Your browser is old and dusty. Try Google Chrome!

Details for ssr8013

ORF ssr8013
Accession NP_942407.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Reverse -289 -308 -28.2215 0.203
NP_440815.1_2 Reverse -330 -344 10.422 0.265
NP_440897.1_6 Forward -103 -84 -2.95123 0.227
NP_441453.1_7 Reverse -251 -258 12.9205 0.23
NP_441453.1_7 Forward -322 -315 11.6422 0.298
NP_441818.1_9 Forward -190 -171 -9.93197 0.291
NP_442287.1_1 Reverse -241 -251 13.5492 0.277
NP_443002.1_5 Forward -227 -209 8.08151 0.299
NP_441745.1_5 Forward -264 -245 11.7992 0.112
NP_441812.1_1 Reverse -335 -349 13.5686 0.231
NP_442062.1_8 Forward -252 -242 4.89658 0.193
NP_441859.1_3 Forward -159 -140 2.6536 0.258
NP_440044.1_8 Reverse -261 -280 0.196116 0.203
NP_441594.1_6 Forward -272 -253 6.58763 0.189
NP_441491.1_6 Reverse -72 -86 15.7591 0.21
NP_441083.1_5 Forward -298 -288 5.38824 0.12
NP_440209.1_1 Forward -140 -132 2.08437 0.286
NP_440870.1_4 Reverse -254 -272 12.8022 0.0783
NP_442889.1_1 Reverse -301 -320 -11.0136 0.217
NP_440407.1_6 Forward -321 -307 13.9626 0.212
NP_441713.1_1 Forward -340 -321 -16.3235 0.28
NP_441770.1_4 Reverse -72 -91 0.196116 0.179
NP_441716.1_1 Forward -269 -255 5.60446 0.224
NP_440851.1_6 Reverse -304 -321 -0.0594896 0.288
NP_440747.1_10 Reverse -286 -298 -12.1541 0.227
NP_441014.1_9 Reverse -178 -197 6.78429 0.217
NP_441014.1_10 Reverse -148 -167 11.11 0.118
NP_441012.1_4 Reverse -183 -196 5.91914 0.286
NP_441634.1_3 Reverse -357 -376 17.6007 0.096
NP_441634.1_8 Forward -271 -257 -0.295402 0.252
NP_440376.1_1 Forward -252 -243 4.42462 0.159
NP_442687.1_7 Reverse -242 -252 3.61828 0.299
NP_442485.1_3 Reverse -358 -377 -5.80207 0.296
NP_440642.1_10 Reverse -85 -99 1.5723 0.29
NP_442658.1_1 Reverse -241 -251 7.84605 0.205
NP_442544.1_2 Forward -324 -310 -0.393733 0.22
NP_442937.1_5 Reverse -284 -303 6.58763 0.275
NP_442321.1_4 Reverse -353 -372 -8.55534 0.289
NP_442836.1_10 Reverse -290 -300 8.73149 0.299
NP_441941.1_9 Reverse -297 -316 0.687771 0.268
NP_442064.1_4 Forward -107 -88 5.89851 0.26
NP_443055.1_6 Reverse -243 -261 2.57501 0.206
NP_440138.1_6 Reverse -316 -335 3.14526 0.246
NP_440615.1_2 Forward -244 -225 4.52268 0.296
NP_443020.1_4 Reverse -347 -366 17.0099 0.232
NP_440147.1_4 Reverse -241 -254 0.60927 0.249
NP_442004.1_6 Reverse -254 -268 5.70279 0.184
NP_441725.1_5 Reverse -182 -192 -0.806614 0.271
NP_440983.1_5 Forward -384 -365 0.0977854 0.217
NP_441678.1_9 Forward -335 -316 -5.70374 0.299
NP_442281.1_1 Forward -29 -15 2.75226 0.257
NP_440395.1_6 Reverse -248 -267 11.1109 0.273
NP_440479.1_6 Reverse -334 -348 13.2736 0.282
NP_442500.1_8 Reverse -340 -354 11.4317 0.261
NP_442049.1_6 Reverse -281 -300 3.24438 0.276
NP_442982.1_5 Forward -99 -80 -3.04881 0.293
NP_440867.1_10 Reverse -282 -301 4.32602 0.283
NP_442215.1_2 Reverse -241 -257 -0.43312 0.167
NP_441751.2_8 Reverse -255 -269 -5.50694 0.214
NP_442142.1_4 Reverse -128 -141 4.34528 0.223
NP_441020.2_6 Forward -371 -354 6.52869 0.262
NP_441673.1_1 Reverse -243 -252 -8.06341 0.254
NP_442490.1_10 Forward -302 -284 8.67227 0.264
NP_442719.1_2 Forward -394 -376 -10.4046 0.273
NP_441612.1_2 Forward -90 -80 15.5198 0.209
NP_442808.1_1 Reverse -130 -140 6.56775 0.107
NP_442808.1_1 Reverse -242 -252 6.37109 0.116
NP_442808.1_1 Forward -299 -289 0.864583 0.3
NP_440752.1_8 Reverse -207 -226 12.3892 0.213
NP_442113.1_10 Reverse -174 -193 -8.16202 0.278
NP_442903.1_2 Reverse -333 -352 3.48503 0.242
NP_442342.1_7 Forward -219 -200 15.5938 0.246
NP_441114.1_3 Reverse -309 -318 17.1093 0.113
NP_440558.1_2 Reverse -212 -231 -5.9004 0.267
NP_441878.1_6 Forward -253 -243 -6.8048 0.196
NP_441878.1_6 Forward -191 -181 -7.29646 0.217
NP_441433.1_8 Reverse -364 -383 2.26107 0.223
NP_442397.1_9 Forward -236 -217 1.96607 0.283
NP_442645.1_2 Reverse -299 -318 -17.2085 0.25
NP_442508.1_8 Reverse -283 -300 13.2152 0.256
NP_441633.1_3 Reverse -241 -254 2.57589 0.0926
NP_442590.1_10 Reverse -247 -266 3.24438 0.294
NP_442998.1_5 Reverse -374 -384 10.2065 0.222
NP_441229.1_1 Reverse -96 -111 14.0412 0.243
NP_442283.1_6 Reverse -370 -389 16.8141 0.189
NP_441559.1_8 Reverse -303 -317 -5.11362 0.248
NP_441270.1_4 Reverse -212 -231 17.8948 0.245
NP_442158.1_4 Forward -344 -334 15.9097 0.129
NP_441866.1_3 Forward -162 -149 11.524 0.242
NP_441866.1_6 Forward -331 -312 6.78348 0.285
NP_442452.1_4 Forward -318 -299 13.6675 0.165
NP_442866.1_1 Reverse -176 -195 -5.80207 0.245
NP_442386.1_9 Forward -379 -370 5.40752 0.253
NP_440161.1_3 Reverse -179 -198 10.3242 0.23
NP_441134.1_10 Forward -326 -308 10.5406 0.238
NP_440586.1_8 Forward -23 -16 7.02027 0.279
NP_440926.1_9 Reverse -199 -218 13.1758 0.19
NP_442239.1_8 Forward -372 -353 6.68596 0.263
NP_441138.1_5 Forward -354 -341 2.92653 0.297
NP_440316.1_10 Forward -317 -307 7.15819 0.251
NP_440476.1_1 Reverse -49 -68 19.4339 0.165
NP_441018.1_3 Forward -353 -334 12.29 0.286
NP_442790.1_4 Forward -129 -110 -13.9635 0.27
NP_441689.1_5 Reverse -64 -74 7.0594 0.197
NP_440163.1_10 Forward -193 -183 8.73149 0.262
NP_441060.1_1 Forward -359 -340 13.2525 0.294
NP_441335.1_8 Forward -270 -251 6.98095 0.281
NP_440297.1_9 Reverse -182 -192 0.176696 0.282
NP_442187.1_3 Reverse -288 -298 14.6313 0.165
NP_442280.1_10 Reverse -304 -322 6.13623 0.28
NP_441896.1_3 Reverse -369 -388 7.27595 0.0973
NP_440894.1_10 Reverse -238 -257 2.94938 0.279
NP_440888.1_2 Reverse -111 -125 5.99717 0.254
NP_440822.1_8 Forward -376 -357 6.78429 0.286
NP_441834.1_10 Reverse -302 -321 0.0977854 0.299
NP_442637.1_1 Forward -325 -306 -2.45882 0.16
NP_440710.1_1 Reverse -173 -191 -7.749 0.244
NP_443062.1_6 Forward -198 -179 6.98095 0.178
NP_440516.1_8 Reverse -289 -298 -0.295266 0.232
NP_442120.1_10 Reverse -357 -376 -6.49039 0.211
NP_442120.1_10 Reverse -213 -232 -15.9302 0.296
NP_441867.1_2 Forward -375 -356 -11.3086 0.223
NP_441052.1_2 Reverse -260 -270 10.2065 0.0295
NP_441052.1_2 Forward -24 -14 0.668351 0.256
NP_442219.1_8 Forward -107 -88 13.0954 0.153
NP_442412.1_3 Reverse -303 -322 9.73422 0.286
NP_442813.1_2 Forward -232 -213 1.86774 0.25
NP_442694.1_4 Forward -253 -244 11.6028 0.277
NP_443054.1_2 Forward -374 -360 8.75105 0.109
NP_443054.1_2 Reverse -241 -255 0.0979218 0.278
NP_443054.1_2 Forward -230 -216 -0.197071 0.288
NP_442208.1_5 Reverse -197 -216 -7.57203 0.274
NP_442001.1_4 Forward -32 -13 6.58682 0.29
NP_441982.1_7 Reverse -378 -397 19.764 0.142
NP_440432.1_9 Reverse -244 -259 -4.54333 0.211
NP_442843.1_1 Reverse -370 -389 -4.72043 0.239
NP_442843.1_1 Forward -377 -358 -6.88371 0.245
NP_439960.1_10 Reverse -282 -300 -3.42244 0.273
NP_440793.1_1 Reverse -76 -90 9.73373 0.293
NP_440526.1_3 Reverse -244 -255 6.54802 0.195
NP_441732.1_2 Forward -94 -78 -15.6744 0.155
NP_440760.1_1 Reverse -243 -262 -21.3384 0.234
NP_441057.1_4 Forward -388 -370 -2.14413 0.272
NP_442489.1_7 Forward -252 -243 -1.77023 0.247
NP_441659.2_8 Reverse -181 -191 2.53664 0.198
NP_442913.1_10 Forward -261 -242 0.196116 0.155
NP_442346.1_5 Forward -191 -181 5.87989 0.225
NP_442346.1_10 Forward -271 -252 -3.24547 0.294
NP_441629.1_3 Reverse -174 -193 0.392004 0.235
NP_441744.1_6 Forward -255 -236 16.991 0.217
NP_442934.1_9 Forward -165 -147 16.9321 0.169
NP_441943.1_8 Forward -326 -307 -12.6852 0.261
NP_442551.1_4 Reverse -305 -320 -1.29841 0.245
NP_441168.1_7 Reverse -291 -310 15.6341 0.278
NP_442547.1_2 Reverse -239 -258 20.5506 0.036
NP_441813.1_3 Reverse -199 -218 13.8495 0.272
NP_440665.1_1 Reverse -181 -200 -11.8003 0.244
NP_440665.1_1 Forward -202 -183 -16.4218 0.288
NP_442105.1_1 Forward -150 -131 16.1257 0.0707
NP_441874.1_1 Forward -100 -86 13.3726 0.214
NP_440546.1_4 Reverse -250 -260 6.55553 0.291
NP_441879.1_8 Reverse -72 -91 12.0933 0.181
NP_441811.1_1 Reverse -298 -317 4.32602 0.285
NP_440825.1_6 Forward -359 -340 7.96426 0.285
NP_442837.1_3 Reverse -150 -157 6.82395 0.184
NP_440160.1_9 Reverse -200 -219 12.0942 0.216
NP_440520.1_1 Forward -270 -251 -5.01543 0.289
NP_441252.1_6 Forward -319 -312 14.3954 0.168
NP_442471.1_4 Reverse -132 -151 15.9282 0.288
NP_440914.1_1 Forward -316 -306 8.41992 0.191
NP_442101.1_10 Reverse -7 -26 -8.35868 0.233
NP_442533.1_6 Forward -24 -15 2.26134 0.266
NP_442533.1_6 Forward -190 -181 1.67135 0.293
NP_442322.1_9 Reverse -40 -58 9.16315 0.297
NP_441028.1_6 Reverse -83 -93 14.6309 0.158
NP_441028.1_6 Reverse -224 -234 5.19112 0.265
NP_441527.1_4 Forward -95 -76 -10.4568 0.27
NP_441527.1_7 Reverse -76 -95 8.65176 0.282
NP_441170.1_4 Reverse -252 -270 6.214 0.208
NP_441972.1_5 Reverse -309 -328 -9.93197 0.294
NP_441930.1_2 Forward -317 -307 15.6147 0.19
NP_441930.1_2 Reverse -307 -317 11.8781 0.271
NP_440886.1_7 Forward -299 -289 5.78111 0.163
NP_440886.1_7 Reverse -87 -97 4.30615 0.243
NP_441808.1_8 Reverse -302 -321 7.57094 0.277
NP_441021.1_1 Reverse -193 -212 -12.3902 0.286
NP_441463.1_6 Forward -271 -257 8.73514 0.25
NP_442362.1_7 Forward -376 -358 10.1472 0.287
NP_441460.1_5 Reverse -76 -90 16.2235 0.204
NP_442238.1_1 Forward -80 -61 0.687771 0.269
NP_441962.1_4 Forward -257 -238 -11.3086 0.239
NP_440387.1_1 Forward -252 -236 -5.93965 0.258
NP_440855.1_1 Forward -202 -183 11.2092 0.12
NP_441993.1_1 Reverse -243 -262 0.582284 0.297
NP_442084.1_6 Forward -381 -363 10.6389 0.221
NP_440114.1_10 Forward -80 -66 10.226 0.151
NP_440311.1_2 Forward -384 -365 13.1758 0.299
NP_441720.1_2 Reverse -67 -86 3.44025 0.236
NP_440766.1_5 Forward -312 -300 9.47014 0.275
NP_439910.1_2 Forward -166 -149 -22.0856 0.207
NP_439910.1_2 Reverse -123 -140 -22.479 0.25
NP_442867.1_8 Reverse -361 -380 4.916 0.277
NP_440457.1_1 Forward -194 -182 8.79043 0.101
NP_441801.1_4 Reverse -247 -257 3.42162 0.231
NP_441984.1_3 Reverse -239 -257 4.9357 0.299
NP_442509.1_9 Reverse -243 -253 13.8442 0.0448
NP_441489.1_4 Forward -230 -216 14.7492 0.162
NP_442341.1_7 Forward -25 -11 4.32615 0.194
NP_441173.1_9 Forward -381 -373 13.1954 0.184
NP_441173.1_9 Forward -382 -374 12.9004 0.206
NP_442395.2_4 Forward -299 -280 -0.492971 0.295
NP_440191.1_5 Reverse -364 -383 18.6823 0.118
NP_440175.1_7 Forward -352 -334 8.58238 0.293
NP_442495.1_3 Reverse -10 -28 11.5239 0.259
NP_441105.1_3 Reverse -308 -327 -5.80207 0.224
NP_440216.1_9 Forward -376 -367 7.07956 0.289
NP_442329.1_8 Reverse -286 -305 5.211 0.261
NP_440416.1_9 Forward -270 -251 -20.65 0.287
NP_440072.1_5 Forward -138 -120 -3.91409 0.286
NP_442154.1_1 Forward -189 -171 -14.2388 0.217
NP_440261.1_7 Reverse -368 -387 -4.22878 0.217
NP_440988.1_10 Reverse -258 -272 7.7064 0.215
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGCATAAAGTAAGGCCGATTTTACCCAAGGCAGAGGACGCTGGAAGTGTTGTGCTGTTTTTTCTGGGTCTAAAGCATACCCTTGGGCAATGCGGACAACTTCCCAGACCGCCAGGGTAGAGTTTTTAAGATGGGCATGACGACCCAGGGGCGTTTGTCGAAATTCAATGTAGGGAAAGTCCTGCTGCCGCAAGGATTCTTCCACTAGCAGGGCGGTGGTTTCACTAGGTGTCTTACCTAAACAGCGAGCAAAACGTTGAAGTCGTTCGTGGGTTAAGTCCGGCAGACGGGTACTGACTACTATGGACATAGGGGAAAGACAACAATGGGATTTATATTGATTACAGTGTAACGAAGAGACGAGTATTTATTATCAGGCCCATCAACAAAGGTTGAGCACC

CDS

ATGACAGCGCAAGAAAAACTCTACCAACTAATTCAAACTCTGCCAGAGAAGGAAGTTAGCGAAATACTCAATTTTGCCGAGTCGCTTTGGCCAAAAGTCTCTAGCCCCAAAATTCCCGCCGGCACCCTTACCGGACTGCGGGGCATTGCCAAACCAACGGGCCCCGTACCTAGCGACGCTGAGTTACAAAGGCAATACACTGACTACCTAAAAGAGAAGTATCTGTAA

Protein

No sequence available