Your browser is old and dusty. Try Google Chrome!

Details for ssr6099

ORF ssr6099
Accession NP_942542.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -192 -178 8.75105 0.0846
NP_440795.1_7 Forward -192 -185 14.6904 0.0123
NP_440795.1_7 Reverse -185 -192 14.6904 0.0123
NP_442100.1_1 Forward -94 -75 8.92807 0.24
NP_441418.1_3 Reverse -24 -43 13.7027 0.176
NP_441418.1_6 Forward -193 -174 -10.1286 0.0319
NP_441418.1_6 Reverse -184 -203 -29.2048 0.219
NP_441418.1_6 Reverse -311 -330 -29.3032 0.221
NP_442291.1_5 Reverse -183 -199 17.5614 0.0165
NP_442291.1_5 Forward -194 -178 4.87675 0.0841
NP_440897.1_6 Reverse -184 -203 5.11187 0.123
NP_441453.1_4 Reverse -184 -192 16.539 0.00633
NP_441453.1_4 Forward -193 -185 16.539 0.00633
NP_442151.1_6 Forward -193 -179 8.06273 0.183
NP_441818.1_1 Reverse -185 -196 18.0527 0.00639
NP_441818.1_1 Forward -192 -181 15.8894 0.0244
NP_441818.1_9 Reverse -319 -338 -10.0303 0.292
NP_440226.1_1 Forward -193 -174 13.5691 0.0352
NP_440226.1_1 Reverse -184 -203 8.35759 0.0885
NP_442169.1_1 Forward -271 -252 1.37609 0.261
NP_440817.1_2 Reverse -320 -339 10.4225 0.272
NP_440150.1_6 Reverse -181 -200 0.786102 0.296
NP_443002.1_5 Reverse -260 -278 12.1131 0.232
NP_442173.1_1 Forward -192 -184 15.4574 0.00633
NP_442173.1_1 Reverse -185 -193 15.4574 0.00633
NP_442173.1_6 Forward -261 -247 14.3559 0.118
NP_442752.1_4 Forward -193 -186 13.8055 0.0199
NP_442752.1_4 Reverse -184 -191 13.8055 0.0199
NP_443027.1_4 Reverse -182 -192 14.0414 0.0452
NP_443027.1_4 Forward -195 -185 11.0914 0.107
NP_441812.1_3 Forward -194 -180 8.65272 0.251
NP_442975.1_10 Reverse -180 -194 3.63724 0.252
NP_440784.1_7 Forward -192 -185 15.9687 0.0123
NP_440784.1_7 Reverse -185 -192 15.9687 0.0123
NP_442909.1_7 Forward -192 -178 12.192 0.131
NP_440061.1_9 Reverse -182 -196 21.5334 0.00189
NP_440061.1_9 Forward -195 -181 10.3237 0.126
NP_441054.1_4 Forward -203 -185 3.06741 0.169
NP_442062.1_3 Reverse -281 -300 -2.36049 0.271
NP_442062.1_8 Forward -193 -183 17.3846 0.00193
NP_442062.1_8 Reverse -184 -194 17.3846 0.00193
NP_440761.1_4 Forward -263 -244 -14.2585 0.261
NP_441859.1_3 Forward -194 -175 4.22689 0.228
NP_442972.1_1 Forward -160 -142 11.8068 0.254
NP_440304.1_4 Reverse -182 -192 10.8948 0.051
NP_440304.1_4 Forward -195 -185 1.84832 0.299
NP_442242.1_4 Forward -192 -185 14.3954 0.0124
NP_442242.1_4 Reverse -185 -192 14.3954 0.0124
NP_440044.1_8 Reverse -185 -204 9.14423 0.0703
NP_440044.1_8 Forward -192 -173 8.94757 0.0723
NP_440044.1_8 Forward -180 -161 -1.18052 0.238
NP_439918.1_2 Forward -369 -350 11.4058 0.126
NP_442742.1_9 Reverse -250 -269 -8.55534 0.265
NP_442110.1_7 Reverse -184 -198 -0.197071 0.276
NP_440300.1_5 Reverse -31 -49 19.1004 0.213
NP_441083.1_5 Forward -193 -183 20.3345 0.00053
NP_441083.1_5 Reverse -184 -194 20.3345 0.00053
NP_441083.1_5 Forward -320 -310 3.61828 0.166
NP_441738.1_2 Forward -191 -184 15.28 0.0102
NP_441738.1_2 Reverse -186 -193 15.28 0.0102
NP_441558.1_5 Reverse -182 -201 7.66927 0.174
NP_440209.1_1 Reverse -184 -192 18.1123 0.00295
NP_440209.1_1 Forward -193 -185 18.1123 0.00295
NP_442889.1_8 Reverse -265 -279 9.43874 0.0989
NP_442889.1_8 Forward -196 -182 3.8339 0.273
NP_442889.1_8 Reverse -181 -195 2.94893 0.295
NP_441713.1_1 Reverse -178 -197 -14.4552 0.259
NP_440178.1_7 Reverse -183 -202 -22.5183 0.267
NP_441716.1_1 Reverse -184 -198 13.8643 0.0689
NP_441716.1_1 Forward -193 -179 4.32615 0.256
NP_441716.1_2 Reverse -160 -179 -2.00377 0.293
NP_441327.1_5 Forward -111 -102 15.0444 0.191
NP_442111.1_4 Reverse -183 -197 10.3243 0.0545
NP_442111.1_4 Forward -237 -223 8.55439 0.0729
NP_442111.1_4 Forward -194 -180 1.76955 0.294
NP_441163.1_1 Forward -335 -318 4.0697 0.294
NP_440906.1_5 Forward -192 -185 15.8704 0.0124
NP_440906.1_5 Reverse -185 -192 15.8704 0.0124
NP_440747.1_10 Forward -196 -184 16.8536 0.00143
NP_440747.1_10 Reverse -181 -193 7.4138 0.00422
NP_441130.1_10 Reverse -182 -196 17.3058 0.0167
NP_441486.1_1 Forward -196 -182 12.4876 0.0116
NP_441486.1_1 Reverse -181 -195 5.50613 0.0365
NP_442634.1_4 Forward -195 -181 -1.96703 0.149
NP_441014.1_10 Forward -194 -175 8.55343 0.131
NP_442848.1_1 Reverse -178 -192 8.06273 0.0791
NP_442848.1_1 Forward -199 -185 -2.45868 0.263
NP_443018.1_3 Forward -192 -185 14.8871 0.0123
NP_443018.1_3 Reverse -185 -192 14.8871 0.0123
NP_441634.1_8 Reverse -182 -196 2.94952 0.158
NP_441634.1_8 Forward -195 -181 -3.24533 0.295
NP_440376.1_1 Forward -193 -184 19.4693 0.000692
NP_440376.1_1 Reverse -184 -193 19.4693 0.000692
NP_441588.1_4 Forward -191 -181 6.37155 0.2
NP_442687.1_7 Forward -194 -184 8.92815 0.0994
NP_442687.1_7 Reverse -183 -193 8.92815 0.0994
NP_442958.1_3 Forward -204 -185 0.491109 0.267
NP_442530.1_2 Forward -48 -38 12.2714 0.278
NP_441013.1_3 Forward -270 -251 10.8159 0.204
NP_441950.1_7 Reverse -311 -330 -9.047 0.292
NP_442658.1_1 Forward -195 -185 7.94438 0.199
NP_442658.1_1 Reverse -182 -192 6.76441 0.214
NP_442782.1_2 Forward -258 -244 9.04604 0.198
NP_441414.1_9 Forward -193 -174 3.83436 0.0572
NP_441958.1_5 Forward -194 -184 12.2714 0.00183
NP_441958.1_5 Reverse -183 -193 12.2714 0.00183
NP_440373.1_2 Forward -89 -70 24.788 0.00208
NP_439905.1_1 Reverse -185 -198 11.6223 0.204
NP_440984.1_7 Forward -198 -184 11.996 0.122
NP_439990.1_5 Reverse -179 -192 7.6891 0.186
NP_442690.1_1 Reverse -75 -94 5.99764 0.0692
NP_442911.1_2 Reverse -174 -193 4.03102 0.0401
NP_440153.1_5 Reverse -185 -199 12.4876 0.0645
NP_440369.1_5 Forward -271 -252 21.3373 0.0396
NP_442064.1_1 Reverse -179 -198 -11.0136 0.259
NP_442210.1_5 Reverse -158 -177 10.5209 0.24
NP_441099.1_5 Forward -203 -184 -1.37718 0.107
NP_441099.1_5 Forward -246 -227 -11.4069 0.28
NP_440809.1_9 Reverse -175 -193 -6.86402 0.225
NP_441712.1_1 Forward -88 -69 12.3233 0.251
NP_441294.1_7 Forward -197 -183 19.1375 0.00332
NP_441646.1_1 Reverse -177 -196 1.96607 0.224
NP_442438.1_10 Forward -198 -184 11.3077 0.0463
NP_440377.1_1 Forward -107 -90 10.1141 0.299
NP_441000.1_6 Reverse -183 -197 4.71948 0.0933
NP_440484.1_3 Forward -195 -181 12.1926 0.242
NP_441674.1_6 Reverse -185 -204 8.16093 0.205
NP_440147.1_4 Reverse -182 -195 9.75405 0.0371
NP_440147.1_4 Forward -195 -182 8.67241 0.0475
NP_441550.1_8 Forward -195 -185 15.1225 0.0132
NP_441550.1_8 Reverse -182 -192 12.3692 0.0336
NP_441550.1_8 Reverse -309 -319 8.23937 0.127
NP_441550.1_8 Forward -322 -312 6.66608 0.198
NP_441550.1_8 Forward -206 -196 4.60114 0.299
NP_441916.1_7 Forward -193 -183 10.3048 0.0261
NP_441916.1_7 Reverse -184 -194 10.3048 0.0261
NP_441916.1_7 Reverse -188 -198 1.84832 0.272
NP_442396.1_5 Reverse -180 -193 18.6038 0.0171
NP_442004.1_6 Reverse -184 -198 2.06454 0.274
NP_441725.1_5 Forward -192 -182 11.2881 0.0247
NP_441725.1_5 Reverse -185 -195 2.04498 0.115
NP_439966.1_7 Reverse -182 -192 15.8108 0.0124
NP_439966.1_7 Forward -195 -185 15.3192 0.0152
NP_442941.1_3 Forward -192 -182 19.9412 0.00262
NP_442941.1_3 Reverse -185 -195 19.2529 0.00262
NP_440289.1_2 Reverse -181 -194 3.75586 0.0741
NP_440289.1_2 Forward -196 -183 3.16588 0.0811
NP_442281.1_1 Reverse -179 -193 8.25877 0.0832
NP_441079.1_7 Forward -86 -67 1.86696 0.177
NP_440177.1_9 Reverse -176 -195 11.8975 0.243
NP_442256.1_2 Forward -195 -177 -1.84914 0.185
NP_001035871.2_7 Forward -256 -246 15.0247 0.171
NP_441556.1_7 Reverse -248 -267 5.50519 0.202
NP_440375.1_8 Reverse -185 -204 -1.57384 0.288
NP_441644.1_6 Forward -193 -183 17.3841 0.00127
NP_441644.1_6 Reverse -184 -194 17.3841 0.00127
NP_441644.1_6 Forward -236 -226 3.61784 0.272
NP_441644.1_6 Forward -320 -310 3.22451 0.293
NP_441795.1_4 Forward -94 -81 16.7335 0.271
NP_442215.1_2 Reverse -182 -198 -4.07137 0.227
NP_442215.1_2 Forward -195 -179 -6.92296 0.281
NP_440253.1_2 Forward -193 -175 2.0841 0.144
NP_440253.1_2 Reverse -184 -202 -2.3408 0.265
NP_440929.1_8 Forward -193 -184 19.2726 0.000701
NP_440929.1_8 Reverse -184 -193 19.2726 0.000701
NP_442933.1_6 Forward -82 -63 14.0846 0.284
NP_442933.1_10 Forward -193 -184 17.601 0.00325
NP_442933.1_10 Reverse -184 -193 17.601 0.00325
NP_441751.2_8 Forward -192 -178 5.60446 0.0419
NP_441751.2_8 Reverse -185 -199 -2.26202 0.132
NP_442554.1_8 Reverse -185 -195 16.2046 0.0065
NP_442554.1_8 Forward -192 -182 15.9097 0.00747
NP_441762.1_7 Reverse -183 -195 -6.74586 0.284
NP_441762.1_7 Forward -194 -182 -6.84419 0.284
NP_442142.1_4 Reverse -181 -194 6.21356 0.17
NP_442142.1_4 Forward -196 -183 4.34528 0.223
NP_442292.1_1 Forward -192 -183 18.486 0.00229
NP_442292.1_1 Reverse -185 -194 18.486 0.00229
NP_442476.1_6 Reverse -185 -199 20.3541 0.0222
NP_442476.1_6 Forward -192 -178 8.06273 0.107
NP_443009.1_5 Reverse -183 -194 8.90795 0.0965
NP_443009.1_5 Forward -194 -183 8.90795 0.0965
NP_441715.1_4 Reverse -185 -195 17.3846 0.0106
NP_441715.1_4 Forward -192 -182 14.828 0.0268
NP_440158.1_1 Forward -89 -70 10.5514 0.243
NP_440183.1_9 Reverse -186 -205 -20.2567 0.282
NP_441468.1_1 Forward -192 -185 15.8704 0.0124
NP_441468.1_1 Reverse -185 -192 15.8704 0.0124
NP_441015.1_10 Reverse -179 -198 -6.98204 0.26
NP_441673.1_1 Forward -193 -184 20.8459 0.000698
NP_441673.1_1 Reverse -184 -193 20.8459 0.000698
NP_441826.1_2 Forward -199 -185 3.8345 0.105
NP_441826.1_2 Reverse -178 -192 2.16287 0.134
NP_441826.1_5 Reverse -185 -204 0.58944 0.3
NP_442868.1_6 Forward -195 -185 19.2529 0.00563
NP_442868.1_6 Reverse -182 -192 9.91146 0.038
NP_441612.1_2 Reverse -184 -194 8.54929 0.21
NP_441612.1_2 Forward -193 -183 8.54929 0.21
NP_442427.1_8 Reverse -175 -194 8.94757 0.192
NP_442808.1_1 Reverse -183 -193 8.63269 0.0481
NP_442808.1_1 Forward -194 -184 8.63269 0.0481
NP_442808.1_1 Reverse -257 -267 2.5362 0.263
NP_442775.1_1 Reverse -316 -335 10.8159 0.288
NP_442542.1_2 Forward -195 -182 9.75405 0.131
NP_442542.1_2 Forward -20 -7 5.82081 0.247
NP_442050.1_1 Forward -271 -252 7.07928 0.277
NP_442050.1_5 Reverse -182 -192 16.4991 0.00812
NP_442050.1_5 Forward -195 -185 14.3359 0.0206
NP_441114.1_3 Forward -326 -317 7.66954 0.231
NP_440558.1_2 Forward -202 -183 -1.27885 0.213
NP_440558.1_5 Reverse -319 -333 13.8643 0.289
NP_441878.1_6 Forward -194 -184 10.4031 0.0176
NP_441878.1_6 Reverse -183 -193 10.4031 0.0176
NP_441036.1_8 Forward -194 -184 8.33817 0.174
NP_441036.1_8 Reverse -183 -193 8.33817 0.174
NP_441557.1_5 Forward -193 -184 19.9609 0.000699
NP_441557.1_5 Reverse -184 -193 19.9609 0.000699
NP_441445.1_1 Reverse -175 -194 6.78429 0.142
NP_441590.1_4 Reverse -245 -264 2.45694 0.295
NP_442066.2_9 Reverse -180 -193 11.229 0.154
NP_441308.1_8 Reverse -309 -319 10.2065 0.22
NP_441458.1_10 Reverse -175 -194 4.52268 0.23
NP_442183.1_1 Forward -193 -179 20.3541 0.00441
NP_442166.1_3 Forward -262 -243 -4.32711 0.264
NP_441819.1_2 Reverse -73 -92 15.4215 0.283
NP_441574.1_1 Reverse -172 -191 -6.09707 0.273
NP_441549.1_9 Reverse -180 -198 1.98577 0.0979
NP_441238.1_10 Forward -269 -255 11.8976 0.292
NP_442347.1_2 Forward -192 -183 12.4878 0.056
NP_442347.1_2 Reverse -185 -194 12.4878 0.056
NP_442347.1_2 Reverse -51 -60 3.93297 0.284
NP_442645.1_2 Forward -201 -182 -11.7019 0.144
NP_441633.1_3 Forward -195 -182 3.36254 0.0699
NP_441633.1_3 Reverse -182 -195 -5.97891 0.236
NP_440136.1_2 Forward -192 -185 15.9687 0.0123
NP_440136.1_2 Reverse -185 -192 15.9687 0.0123
NP_442998.1_5 Forward -110 -100 7.45319 0.292
NP_442998.1_10 Forward -191 -184 15.5754 0.0102
NP_442998.1_10 Reverse -186 -193 15.5754 0.0102
NP_440299.1_1 Forward -197 -184 14.1783 0.0259
NP_440299.1_1 Reverse -180 -193 12.9984 0.0319
NP_441799.1_1 Forward -197 -183 16.3219 0.0152
NP_441799.1_1 Reverse -180 -194 12.2903 0.0441
NP_441007.1_10 Reverse -179 -192 8.37742 0.115
NP_441007.1_10 Forward -198 -185 -0.570702 0.287
NP_440256.1_1 Reverse -181 -200 8.35759 0.0236
NP_440256.1_1 Forward -196 -177 -0.885524 0.0979
NP_440256.1_1 Forward -184 -165 -10.0303 0.293
NP_440709.1_1 Forward -93 -74 2.9486 0.219
NP_441559.1_8 Forward -198 -184 0.687908 0.163
NP_440915.1_6 Forward -197 -183 0.0979218 0.176
NP_442785.1_7 Reverse -182 -196 11.2093 0.228
NP_440695.1_5 Forward -193 -174 12.8808 0.15
NP_440695.1_5 Reverse -172 -191 12.1925 0.15
NP_442386.1_9 Reverse -183 -192 13.8639 0.0289
NP_442386.1_9 Forward -194 -185 13.8639 0.0289
NP_441404.1_7 Reverse -220 -239 15.8307 0.0848
NP_441750.1_1 Reverse -208 -227 3.44104 0.128
NP_441340.1_5 Forward -192 -185 15.6737 0.0124
NP_441340.1_5 Reverse -185 -192 15.6737 0.0124
NP_441340.1_9 Forward -111 -101 8.25522 0.256
NP_442484.1_2 Forward -204 -185 2.26107 0.226
NP_442484.1_2 Reverse -173 -192 -0.000545616 0.254
NP_440168.1_9 Reverse -317 -336 -2.55715 0.283
NP_441248.1_10 Forward -372 -362 16.0642 0.277
NP_442714.1_7 Forward -96 -77 3.93269 0.199
NP_441160.1_5 Reverse -77 -96 -6.58872 0.288
NP_440586.1_8 Forward -192 -185 13.2151 0.026
NP_440586.1_8 Reverse -185 -192 13.2151 0.026
NP_442251.1_6 Forward -192 -185 15.2804 0.0124
NP_442251.1_6 Reverse -185 -192 15.2804 0.0124
NP_440192.1_4 Forward -271 -252 12.7933 0.169
NP_440684.1_9 Reverse -178 -192 9.5377 0.218
NP_441262.1_3 Reverse -184 -191 14.7888 0.0223
NP_441262.1_3 Forward -193 -186 14.7888 0.0223
NP_440027.1_3 Reverse -184 -202 7.58986 0.208
NP_443051.1_1 Reverse -183 -192 10.4228 0.00754
NP_443051.1_1 Forward -194 -185 10.4228 0.00754
NP_441232.1_10 Reverse -173 -192 2.65439 0.243
NP_441232.1_10 Forward -204 -185 0.982764 0.292
NP_439937.1_9 Forward -400 -383 -13.1381 0.28
NP_439937.1_9 Reverse -183 -200 -14.4164 0.287
NP_440439.1_1 Forward -196 -183 4.24752 0.104
NP_440372.1_2 Forward -192 -185 16.3621 0.0124
NP_440372.1_2 Reverse -185 -192 16.3621 0.0124
NP_440139.1_1 Forward -199 -180 8.75009 0.109
NP_442384.1_10 Reverse -184 -197 21.4554 0.00194
NP_442384.1_10 Forward -193 -180 15.8506 0.00946
NP_442790.1_4 Reverse -175 -194 -10.1286 0.201
NP_442262.1_10 Forward -192 -185 14.1988 0.0123
NP_442262.1_10 Reverse -185 -192 14.1988 0.0123
NP_441689.1_5 Reverse -182 -192 15.3192 0.0403
NP_441689.1_5 Forward -195 -185 5.78111 0.197
NP_441689.1_5 Reverse -309 -319 3.71617 0.294
NP_440163.1_10 Reverse -181 -191 10.4031 0.201
NP_440344.1_10 Reverse -177 -194 -7.82764 0.119
NP_440282.1_10 Reverse -174 -193 -6.88371 0.25
NP_440531.1_6 Forward -201 -182 -0.590531 0.216
NP_442832.1_3 Reverse -227 -246 12.3892 0.288
NP_440562.1_10 Forward -202 -184 5.42735 0.289
NP_441965.1_3 Forward -203 -184 7.57094 0.134
NP_441965.1_10 Reverse -181 -197 8.41667 0.125
NP_441965.1_10 Forward -196 -180 7.43336 0.148
NP_441640.1_8 Reverse -269 -288 -4.6221 0.266
NP_440297.1_9 Forward -192 -182 9.32148 0.0917
NP_440297.1_9 Reverse -185 -195 -0.118297 0.282
NP_440999.1_9 Forward -197 -183 -0.393733 0.205
NP_440888.1_2 Reverse -184 -198 18.9768 0.00173
NP_440888.1_2 Forward -193 -179 14.8469 0.0144
NP_440600.1_1 Forward -90 -71 18.5728 0.0949
NP_440600.1_4 Reverse -176 -194 -0.964162 0.16
NP_441543.1_2 Forward -192 -183 16.9127 0.00359
NP_441543.1_2 Reverse -185 -194 16.9127 0.00359
NP_442845.1_2 Reverse -178 -192 7.37441 0.195
NP_442845.1_2 Forward -199 -185 7.17775 0.198
NP_442845.1_2 Reverse -184 -198 4.81781 0.251
NP_441319.1_5 Reverse -185 -204 9.3409 0.27
NP_442710.1_7 Reverse -67 -86 0.75437 0.183
NP_441469.1_8 Forward -194 -185 6.48957 0.227
NP_441469.1_8 Reverse -183 -192 6.48957 0.227
NP_443064.1_6 Forward -193 -183 12.5669 0.0796
NP_443064.1_6 Reverse -184 -194 12.5669 0.0796
NP_443064.1_6 Forward -320 -310 8.30077 0.3
NP_442578.1_7 Forward -192 -185 14.5921 0.026
NP_442578.1_7 Reverse -185 -192 14.5921 0.026
NP_440710.1_1 Forward -201 -183 -8.53565 0.269
NP_441462.1_2 Forward -193 -183 11.5831 0.00406
NP_441462.1_2 Reverse -184 -194 11.5831 0.00406
NP_443062.1_1 Forward -193 -175 10.3986 0.117
NP_443062.1_6 Reverse -176 -195 6.19431 0.186
NP_442204.1_1 Forward -197 -186 0.0586712 0.284
NP_440255.1_8 Forward -54 -35 13.3647 0.28
NP_440516.1_8 Forward -193 -184 16.9127 0.00442
NP_440516.1_8 Reverse -184 -193 16.9127 0.00442
NP_440516.1_8 Reverse -311 -320 7.07956 0.0867
NP_440516.1_8 Reverse -227 -236 -0.68859 0.297
NP_442428.1_5 Forward -192 -185 15.8704 0.0124
NP_442428.1_5 Reverse -185 -192 15.8704 0.0124
NP_440673.1_3 Forward -191 -184 12.4288 0.0426
NP_440673.1_3 Reverse -186 -193 12.4288 0.0426
NP_441052.1_2 Forward -193 -183 19.9412 0.00106
NP_441052.1_2 Reverse -184 -194 19.9412 0.00106
NP_442219.1_9 Forward -192 -183 17.7976 0.00718
NP_442219.1_9 Reverse -185 -194 17.7976 0.00718
NP_440436.1_2 Reverse -170 -189 16.5175 0.224
NP_440436.1_4 Forward -192 -183 17.2072 0.00233
NP_440436.1_4 Reverse -185 -194 17.2072 0.00233
NP_440436.1_4 Reverse -250 -259 5.11253 0.222
NP_441884.1_9 Reverse -181 -200 -22.0267 0.275
NP_440314.1_9 Forward -192 -173 -4.22878 0.203
NP_441719.1_4 Forward -192 -185 16.3621 0.0124
NP_441719.1_4 Reverse -185 -192 16.3621 0.0124
NP_441004.1_1 Reverse -268 -287 -15.8318 0.279
NP_442366.1_5 Forward -356 -346 10.206 0.282
NP_442873.1_9 Reverse -174 -193 14.9449 0.0906
NP_442206.1_10 Forward -193 -178 5.58476 0.178
NP_441851.1_10 Forward -194 -184 15.8113 0.00552
NP_441851.1_10 Reverse -183 -193 15.8113 0.00552
NP_442856.1_7 Forward -202 -183 -2.45882 0.236
NP_441668.1_4 Reverse -174 -193 6.09597 0.163
NP_442515.1_1 Forward -194 -180 20.0591 0.0162
NP_442515.1_1 Reverse -183 -197 9.04604 0.0671
NP_441982.1_6 Reverse -83 -92 12.4854 0.275
NP_441046.1_2 Forward -269 -250 6.19431 0.221
NP_442689.1_8 Reverse -79 -96 12.6252 0.103
NP_441349.1_10 Forward -203 -184 3.93269 0.0612
NP_441349.1_10 Reverse -174 -193 -6.78538 0.236
NP_440432.1_9 Reverse -185 -200 -4.15 0.198
NP_442843.1_1 Forward -276 -257 9.73422 0.115
NP_442843.1_1 Reverse -320 -339 -3.14714 0.222
NP_442843.1_1 Forward -192 -173 -10.9153 0.282
NP_442944.1_10 Forward -237 -218 7.47261 0.269
NP_440396.1_10 Forward -192 -176 11.2676 0.186
NP_442450.1_5 Reverse -182 -192 9.32148 0.115
NP_440588.1_2 Forward -202 -183 -2.0655 0.16
NP_440588.1_2 Reverse -218 -237 -3.44213 0.186
NP_440195.1_4 Reverse -172 -191 5.99764 0.283
NP_442243.1_1 Forward -199 -181 11.6214 0.114
NP_441570.1_1 Reverse -184 -202 -6.4707 0.0796
NP_441570.1_1 Forward -193 -175 -6.76569 0.0818
NP_441078.1_4 Forward -193 -184 19.6659 0.0007
NP_441078.1_4 Reverse -184 -193 19.6659 0.0007
NP_442729.1_8 Reverse -180 -193 19.1938 0.0312
NP_440526.1_3 Forward -340 -329 4.38475 0.267
NP_440526.1_3 Forward -192 -181 0.943182 0.267
NP_440526.1_3 Reverse -185 -196 0.943182 0.267
NP_441432.1_8 Reverse -183 -192 16.8143 0.00595
NP_441432.1_8 Forward -194 -185 16.8143 0.00595
NP_441432.1_8 Reverse -226 -235 2.94966 0.28
NP_442320.1_8 Reverse -178 -192 3.14618 0.0674
NP_442320.1_8 Forward -199 -185 -3.44199 0.122
NP_441732.1_2 Reverse -180 -196 -6.92296 0.0558
NP_441732.1_2 Forward -197 -181 -16.3627 0.165
NP_441732.1_2 Reverse -245 -261 -16.6577 0.186
NP_442003.1_4 Reverse -185 -204 14.4541 0.22
NP_442815.1_1 Reverse -206 -225 7.57094 0.187
NP_440760.1_1 Forward -193 -174 -21.6334 0.24
NP_440760.1_1 Reverse -184 -203 -23.1083 0.283
NP_442797.1_7 Forward -200 -182 9.75391 0.169
NP_440199.1_10 Reverse -224 -234 12.3697 0.127
NP_440199.1_10 Reverse -181 -191 7.64985 0.231
NP_442353.1_4 Forward -199 -180 2.16195 0.236
NP_440713.1_4 Reverse -190 -209 7.17762 0.184
NP_440713.1_4 Reverse -268 -287 6.78429 0.185
NP_442489.1_7 Forward -193 -184 20.1576 0.000695
NP_442489.1_7 Reverse -184 -193 20.1576 0.000695
NP_442079.1_7 Forward -192 -173 14.1591 0.079
NP_440559.1_1 Forward -192 -183 17.4043 0.00658
NP_440559.1_1 Reverse -185 -194 17.4043 0.00658
NP_441659.2_8 Forward -193 -183 18.1713 0.00133
NP_441659.2_8 Reverse -184 -194 18.1713 0.00133
NP_441022.1_1 Reverse -246 -255 10.587 0.294
NP_442913.1_10 Forward -202 -183 0.392778 0.154
NP_440336.1_7 Forward -92 -73 10.074 0.147
NP_439956.1_7 Forward -264 -245 5.50599 0.257
NP_442346.1_5 Forward -194 -184 16.6963 0.00248
NP_442346.1_5 Reverse -183 -193 16.6963 0.00248
NP_440352.1_5 Forward -119 -100 10.8063 0.27
NP_440545.1_3 Forward -197 -180 -2.91109 0.195
NP_440545.1_5 Reverse -314 -331 13.6085 0.176
NP_440459.1_2 Forward -202 -185 8.10198 0.27
NP_441653.1_2 Reverse -173 -192 5.46229 0.245
NP_442137.1_6 Reverse -84 -103 3.44104 0.288
NP_440847.1_3 Forward -335 -321 16.2235 0.139
NP_442603.1_7 Forward -193 -179 15.6336 0.0422
NP_442603.1_7 Reverse -184 -198 11.897 0.109
NP_441050.1_5 Forward -262 -244 -2.43913 0.283
NP_441833.1_4 Forward -192 -185 15.9687 0.0124
NP_441833.1_4 Reverse -185 -192 15.9687 0.0124
NP_441895.1_10 Forward -114 -95 -18.8801 0.282
NP_442162.1_9 Forward -192 -185 16.2637 0.0124
NP_442162.1_9 Reverse -185 -192 16.2637 0.0124
NP_440671.1_1 Reverse -72 -91 13.6917 0.128
NP_440224.1_1 Forward -204 -185 11.7992 0.0566
NP_442140.1_3 Reverse -185 -195 10.3048 0.0902
NP_442140.1_3 Forward -192 -182 4.40493 0.243
NP_441671.1_10 Forward -204 -185 2.65439 0.249
NP_441813.1_5 Forward -195 -185 18.1713 0.00743
NP_441813.1_5 Reverse -182 -192 15.9097 0.01
NP_442028.1_1 Forward -36 -23 9.51548 0.251
NP_440590.1_4 Reverse -185 -198 11.524 0.0197
NP_440590.1_4 Forward -192 -179 -5.97891 0.296
NP_440567.1_1 Reverse -185 -199 12.7826 0.0216
NP_440567.1_1 Forward -192 -178 2.35953 0.176
NP_442497.1_10 Forward -192 -183 10.4228 0.0087
NP_442497.1_10 Reverse -185 -194 10.4228 0.0087
NP_440821.1_4 Reverse -182 -192 18.2696 0.00448
NP_440821.1_4 Forward -195 -185 9.41981 0.0286
NP_441239.1_9 Forward -195 -183 5.25052 0.223
NP_441239.1_9 Reverse -182 -194 4.36554 0.253
NP_441239.1_9 Forward -329 -317 3.67722 0.279
NP_440796.1_3 Reverse -177 -195 8.08151 0.281
NP_440219.1_1 Reverse -70 -89 15.4197 0.158
NP_441508.1_4 Reverse -243 -257 16.2452 0.227
NP_441541.1_1 Reverse -73 -91 10.6971 0.0858
NP_440546.1_4 Forward -193 -183 10.046 0.109
NP_440546.1_4 Reverse -184 -194 10.046 0.109
NP_440462.1_4 Reverse -317 -331 5.80112 0.29
NP_440462.1_6 Forward -195 -185 9.61647 0.0429
NP_440462.1_6 Reverse -182 -192 7.74818 0.0699
NP_440868.1_4 Forward -197 -185 17.6402 0.0124
NP_440868.1_4 Reverse -180 -192 8.10212 0.0602
NP_441204.1_1 Reverse -175 -194 5.89931 0.284
NP_441848.1_4 Forward -115 -99 12.9937 0.195
NP_441084.1_6 Reverse -247 -261 9.73195 0.269
NP_442039.1_4 Forward -192 -185 15.1821 0.0124
NP_442039.1_4 Reverse -185 -192 15.1821 0.0124
NP_442837.1_3 Forward -192 -185 15.7721 0.0124
NP_442837.1_3 Reverse -185 -192 15.7721 0.0124
NP_442053.1_1 Forward -193 -184 18.3876 0.0007
NP_442053.1_1 Reverse -184 -193 18.3876 0.0007
NP_440505.1_3 Forward -195 -185 18.3679 0.00213
NP_440505.1_3 Reverse -182 -192 16.303 0.00696
NP_440505.1_7 Forward -271 -252 15.0441 0.146
NP_440914.1_1 Forward -193 -183 17.5935 0.000537
NP_440914.1_1 Reverse -184 -194 17.5935 0.000537
NP_441011.1_8 Forward -192 -183 8.25953 0.144
NP_441011.1_8 Reverse -185 -194 8.25953 0.144
NP_442533.1_6 Forward -193 -184 17.2076 0.00137
NP_442533.1_6 Reverse -184 -193 17.2076 0.00137
NP_442541.1_10 Reverse -184 -198 3.93223 0.252
NP_441482.1_7 Reverse -178 -192 5.99778 0.0364
NP_439944.1_9 Forward -192 -182 19.0562 0.00329
NP_439944.1_9 Reverse -185 -195 10.5014 0.0887
NP_441697.1_5 Forward -86 -67 -10.0748 0.278
NP_440816.1_2 Reverse -86 -105 5.85408 0.293
NP_441028.1_6 Reverse -103 -113 4.20782 0.278
NP_440116.1_8 Reverse -185 -204 1.67108 0.0915
NP_440116.1_8 Forward -192 -173 -4.32711 0.168
NP_440115.1_6 Forward -196 -186 15.0247 0.0505
NP_440007.1_9 Reverse -307 -321 3.34284 0.27
NP_441602.1_3 Reverse -185 -204 -2.0655 0.232
NP_441972.1_5 Forward -192 -173 -3.63879 0.201
NP_441106.1_1 Forward -194 -185 9.63616 0.0311
NP_441106.1_1 Reverse -183 -192 9.63616 0.0311
NP_440429.1_2 Reverse -189 -208 7.47261 0.288
NP_440429.1_2 Reverse -185 -204 7.07928 0.295
NP_442306.1_10 Forward -198 -179 -20.1584 0.202
NP_441186.1_4 Forward -89 -79 16.1058 0.223
NP_441286.1_1 Forward -194 -182 21.3768 0.00196
NP_441286.1_1 Reverse -183 -195 12.9203 0.00815
NP_440670.1_8 Forward -193 -184 18.3876 0.000699
NP_440670.1_8 Reverse -184 -193 18.3876 0.000699
NP_439955.1_10 Reverse -247 -266 11.405 0.282
NP_440886.1_7 Forward -194 -184 7.94438 0.0805
NP_440886.1_7 Reverse -183 -193 7.94438 0.0805
NP_442614.1_2 Reverse -184 -198 14.3559 0.102
NP_442264.1_2 Reverse -180 -197 9.28195 0.198
NP_442264.1_2 Reverse -174 -191 7.90532 0.225
NP_439967.1_7 Reverse -183 -201 20.8653 0.0554
NP_439967.1_7 Forward -344 -326 11.3272 0.193
NP_441021.1_1 Forward -192 -173 -8.85033 0.201
NP_441463.1_2 Reverse -69 -87 -1.07099 0.293
NP_441463.1_2 Reverse -79 -97 -1.26321 0.293
NP_441463.1_3 Reverse -174 -193 10.3242 0.0481
NP_441463.1_6 Reverse -182 -196 8.34861 0.25
NP_441626.1_2 Forward -192 -185 15.7721 0.0124
NP_441626.1_2 Reverse -185 -192 15.7721 0.0124
NP_442365.1_7 Forward -197 -178 8.06259 0.0899
NP_442365.1_7 Reverse -180 -199 3.73603 0.156
NP_442794.1_1 Reverse -180 -192 7.02048 0.152
NP_442794.1_1 Forward -185 -173 5.64384 0.212
NP_442615.1_1 Reverse -175 -193 6.90232 0.0335
NP_441962.1_4 Forward -198 -179 -1.37718 0.123
NP_441962.1_4 Reverse -158 -177 -12.8819 0.265
NP_440387.1_1 Forward -193 -177 11.8583 0.0149
NP_441836.1_2 Forward -199 -180 2.45773 0.172
NP_441993.1_1 Reverse -313 -332 0.679741 0.294
NP_440114.1_10 Reverse -184 -198 7.27608 0.239
NP_440114.1_10 Forward -193 -179 5.80112 0.292
NP_441425.1_3 Reverse -89 -99 15.5163 0.273
NP_441552.1_3 Forward -200 -181 13.7649 0.263
NP_442103.1_1 Reverse -255 -269 13.8643 0.254
NP_440457.1_1 Forward -197 -185 10.7571 0.092
NP_440457.1_1 Reverse -180 -192 -0.0593532 0.25
NP_440798.1_6 Reverse -185 -198 6.21414 0.14
NP_441436.1_8 Forward -259 -240 9.3409 0.266
NP_442509.1_9 Reverse -311 -321 10.3043 0.184
NP_442509.1_9 Forward -193 -183 8.14104 0.192
NP_442509.1_9 Reverse -184 -194 8.14104 0.192
NP_442582.1_3 Forward -94 -80 16.6272 0.127
NP_440554.1_4 Reverse -185 -195 8.92815 0.0646
NP_440554.1_4 Forward -192 -182 7.05986 0.106
NP_441885.1_5 Forward -193 -183 20.9245 0.000538
NP_441885.1_5 Reverse -184 -194 20.9245 0.000538
NP_442341.1_7 Forward -194 -180 13.6676 0.0334
NP_442341.1_7 Reverse -183 -197 1.08123 0.299
NP_442341.1_9 Reverse -309 -323 5.01387 0.284
NP_441173.1_9 Forward -90 -82 10.6388 0.261
NP_440191.1_4 Forward -298 -288 13.342 0.282
NP_443000.1_7 Forward -195 -185 19.9412 0.00223
NP_443000.1_7 Reverse -182 -192 17.0896 0.00865
NP_441842.1_1 Reverse -186 -199 19.8815 0.0111
NP_440275.1_3 Forward -195 -185 15.123 0.0182
NP_440275.1_3 Reverse -182 -192 8.1415 0.0602
NP_440091.1_1 Forward -197 -185 8.29878 0.0653
NP_440091.1_1 Reverse -180 -192 -0.452677 0.273
NP_443060.1_5 Forward -201 -182 8.84842 0.197
NP_442451.1_2 Forward -201 -182 -5.9004 0.228
NP_440149.1_8 Forward -193 -174 -0.983855 0.154
NP_440149.1_8 Reverse -184 -203 -1.47551 0.16
NP_440216.1_1 Reverse -184 -198 19.3708 0.000776
NP_440216.1_1 Forward -193 -179 -10.7185 0.146
NP_440172.1_1 Forward -193 -183 15.0247 0.00945
NP_440172.1_1 Reverse -184 -194 15.0247 0.00945
NP_442015.1_10 Forward -197 -184 11.819 0.0372
NP_442015.1_10 Reverse -180 -193 0.412608 0.227
NP_441226.1_7 Forward -192 -185 14.4934 0.0123
NP_441226.1_7 Reverse -185 -192 14.4934 0.0123
NP_441111.1_7 Forward -192 -184 18.7023 0.00294
NP_441111.1_7 Reverse -185 -193 18.7023 0.00294
NP_441766.1_2 Forward -193 -184 17.5026 0.00297
NP_441766.1_2 Reverse -184 -193 17.5026 0.00297
NP_440416.1_9 Reverse -177 -196 -14.3569 0.176
NP_440261.1_5 Reverse -185 -198 5.13249 0.0476
NP_440261.1_5 Forward -192 -179 -10.4038 0.201
NP_440988.1_10 Reverse -182 -196 16.9036 0.112
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGCCTCTTTCCGCACATACATAAACACGAATAGATTAGGATTCGGTAGTGCATCCGTTGAACCATCCAACCGACCCAATGCCCGATCAGCTTTAGAGAGCAAGTTCCACATTTCCTGATCCATTTCGACGGCAGGATTTGGTGGCAAGGGTTTTGGAATAAACGCCCGATAACCTTCCACCTGCTGCACATACTGACCTGCTCGGCTGGCGATCGCCATAATTATCGCTTTCGTTAATACTGCATTGATTTCAAGCTTATATTATCGGAAAAGACTGCTTTTCATTAATAAGGAAAAATGTCGCACCATTTTTAACAAAACTCCATAAATCTATAGGTAGTGGTGTTCAAGTAGCTCAAAGTTAAATTATCGTTTTATAAGCCACTATAGGTAGTGTGAT

CDS

ATGGATTTAGATGCACGGTTTGAGTGTGATATCACACCATTGCGATCAACCTTTATCACGTATAACCAAGGAAGGGCACAGCCCAGGGGTAGTCGTAGGACTGCCGCACGAGCCGCCACCGGATTAAAGGTTGCGGTTTTTGTGTTTTATCGTACCCTCAAAAATTTGATCAGCACCTTCCCTGGGCGTGACCATTGCCAAAAACTTCGCAAAACGCTAAGATTTGATTGTGGTTAA

Protein

No sequence available