Your browser is old and dusty. Try Google Chrome!

Details for ssr7040

ORF ssr7040
Accession NP_942328.1
Symbol
Category Other
Definition probable cell growth regulatory protein
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -370 -384 3.93283 0.158
NP_441061.1_2 Forward -297 -283 2.5562 0.174
NP_441061.1_2 Reverse -364 -378 -2.36035 0.29
NP_440557.1_1 Forward -297 -278 -0.000545616 0.265
NP_440557.1_1 Forward -372 -353 -1.08219 0.27
NP_440795.1_7 Reverse -290 -297 12.2322 0.0614
NP_441418.1_6 Forward -298 -279 -19.4701 0.0888
NP_440815.1_5 Reverse -352 -371 10.3242 0.223
NP_441480.1_5 Reverse -162 -181 16.7157 0.11
NP_440897.1_6 Reverse -169 -188 -2.95123 0.227
NP_441453.1_4 Reverse -289 -297 6.90259 0.121
NP_441453.1_4 Forward -298 -290 5.82095 0.126
NP_441453.1_8 Forward -158 -141 11.1502 0.217
NP_442151.1_6 Forward -378 -364 5.21113 0.288
NP_442151.1_6 Reverse -369 -383 5.01447 0.298
NP_443043.1_10 Forward -389 -370 6.98095 0.161
NP_440561.1_8 Reverse -218 -237 7.47261 0.282
NP_441818.1_1 Reverse -370 -381 11.1696 0.199
NP_441818.1_9 Forward -384 -365 -8.26035 0.276
NP_441818.1_9 Reverse -324 -343 -10.227 0.292
NP_440150.1_2 Reverse -371 -390 8.35677 0.234
NP_442173.1_1 Forward -297 -289 6.01761 0.2
NP_443027.1_4 Forward -300 -290 6.66654 0.274
NP_442975.1_10 Reverse -285 -299 1.86729 0.29
NP_440784.1_7 Forward -297 -290 6.23397 0.241
NP_440784.1_7 Reverse -290 -297 6.23397 0.241
NP_442405.1_3 Forward -165 -153 18.5246 0.252
NP_441054.1_4 Reverse -159 -177 -1.06249 0.193
NP_440878.1_9 Reverse -159 -178 -2.45882 0.264
NP_442062.1_8 Reverse -169 -179 2.83163 0.293
NP_441995.1_4 Forward -124 -106 10.9331 0.282
NP_442242.1_4 Forward -297 -290 11.8388 0.0776
NP_440044.1_8 Reverse -290 -309 -1.7705 0.251
NP_441492.1_2 Reverse -341 -360 10.6192 0.129
NP_440916.1_1 Forward -326 -312 7.9644 0.284
NP_439918.1_2 Forward -53 -34 -3.24547 0.251
NP_441208.1_9 Forward -143 -129 5.60446 0.267
NP_441594.1_6 Reverse -280 -299 6.19431 0.193
NP_440132.1_1 Reverse -287 -305 10.5406 0.218
NP_441083.1_5 Reverse -169 -179 -0.314959 0.265
NP_441558.1_5 Forward -300 -281 10.4225 0.098
NP_440209.1_1 Reverse -289 -297 8.27922 0.0687
NP_441713.1_2 Forward -178 -159 14.8474 0.291
NP_440178.1_7 Reverse -288 -307 -22.5183 0.267
NP_442111.1_4 Forward -299 -285 16.8142 0.0128
NP_441163.1_1 Reverse -174 -191 8.29791 0.232
NP_440343.1_3 Reverse -39 -57 9.35981 0.184
NP_440906.1_5 Forward -297 -290 12.0355 0.0724
NP_440906.1_5 Reverse -290 -297 6.0373 0.262
NP_440906.1_9 Forward -353 -334 12.29 0.296
NP_440747.1_10 Reverse -286 -298 -2.51763 0.0509
NP_440747.1_10 Forward -181 -169 -2.71429 0.0639
NP_440747.1_10 Reverse -177 -189 -11.7607 0.142
NP_441130.1_10 Reverse -287 -301 8.06273 0.141
NP_442634.1_4 Forward -380 -366 2.2612 0.141
NP_442634.1_4 Reverse -287 -301 -4.03198 0.179
NP_441014.1_8 Forward -224 -205 -4.32711 0.249
NP_441012.1_4 Forward -296 -283 6.60746 0.278
NP_443018.1_3 Forward -297 -290 5.84064 0.174
NP_443018.1_3 Reverse -290 -297 5.54565 0.187
NP_441316.1_7 Reverse -287 -302 -2.57671 0.26
NP_441634.1_8 Reverse -287 -301 -3.83532 0.295
NP_441634.1_8 Forward -357 -343 -4.52363 0.295
NP_440376.1_1 Forward -298 -289 7.76787 0.0688
NP_440376.1_1 Forward -189 -180 4.32629 0.163
NP_440376.1_1 Reverse -169 -178 3.63797 0.2
NP_440376.1_1 Reverse -346 -355 1.86802 0.238
NP_440376.1_1 Reverse -289 -298 -0.0986038 0.285
NP_442485.1_3 Reverse -278 -297 -5.70374 0.295
NP_441846.1_10 Reverse -239 -258 -15.0452 0.243
NP_440609.1_6 Reverse -139 -158 15.5357 0.286
NP_441422.1_7 Reverse -287 -304 -1.82945 0.194
NP_440667.1_2 Forward -384 -365 -9.14533 0.297
NP_442658.1_1 Reverse -287 -297 7.74772 0.209
NP_442658.1_1 Forward -300 -290 4.89613 0.292
NP_442782.1_2 Forward -384 -370 6.88276 0.217
NP_441414.1_9 Reverse -169 -188 -7.17871 0.212
NP_441317.1_4 Reverse -87 -101 9.84592 0.29
NP_441958.1_5 Forward -299 -289 1.65166 0.0872
NP_441958.1_5 Reverse -288 -298 -6.70647 0.287
NP_441097.1_2 Reverse -241 -258 4.07041 0.286
NP_442911.1_2 Forward -308 -289 -9.53865 0.258
NP_440153.1_8 Forward -352 -339 -2.93064 0.268
NP_439975.1_2 Reverse -251 -269 5.91901 0.256
NP_441099.1_5 Reverse -279 -298 -3.54046 0.136
NP_442002.1_9 Forward -212 -205 9.47889 0.282
NP_441646.1_1 Reverse -250 -269 0.687771 0.245
NP_441646.1_1 Reverse -282 -301 -0.000545616 0.257
NP_442431.1_10 Forward -384 -366 2.37909 0.238
NP_440147.1_4 Reverse -287 -300 7.88576 0.0598
NP_441295.1_2 Forward -379 -360 18.4857 0.274
NP_441916.1_7 Forward -298 -288 7.15819 0.0745
NP_441041.1_4 Forward -378 -359 1.67108 0.0792
NP_441041.1_4 Forward -384 -365 -0.787193 0.0974
NP_441041.1_4 Reverse -142 -161 -11.7019 0.251
NP_441041.1_7 Forward -301 -289 7.12607 0.176
NP_441725.1_4 Reverse -284 -298 9.83206 0.144
NP_439966.1_7 Forward -180 -170 8.92768 0.125
NP_439966.1_7 Reverse -287 -297 8.3377 0.14
NP_439966.1_7 Reverse -43 -53 5.68278 0.214
NP_442941.1_3 Reverse -170 -180 7.15819 0.0855
NP_442941.1_3 Forward -297 -287 1.06167 0.153
NP_442281.1_1 Reverse -284 -298 6.78381 0.115
NP_441334.1_7 Forward -300 -281 -10.7186 0.12
NP_441457.1_7 Forward -300 -281 4.22769 0.221
NP_441556.1_10 Forward -184 -170 12.2659 0.195
NP_441644.1_6 Reverse -289 -299 7.15773 0.133
NP_440929.1_8 Forward -298 -289 7.66954 0.0624
NP_440929.1_8 Reverse -289 -298 7.57121 0.0706
NP_442933.1_2 Reverse -19 -37 7.06839 0.268
NP_440430.1_4 Reverse -279 -298 13.47 0.263
NP_441751.2_8 Forward -297 -283 -2.95034 0.134
NP_441751.2_8 Reverse -170 -184 -5.11362 0.194
NP_442554.1_8 Reverse -290 -300 6.56821 0.112
NP_442554.1_8 Forward -297 -287 4.99491 0.163
NP_442554.1_8 Reverse -370 -380 2.43831 0.272
NP_441762.1_7 Reverse -288 -300 -5.46756 0.212
NP_442142.1_4 Reverse -372 -385 7.98351 0.125
NP_442292.1_1 Reverse -290 -299 7.27622 0.0732
NP_442292.1_1 Reverse -370 -379 3.7363 0.192
NP_442292.1_1 Forward -297 -288 -0.0986038 0.239
NP_442292.1_1 Reverse -170 -179 -0.68859 0.268
NP_442292.1_5 Forward -302 -283 -0.590531 0.257
NP_443009.1_5 Forward -179 -168 4.77807 0.23
NP_441715.1_4 Forward -297 -287 9.41981 0.097
NP_441715.1_4 Reverse -170 -180 5.68323 0.189
NP_441715.1_5 Reverse -2 -12 18.3674 0.219
NP_441198.1_4 Reverse -250 -269 23.9922 0.00755
NP_441198.1_8 Forward -300 -290 10.8298 0.239
NP_440464.1_4 Forward -398 -380 20.9982 0.11
NP_441468.1_1 Forward -297 -290 6.43063 0.175
NP_441468.1_1 Reverse -290 -297 6.0373 0.223
NP_441015.1_10 Forward -297 -278 -3.63879 0.19
NP_441673.1_1 Forward -298 -289 1.27803 0.155
NP_441673.1_1 Reverse -289 -298 1.27803 0.155
NP_441673.1_1 Reverse -180 -189 -8.06341 0.254
NP_441731.1_7 Reverse -162 -181 2.0644 0.297
NP_441826.1_2 Reverse -283 -297 -3.93365 0.29
NP_442868.1_6 Forward -180 -170 13.0581 0.038
NP_442868.1_6 Reverse -287 -297 0.668351 0.213
NP_441056.1_1 Forward -298 -279 2.75272 0.133
NP_441612.1_2 Reverse -369 -379 6.80666 0.277
NP_442427.1_8 Reverse -160 -179 12.5858 0.152
NP_442808.1_1 Forward -172 -162 1.74956 0.281
NP_440918.1_8 Reverse -351 -369 14.8663 0.273
NP_440145.1_3 Reverse -170 -189 -2.75381 0.178
NP_442542.1_2 Forward -386 -373 5.23083 0.276
NP_442050.1_5 Forward -180 -170 8.92768 0.206
NP_442050.1_5 Forward -300 -290 6.86274 0.28
NP_440630.1_3 Forward -309 -290 5.01433 0.197
NP_441114.1_3 Reverse -377 -386 7.66954 0.231
NP_440558.1_2 Reverse -372 -391 -1.37718 0.214
NP_441878.1_6 Forward -190 -180 -6.21482 0.191
NP_441878.1_6 Forward -385 -375 -7.49312 0.231
NP_441878.1_6 Forward -299 -289 -7.49312 0.231
NP_441878.1_6 Reverse -168 -178 -7.59145 0.245
NP_441557.1_5 Forward -298 -289 7.66954 0.0443
NP_441557.1_5 Reverse -289 -298 0.983037 0.0911
NP_441458.1_10 Reverse -199 -218 1.0811 0.298
NP_442183.1_1 Reverse -289 -303 17.7975 0.00938
NP_440356.1_2 Reverse -165 -184 1.67108 0.263
NP_442347.1_2 Reverse -40 -49 3.7363 0.284
NP_441037.1_4 Forward -300 -290 6.24566 0.274
NP_442508.1_8 Reverse -243 -260 9.47861 0.289
NP_441633.1_3 Reverse -287 -300 -3.52063 0.177
NP_441633.1_3 Forward -180 -167 -7.25721 0.3
NP_440136.1_2 Reverse -170 -177 11.1505 0.0519
NP_440136.1_2 Forward -297 -290 6.52896 0.116
NP_440136.1_2 Reverse -290 -297 6.13563 0.193
NP_442590.1_10 Forward -391 -372 7.07928 0.232
NP_442998.1_10 Forward -296 -289 12.5271 0.0457
NP_441007.1_10 Forward -303 -290 11.6223 0.0624
NP_441559.1_8 Forward -183 -169 3.44117 0.143
NP_441559.1_8 Reverse -175 -189 0.687908 0.163
NP_441559.1_8 Forward -236 -222 -2.26202 0.19
NP_441559.1_8 Reverse -284 -298 -5.70361 0.27
NP_441559.1_8 Reverse -381 -395 -7.08024 0.283
NP_441559.1_8 Reverse -294 -308 -7.76856 0.299
NP_440915.1_6 Reverse -285 -299 2.35953 0.119
NP_440915.1_6 Forward -182 -168 1.57289 0.134
NP_442158.1_2 Reverse -317 -336 15.326 0.247
NP_442158.1_4 Reverse -330 -340 13.0581 0.239
NP_440733.1_2 Forward -101 -83 11.079 0.293
NP_440134.1_2 Reverse -121 -140 9.63589 0.227
NP_442866.1_1 Forward -378 -359 6.58763 0.121
NP_442866.1_4 Forward -372 -353 7.47261 0.202
NP_441464.1_1 Reverse -176 -195 7.47261 0.261
NP_441464.1_10 Reverse -248 -262 17.2075 0.129
NP_440026.1_4 Reverse -247 -266 16.7157 0.203
NP_441939.1_3 Forward -297 -278 21.4356 0.0055
NP_442386.1_9 Forward -179 -170 7.37413 0.219
NP_442386.1_9 Reverse -288 -297 6.39082 0.219
NP_441340.1_5 Forward -297 -290 13.2155 0.0437
NP_441340.1_5 Reverse -290 -297 6.13563 0.175
NP_440194.1_3 Forward -308 -289 0.58944 0.277
NP_440586.1_8 Forward -341 -334 7.1186 0.272
NP_441262.1_3 Forward -298 -291 5.34899 0.181
NP_443051.1_1 Forward -299 -290 7.76787 0.0541
NP_443051.1_1 Reverse -288 -297 0.589713 0.143
NP_439937.1_9 Reverse -168 -185 -0.846829 0.122
NP_439937.1_9 Forward -116 -99 -11.4665 0.256
NP_443039.1_3 Forward -140 -121 5.11266 0.286
NP_440408.1_7 Reverse -125 -144 8.35759 0.281
NP_440439.1_1 Reverse -286 -299 -0.865694 0.241
NP_440372.1_2 Forward -297 -290 6.62729 0.151
NP_440372.1_2 Reverse -290 -297 6.52896 0.188
NP_440316.1_10 Forward -385 -375 8.04317 0.24
NP_440316.1_10 Reverse -249 -259 5.38824 0.299
NP_439977.1_5 Reverse -363 -382 -2.65548 0.287
NP_442384.1_10 Forward -298 -285 1.19926 0.267
NP_441877.1_7 Forward -175 -156 4.52188 0.218
NP_442790.1_4 Forward -198 -179 -8.65367 0.173
NP_442262.1_10 Forward -297 -290 10.4622 0.145
NP_442910.1_1 Forward -185 -166 -2.26216 0.254
NP_441896.1_3 Reverse -280 -299 0.491109 0.225
NP_440999.1_9 Reverse -285 -299 -1.47537 0.239
NP_440888.1_2 Reverse -169 -183 8.45543 0.16
NP_440052.1_5 Reverse -278 -297 -5.9004 0.298
NP_442033.1_10 Forward -191 -172 -10.817 0.243
NP_441543.1_2 Forward -297 -288 15.4377 0.00784
NP_441543.1_2 Reverse -290 -299 4.81794 0.219
NP_442845.1_2 Reverse -244 -258 3.93283 0.272
NP_440380.1_1 Forward -384 -365 -11.6036 0.299
NP_441469.1_8 Reverse -288 -297 6.98123 0.227
NP_442337.1_8 Forward -373 -354 2.26107 0.217
NP_440257.1_5 Forward -260 -241 13.9616 0.0235
NP_442578.1_7 Forward -297 -290 11.3472 0.102
NP_440220.1_4 Reverse -380 -399 -0.886293 0.262
NP_441462.1_2 Reverse -289 -299 1.55333 0.0864
NP_441462.1_5 Reverse -240 -259 0.392778 0.296
NP_441621.1_7 Forward -300 -286 5.40779 0.0829
NP_442204.1_1 Reverse -285 -296 1.7303 0.266
NP_442204.1_2 Forward -262 -243 5.40766 0.299
NP_442204.1_5 Reverse -336 -355 6.68596 0.142
NP_440516.1_6 Reverse -376 -390 8.3571 0.247
NP_440516.1_8 Reverse -289 -298 -0.295266 0.232
NP_440516.1_8 Forward -178 -169 -0.590259 0.283
NP_442428.1_5 Forward -297 -290 6.52896 0.109
NP_442428.1_5 Reverse -290 -297 6.0373 0.212
NP_442120.1_10 Forward -384 -365 -5.99873 0.203
NP_440673.1_2 Forward -308 -289 11.2676 0.181
NP_440673.1_3 Reverse -377 -384 8.98723 0.203
NP_441714.1_3 Reverse -195 -213 13.6864 0.217
NP_441052.1_2 Reverse -169 -179 1.455 0.244
NP_440436.1_4 Forward -297 -288 8.65242 0.0997
NP_440436.1_4 Reverse -376 -385 6.48915 0.157
NP_440436.1_4 Reverse -170 -179 4.22755 0.277
NP_441719.1_4 Forward -297 -290 6.62729 0.151
NP_441719.1_4 Reverse -290 -297 6.52896 0.188
NP_441733.1_10 Forward -301 -288 8.47575 0.14
NP_441004.1_1 Reverse -217 -236 -11.8003 0.242
NP_441004.1_5 Reverse -219 -233 15.0442 0.22
NP_440296.1_4 Reverse -150 -169 19.8257 0.0779
NP_440296.1_6 Reverse -318 -336 12.4159 0.295
NP_440296.1_6 Forward -92 -74 10.8881 0.295
NP_442206.1_10 Reverse -289 -304 2.63483 0.201
NP_441851.1_10 Reverse -288 -298 5.97822 0.19
NP_441851.1_10 Reverse -168 -178 5.19158 0.221
NP_442856.1_7 Forward -361 -342 -3.44213 0.243
NP_442856.1_7 Forward -351 -332 -4.03212 0.254
NP_442515.1_1 Reverse -179 -193 2.35953 0.137
NP_442515.1_1 Reverse -342 -356 -2.65535 0.277
NP_442515.1_1 Forward -179 -165 -4.91696 0.298
NP_441396.1_5 Reverse -244 -253 7.37455 0.279
NP_440593.1_9 Forward -354 -340 8.65272 0.255
NP_441349.1_10 Forward -188 -169 -0.885524 0.0967
NP_440432.1_9 Reverse -290 -305 -4.93665 0.228
NP_439960.1_6 Forward -298 -279 9.83255 0.22
NP_442168.1_5 Forward -302 -283 -3.24547 0.281
NP_440588.1_2 Forward -187 -168 3.53937 0.0988
NP_440588.1_3 Forward -85 -66 9.0459 0.291
NP_441570.1_1 Forward -378 -360 -10.1089 0.16
NP_441078.1_4 Reverse -289 -298 8.35786 0.0338
NP_441078.1_4 Forward -298 -289 7.27622 0.0764
NP_441078.1_4 Forward -189 -180 -0.786921 0.207
NP_441078.1_4 Reverse -180 -189 -1.57357 0.266
NP_441078.1_4 Forward -178 -169 -1.86856 0.272
NP_442729.1_5 Forward -385 -375 9.7148 0.235
NP_440526.1_3 Reverse -290 -301 1.43483 0.267
NP_441432.1_8 Forward -179 -170 8.1612 0.0815
NP_441432.1_8 Reverse -288 -297 6.98123 0.112
NP_441945.1_10 Forward -391 -372 6.88262 0.291
NP_442353.1_4 Forward -351 -332 5.60352 0.183
NP_442353.1_4 Reverse -337 -356 4.03023 0.206
NP_442489.1_7 Forward -298 -289 1.08137 0.109
NP_442489.1_7 Reverse -289 -298 0.589713 0.17
NP_442489.1_7 Forward -189 -180 -1.77023 0.247
NP_442489.1_7 Reverse -169 -178 -1.96689 0.28
NP_441659.2_8 Reverse -289 -299 8.04317 0.0508
NP_439956.1_7 Forward -195 -176 2.0644 0.276
NP_442346.1_5 Forward -385 -375 4.60159 0.281
NP_440545.1_3 Forward -302 -285 2.00546 0.108
NP_440025.1_3 Forward -399 -385 13.1279 0.251
NP_440459.1_2 Forward -159 -142 9.28195 0.23
NP_440459.1_2 Forward -393 -376 8.29864 0.266
NP_441653.1_2 Reverse -278 -297 5.07576 0.248
NP_441888.1_7 Reverse -284 -298 3.93283 0.225
NP_441050.1_5 Reverse -248 -266 9.95058 0.143
NP_441358.1_4 Reverse -58 -77 21.0414 0.0652
NP_441833.1_4 Forward -297 -290 6.23397 0.163
NP_441833.1_4 Reverse -290 -297 6.13563 0.198
NP_442699.1_8 Forward -294 -275 -12.6852 0.255
NP_442162.1_9 Forward -297 -290 6.62729 0.142
NP_442162.1_9 Reverse -290 -297 6.43063 0.208
NP_441341.1_6 Forward -150 -131 8.84924 0.253
NP_442140.1_3 Forward -297 -287 10.6981 0.0902
NP_442723.1_1 Forward -270 -251 2.45694 0.289
NP_442723.1_1 Forward -269 -250 1.17865 0.298
NP_441671.1_10 Forward -185 -166 -0.0988766 0.288
NP_440875.1_9 Forward -296 -286 8.46937 0.233
NP_441813.1_5 Reverse -287 -297 9.61647 0.027
NP_442089.1_6 Forward -372 -353 4.22769 0.262
NP_440590.1_4 Forward -297 -284 3.75586 0.0686
NP_440590.1_4 Forward -220 -207 1.19926 0.13
NP_442497.1_10 Reverse -290 -299 5.89959 0.109
NP_442497.1_10 Forward -297 -288 0.688044 0.141
NP_440821.1_1 Reverse -281 -300 18.6815 0.0601
NP_440821.1_4 Forward -300 -290 0.471689 0.174
NP_440821.1_4 Reverse -287 -297 0.373358 0.18
NP_440227.1_2 Forward -29 -13 11.9566 0.271
NP_441239.1_9 Forward -300 -288 8.49544 0.131
NP_440706.1_1 Forward -302 -283 -5.21209 0.268
NP_441892.1_10 Forward -189 -170 12.4875 0.262
NP_442193.1_1 Forward -69 -51 7.88563 0.28
NP_441017.1_6 Forward -388 -374 11.2087 0.273
NP_440876.1_5 Reverse -291 -310 6.4893 0.283
NP_440876.1_5 Reverse -377 -396 4.916 0.283
NP_440354.1_5 Reverse -295 -314 1.67108 0.272
NP_440354.1_7 Reverse -237 -255 5.82068 0.297
NP_442138.1_9 Reverse -346 -365 11.2084 0.202
NP_440546.1_4 Forward -151 -141 8.39772 0.192
NP_440462.1_6 Reverse -287 -297 7.45319 0.0788
NP_440868.1_4 Reverse -285 -297 0.727295 0.201
NP_442499.1_3 Reverse -288 -306 3.46073 0.289
NP_442402.1_4 Forward -118 -99 -1.8696 0.194
NP_442402.1_4 Reverse -30 -49 -2.16459 0.195
NP_442402.1_4 Reverse -379 -398 -10.326 0.299
NP_440653.1_10 Forward -80 -61 5.99764 0.218
NP_442039.1_4 Forward -297 -290 12.1338 0.063
NP_441053.1_3 Forward -321 -302 -0.295539 0.278
NP_442696.1_6 Reverse -175 -194 -12.2919 0.252
NP_442837.1_3 Forward -297 -290 6.0373 0.25
NP_442837.1_3 Reverse -290 -297 5.93897 0.265
NP_440160.1_2 Forward -397 -378 -1.96717 0.245
NP_440160.1_5 Forward -237 -227 14.6309 0.291
NP_440505.1_3 Forward -180 -170 13.353 0.0331
NP_440505.1_3 Reverse -287 -297 6.56821 0.176
NP_440505.1_3 Reverse -178 -188 4.60159 0.277
NP_440505.1_7 Forward -359 -340 -1.67217 0.279
NP_442532.1_7 Reverse -289 -303 3.24451 0.205
NP_441011.1_8 Forward -297 -288 7.27622 0.179
NP_441011.1_8 Reverse -290 -299 6.19458 0.196
NP_442533.1_1 Forward -63 -44 -9.83364 0.229
NP_442533.1_1 Reverse -241 -260 -15.7335 0.257
NP_442533.1_6 Forward -292 -283 1.47469 0.298
NP_442322.1_4 Forward -262 -245 -8.90993 0.286
NP_441482.1_7 Reverse -283 -297 -0.983719 0.0612
NP_439944.1_9 Reverse -290 -300 12.7631 0.0838
NP_441697.1_5 Reverse -318 -337 -9.78835 0.274
NP_441028.1_6 Forward -120 -110 3.51951 0.292
NP_440115.1_6 Forward -181 -171 12.3697 0.0987
NP_440007.1_9 Forward -382 -368 11.3077 0.163
NP_440007.1_9 Reverse -285 -299 1.96621 0.281
NP_440007.1_9 Forward -388 -374 0.589577 0.294
NP_441347.1_5 Forward -184 -170 10.422 0.269
NP_441602.1_3 Reverse -284 -303 -1.18052 0.226
NP_441972.1_5 Reverse -278 -297 -9.73531 0.293
NP_441106.1_1 Reverse -288 -297 8.35786 0.0585
NP_441420.1_1 Forward -179 -160 -5.31042 0.292
NP_441286.1_1 Forward -179 -167 -5.07423 0.188
NP_440670.1_8 Reverse -289 -298 6.48957 0.118
NP_440670.1_8 Forward -298 -289 5.60459 0.149
NP_440886.1_7 Reverse -288 -298 7.94438 0.0805
NP_440886.1_7 Forward -253 -243 5.28945 0.188
NP_442614.1_2 Reverse -343 -357 9.73436 0.242
NP_442382.1_7 Reverse -356 -375 7.86593 0.229
NP_442072.1_9 Reverse -288 -306 -23.187 0.284
NP_440907.2_8 Reverse -290 -300 14.0409 0.0342
NP_442264.1_4 Reverse -343 -357 17.2075 0.224
NP_441021.1_1 Reverse -376 -395 1.96607 0.083
NP_441021.1_1 Forward -297 -278 -11.2103 0.258
NP_440962.1_6 Forward -45 -28 13.5094 0.252
NP_441463.1_3 Reverse -365 -384 3.04771 0.107
NP_442893.1_3 Forward -114 -95 17.8948 0.12
NP_441626.1_2 Forward -297 -290 14.2971 0.0271
NP_441626.1_2 Reverse -290 -297 5.93897 0.231
NP_442794.1_1 Reverse -285 -297 7.90546 0.126
NP_441962.1_4 Reverse -284 -303 -6.58872 0.18
NP_441962.1_4 Forward -297 -278 -9.24366 0.215
NP_440387.1_1 Forward -298 -282 -4.46469 0.187
NP_440387.1_1 Reverse -289 -305 -5.34967 0.227
NP_441431.1_2 Forward -351 -337 5.50552 0.298
NP_442647.1_7 Reverse -359 -372 5.32916 0.295
NP_440634.1_6 Reverse -179 -193 18.0925 0.13
NP_441993.1_1 Reverse -369 -388 4.09075 0.225
NP_440114.1_10 Reverse -289 -303 13.4709 0.0561
NP_441206.1_4 Reverse -55 -74 8.84924 0.0296
NP_442930.1_1 Forward -334 -324 9.81266 0.28
NP_441984.1_1 Forward -390 -372 7.09898 0.283
NP_441984.1_3 Forward -161 -143 5.82068 0.276
NP_442509.1_9 Forward -178 -168 12.1726 0.101
NP_440554.1_4 Reverse -290 -300 7.05986 0.106
NP_440554.1_4 Forward -297 -287 6.76487 0.114
NP_441885.1_5 Reverse -289 -299 0.963343 0.116
NP_441428.1_8 Reverse -281 -300 4.916 0.235
NP_441173.1_9 Reverse -390 -398 12.1137 0.21
NP_441173.1_9 Reverse -303 -311 11.0321 0.228
NP_443000.1_7 Reverse -287 -297 1.74999 0.229
NP_443000.1_7 Forward -180 -170 0.57002 0.294
NP_440275.1_3 Forward -300 -290 9.02648 0.0563
NP_440275.1_3 Reverse -287 -297 5.5849 0.14
NP_441307.1_4 Forward -67 -48 6.68596 0.177
NP_441662.1_3 Reverse -79 -98 8.52366 0.264
NP_441635.1_1 Reverse -319 -338 3.77151 0.279
NP_439962.1_4 Reverse -281 -300 -7.27704 0.288
NP_441105.1_3 Reverse -278 -297 -3.3438 0.177
NP_440216.1_1 Forward -298 -284 -11.9968 0.236
NP_440216.1_1 Forward -189 -175 -12.6851 0.296
NP_440216.1_9 Reverse -176 -185 10.9145 0.286
NP_440172.1_1 Forward -178 -168 4.79825 0.166
NP_442371.1_1 Forward -312 -302 13.5492 0.206
NP_442015.1_10 Reverse -285 -298 1.88757 0.204
NP_441226.1_7 Reverse -290 -297 5.54531 0.289
NP_441757.1_3 Forward -179 -160 -1.18052 0.245
NP_441111.1_7 Forward -297 -289 8.96754 0.0463
NP_441766.1_2 Forward -298 -289 6.48957 0.096
NP_442417.1_5 Forward -292 -278 6.29277 0.227
NP_440261.1_5 Forward -297 -284 -11.9771 0.268
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CTTTGGCTAAATCACGGGCAATGGTGATGTCATTGGATTGGGTCTGCTTGTCGCCGCCAGCCAACAAAATAATTAACTGTTCTCCCTGCTGGGTGAAATAGATGCGATAGCCGGGGCCGTAGTTAATCCGAAGTTCTGAAACCCCACCCCCTACCGACTTAACGTCCCCAGCATTAACCAAGGATAGACGGCGAATACGAATATCAATTCGGGCTTTTGCCTGGCAATCCCGCAAAGACTTAAACCAACGGGCATAGGTTTCTGTTTGCCGGATTTCAATCATCCCCCTATTGTATCCCAAAAGATACAAATTGCTTAATGTATTTGAAGCGGGCATTAATCTGAGGGGGCTTGGGATTAGAATTGAGTAATTATATTTTGTATAACTCAGGAGGGGCTA

CDS

ATGGAAGTCCGGCTCAAAAAGTGGGGAAATAGCATCGGGTTACGCATTCCGCACCCCTTGGCCATCAGTTGGGGGTTTGATGAATCAACGGTGGTGGATTTGGTGGAAACGGAGCAGGGGCTGATGATTCGTAAACGGTCTTCCCCTGGGTCATTGGAGGCACTTTTGACATCTATTCCTGCCGATTTTACCTATCCCGGTGATGTGTCCGATTTTGTGGAGAGTGAGGCGACCGGCCAGGAATGGTTATGA

Protein

No sequence available