282
slr0204 Reverse -90 -109 -19.1751 0.282
slr0212 Forward -278 -259 -27.8282 0.299
sll0887 Forward -232 -213 -27.6315 0.282
slr0899 Forward -348 -329 -27.5332 0.282
slr0919 Forward -330 -311 -27.8282 0.299
slr0923 Forward -64 -45 -27.8282 0.299
sll0547 Forward -297 -278 -27.6315 0.282
slr0842 Reverse -76 -95 -9.83364 0.281
slr0076 Reverse -16 -35 -27.6315 0.282
slr0076 Forward -191 -172 -27.8282 0.299
slr0079 Reverse -230 -249 -27.5332 0.282
slr0082 Forward -321 -302 -27.6315 0.282
slr0084 Reverse -235 -254 -18.5851 0.282
slr0092 Reverse -354 -373 -18.8801 0.282
slr0095 Reverse -348 -367 -18.2901 0.282
slr0095 Reverse -347 -366 -18.3884 0.282
sll0487 Reverse -1 -20 -18.7818 0.282
sll0482 Forward -399 -380 -18.4868 0.282
ssr0871 Forward -126 -107 -17.9951 0.281
slr0511 Forward -340 -321 -17.9951 0.281
slr0511 Forward -44 -25 -18.5851 0.282
slr0511 Forward -61 -42 -27.8282 0.299
slr0516 Reverse -79 -98 -27.6315 0.282
slr0517 Forward -52 -33 -19.2734 0.282
slr0522 Reverse -61 -80 -19.2734 0.282
sll0470 Forward -307 -288 -18.5851 0.282
sll0467 Reverse -10 -29 -19.3717 0.282
sll0594 Forward -146 -127 -27.5332 0.282
ssr1041 Reverse -351 -370 -18.9784 0.282
sll0586 Reverse -246 -265 -18.8801 0.282
slr0623 Forward -118 -99 -18.8801 0.282
sll0584 Reverse -306 -325 -27.7299 0.29
slr0626 Forward -363 -344 -27.3366 0.282
slr0099 Forward -131 -112 -27.5332 0.282
sll0108 Forward -58 -39 -18.0934 0.281
sll0107 Forward -108 -89 -18.9784 0.282
slr0103 Forward -289 -270 -18.1918 0.282
slr0103 Reverse -12 -31 -18.9784 0.282
sll0098 Forward -219 -200 -19.1751 0.282
slr0108 Reverse -19 -38 -19.1751 0.282
slr0114 Reverse -309 -328 -27.5332 0.282
slr0116 Reverse -27 -46 -27.7299 0.29
sll0092 Reverse -341 -360 -27.7299 0.29
sll0286 Reverse -34 -53 -27.6315 0.282
sll0284 Reverse -20 -39 -17.8968 0.281
sll0283 Forward -229 -210 -9.63698 0.281
slr0309 Reverse -261 -280 -9.63698 0.281
sll0281 Reverse -101 -120 -9.047 0.281
sll0798 Reverse -284 -303 -18.3884 0.282
sll0797 Reverse -273 -292 -27.4349 0.282
ssl1464 Forward -170 -151 -18.9784 0.282
slr0699 Reverse -95 -114 -18.7818 0.282
slr0702 Forward -219 -200 -18.5851 0.282
sll0677 Forward -44 -25 -18.5851 0.282
sll0677 Forward -61 -42 -27.8282 0.299
slr0703 Forward -44 -25 -18.5851 0.282
slr0703 Forward -61 -42 -27.8282 0.299
sll0672 Reverse -67 -86 -19.0768 0.282
sll0672 Forward -227 -208 -27.7299 0.29
sll0665 Forward -44 -25 -18.5851 0.282
sll0665 Forward -61 -42 -27.8282 0.299
slr0711 Forward -225 -206 -17.9951 0.281
sll0660 Reverse -247 -266 -9.047 0.281
slr0713 Forward -53 -34 -9.047 0.281
sll0737 Forward -46 -27 -8.55534 0.147
sll0044 Reverse -1 -20 -27.8282 0.299
slr0535 Forward -278 -259 -27.8282 0.299
sll0507 Reverse -203 -222 -27.3366 0.282
slr0925 Reverse -234 -253 -27.7299 0.29
sll0537 Reverse -124 -143 -27.6315 0.282
slr0550 Forward -304 -285 -18.7818 0.282
slr0550 Reverse -46 -65 -18.7818 0.282
slr0550 Forward -274 -255 -27.6315 0.282
sll0524 Reverse -86 -105 -18.5851 0.282
slr0557 Forward -42 -23 -18.5851 0.282
sll1365 Forward -357 -338 -18.4868 0.282
slr0654 Reverse -380 -399 -18.6834 0.282
slr0668 Forward -347 -328 -18.1918 0.282
sll1496 Forward -110 -91 -27.5332 0.282
slr1559 Forward -365 -346 -27.8282 0.299
slr1565 Reverse -232 -251 -27.7299 0.29
slr1566 Reverse -26 -45 -18.3884 0.282
sll1489 Forward -170 -151 -27.4349 0.282
sll1489 Reverse -273 -292 -27.8282 0.299
slr1576 Reverse -227 -246 -18.8801 0.282
sll1484 Forward -260 -241 -19.2734 0.282
sll1482 Forward -216 -197 -9.34199 0.281
sll1481 Reverse -364 -383 -27.5332 0.282
sll1471 Reverse -92 -111 -27.7299 0.29
slr1584 Forward -147 -128 -27.7299 0.29
sll0732 Reverse -1 -20 -27.8282 0.299
sll0726 Forward -245 -226 -18.8801 0.282
slr0756 Forward -382 -363 -18.6834 0.282
slr0756 Reverse -97 -116 -18.8801 0.282
slr0758 Forward -168 -149 -27.6315 0.282
slr1656 Forward -161 -142 -27.6315 0.282
slr1659 Reverse -347 -366 -18.0934 0.281
ssr2786 Reverse -69 -88 -27.6315 0.282
sll0451 Forward -23 -4 -18.5851 0.282
sll0448 Reverse -205 -224 -18.9784 0.282
sll0447 Reverse -303 -322 -19.0768 0.282
sll0443 Forward -400 -381 -18.5851 0.282
slr0451 Reverse -3 -22 -18.5851 0.282
slr0460 Forward -131 -112 -27.4349 0.282
sll1106 Reverse -120 -139 -27.7299 0.29
slr1192 Forward -80 -61 -27.7299 0.29
slr0596 Forward -239 -220 9.93088 0.00897
slr0597 Reverse -302 -321 -18.7818 0.282
slr0602 Forward -39 -20 -19.3717 0.282
slr0607 Forward -391 -372 -27.8282 0.299
slr0609 Forward -270 -251 -27.8282 0.299
ssl5025 Forward -230 -211 -27.8282 0.299
ssl5039 Reverse -82 -101 -18.5851 0.282
ssl5039 Reverse -65 -84 -27.8282 0.299
slr5040 Forward -182 -163 -18.5851 0.282
slr5040 Forward -199 -180 -27.8282 0.299
slr5051 Reverse -80 -99 -27.7299 0.29
slr5054 Reverse -278 -297 -27.6315 0.282
slr5056 Forward -388 -369 -18.9784 0.282
slr5058 Forward -352 -333 -27.8282 0.299
sll5060 Reverse -11 -30 -17.6018 0.281
ssl5068 Reverse -280 -299 -18.2901 0.282
sll5084 Forward -255 -236 -27.5332 0.282
ssl5103 Forward -242 -223 -27.6315 0.282
ssr5106 Reverse -206 -225 -18.4868 0.282
slr7011 Reverse -345 -364 -18.3884 0.282
slr7012 Reverse -8 -27 -19.3717 0.282
slr7016 Forward -311 -292 -18.2901 0.282
sll7031 Reverse -99 -118 -18.4868 0.282
ssl7039 Reverse -215 -234 -27.7299 0.29
slr7041 Forward -145 -126 -27.7299 0.29
ssl7053 Forward -138 -119 -27.5332 0.282
slr7088 Forward -200 -181 -27.6315 0.282
sll7089 Reverse -184 -203 -18.7818 0.282
slr7094 Reverse -23 -42 -18.6834 0.282
slr7095 Reverse -378 -397 -8.65367 0.177
ssl8024 Reverse -38 -57 -27.8282 0.299
sll8048 Forward -392 -373 -18.2901 0.282
ssr6002 Forward -194 -175 -19.2734 0.282
slr6015 Forward -209 -190 -18.4868 0.282
slr6022 Forward -193 -174 -18.6834 0.282
ssl6023 Reverse -260 -279 -27.4349 0.282
ssr6024 Reverse -304 -323 -9.24366 0.281
slr6025 Forward -268 -249 -27.4349 0.282
ssr6027 Reverse -320 -339 -19.1751 0.282
slr6028 Forward -342 -323 -19.8634 0.282
ssl6035 Reverse -206 -225 -18.4868 0.282
slr6038 Forward -242 -223 -27.6315 0.282
slr6044 Reverse -36 -55 -27.6315 0.282
slr6051 Reverse -321 -340 -18.8801 0.282
slr6074 Forward -209 -190 -18.4868 0.282
slr6081 Forward -193 -174 -18.6834 0.282
ssl6082 Reverse -260 -279 -27.4349 0.282
ssr6083 Reverse -304 -323 -9.24366 0.281
slr6084 Forward -268 -249 -27.4349 0.282
ssr6086 Reverse -320 -339 -19.1751 0.282
slr6087 Forward -342 -323 -19.8634 0.282
slr6096 Forward -279 -260 -19.1751 0.282
sll6098 Reverse -68 -87 -18.8801 0.282
ssr6099 Forward -114 -95 -18.8801 0.282
slr6107 Reverse -277 -296 -18.3884 0.282
6803t01 Forward -293 -274 -18.3884 0.282
6803t02 Forward -228 -209 -18.5851 0.282
6803t07 Forward -45 -26 -27.8282 0.299
6803t09 Reverse -233 -252 -27.4349 0.282
6803t12 Forward -160 -141 -18.0934 0.281
6803t13 Forward -83 -64 -18.4868 0.282
6803t15 Reverse -173 -192 -27.5332 0.282
6803t16 Reverse -323 -342 -27.7299 0.29
6803t24 Forward -282 -263 -27.6315 0.282
6803t26 Reverse -275 -294 -18.5851 0.282
6803t28 Forward -132 -113 -18.4868 0.282
6803t37 Forward -389 -370 -18.3884 0.282
6803r01 Reverse -61 -80 -18.6834 0.282
6803r06 Reverse -61 -80 -18.6834 0.282
ORF Direction Start Stop Score q-value

TOMTOM

TOMTOM is an application for comparing motifs to known motifs in existing databases. Here's the possibility of running TOMTOM on this motif against the Prodoric or RegTransBase database. It can take up to 1 minute before the results show up, depending on server load. If you want to run TOMTOM against other databases, or with more custom settings, please visit the TOMTOM website.

Options

PSPM

1.000  0.000  0.000  0.000  
1.000 0.000 0.000 0.000
0.000 0.000 0.000 1.000
0.000 0.000 0.000 1.000
0.000 0.000 1.000 0.000
0.000 0.000 1.000 0.000
0.000 0.000 1.000 0.000
1.000 0.000 0.000 0.000
1.000 0.000 0.000 0.000
1.000 0.000 0.000 0.000
1.000 0.000 0.000 0.000
1.000 0.000 0.000 0.000
0.000 0.000 0.000 1.000
0.000 0.000 1.000 0.000
0.000 0.000 1.000 0.000
0.000 0.000 0.000 1.000
0.000 0.000 1.000 0.000
1.000 0.000 0.000 0.000
1.000 0.000 0.000 0.000
0.000 0.000 1.000 0.000