Your browser is old and dusty. Try Google Chrome!

Details for ssr6089

ORF ssr6089
Accession NP_942532.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -392 -378 6.09611 0.126
NP_441418.1_1 Reverse -80 -99 11.6018 0.203
NP_440815.1_2 Reverse -171 -185 10.5204 0.265
NP_441812.1_3 Reverse -30 -44 7.57108 0.272
NP_442062.1_3 Reverse -80 -99 -1.18052 0.256
NP_441802.1_1 Forward -262 -243 17.5024 0.168
NP_441200.1_4 Forward -264 -245 12.1925 0.172
NP_442742.1_9 Reverse -250 -269 -4.81876 0.221
NP_442889.1_8 Reverse -68 -82 3.24392 0.284
NP_442570.1_3 Reverse -29 -48 -4.81876 0.235
NP_441716.1_2 Reverse -250 -269 -1.81236 0.289
NP_441194.1_1 Reverse -77 -96 17.2359 0.117
NP_442145.1_4 Reverse -221 -240 2.81659 0.299
NP_440470.1_5 Reverse -325 -344 10.7424 0.195
NP_440842.1_10 Reverse -380 -394 4.03116 0.254
NP_440057.1_6 Forward -345 -326 11.079 0.289
NP_441857.1_6 Reverse -338 -348 16.7946 0.163
NP_442687.1_5 Forward -25 -11 17.3132 0.277
NP_441077.1_6 Reverse -84 -100 2.41624 0.284
NP_441077.1_6 Reverse -143 -159 1.74139 0.298
NP_441077.1_7 Reverse -335 -354 11.9958 0.296
NP_441846.1_2 Forward -72 -53 15.2399 0.19
NP_441846.1_10 Reverse -33 -52 -23.305 0.282
NP_440781.1_6 Reverse -221 -239 5.82068 0.271
NP_440042.1_1 Reverse -346 -365 9.63589 0.236
NP_440667.1_2 Reverse -48 -67 -0.0988766 0.209
NP_440662.1_2 Forward -263 -244 -4.13045 0.276
NP_441317.1_4 Reverse -339 -353 9.55945 0.29
NP_442816.1_7 Reverse -312 -331 4.24897 0.279
NP_439990.1_5 Reverse -314 -327 5.42749 0.295
NP_442690.1_1 Reverse -17 -36 -17.0118 0.296
NP_442911.1_1 Reverse -14 -27 14.1946 0.291
NP_440993.1_3 Forward -53 -34 4.52188 0.162
NP_443020.1_4 Forward -49 -30 16.7149 0.232
NP_441000.1_5 Forward -234 -215 10.7167 0.214
NP_440345.1_3 Reverse -249 -263 14.0489 0.216
NP_441568.1_9 Reverse -80 -93 18.3082 0.217
NP_441079.1_7 Reverse -81 -100 -4.52452 0.25
NP_442970.1_3 Forward -201 -183 16.5368 0.151
NP_442292.1_2 Forward -208 -194 17.5855 0.248
NP_442301.1_2 Forward -64 -45 4.91521 0.27
NP_441876.1_9 Forward -395 -385 11.091 0.28
NP_441826.1_2 Reverse -384 -398 -4.32697 0.295
NP_442490.1_9 Reverse -22 -41 -6.68705 0.273
NP_441764.1_8 Forward -31 -21 13.6076 0.284
NP_441764.1_8 Forward -337 -327 11.5978 0.284
NP_441612.1_2 Forward -259 -249 11.7441 0.21
NP_442820.1_3 Forward -400 -390 15.7125 0.266
NP_441048.1_4 Forward -391 -372 10.3242 0.266
NP_441878.1_6 Forward -393 -383 -0.0199663 0.163
NP_442192.1_5 Forward -40 -21 8.35759 0.265
NP_442919.1_3 Forward -363 -344 6.13106 0.282
NP_440356.1_9 Forward -287 -268 12.9791 0.198
NP_442998.1_5 Reverse -389 -399 11.9764 0.176
NP_442998.1_5 Reverse -295 -305 8.1415 0.271
NP_440899.1_8 Reverse -239 -258 -9.63698 0.267
NP_442504.1_3 Reverse -232 -251 8.25926 0.221
NP_440456.1_7 Forward -262 -248 19.6658 0.0949
NP_441464.1_10 Reverse -22 -36 9.34103 0.262
NP_441340.1_9 Forward -30 -20 16.0642 0.194
NP_440146.1_1 Forward -162 -144 16.5221 0.166
NP_442959.1_5 Reverse -235 -254 8.45592 0.224
NP_439937.1_9 Reverse -245 -262 -10.9749 0.237
NP_442294.1_3 Forward -309 -295 11.7003 0.298
NP_440836.1_6 Reverse -246 -260 9.93102 0.254
NP_440819.1_5 Forward -374 -366 7.98423 0.228
NP_441877.1_7 Reverse -268 -287 1.57197 0.242
NP_441018.1_8 Forward -110 -91 17.8957 0.261
NP_442556.1_10 Reverse -342 -361 10.0722 0.273
NP_440297.1_9 Forward -391 -381 -0.0199663 0.282
NP_442280.1_10 Reverse -344 -362 5.55182 0.283
NP_442454.1_2 Reverse -13 -32 9.69201 0.291
NP_442277.1_4 Reverse -381 -400 4.22689 0.2
NP_442710.1_7 Reverse -83 -102 0.56215 0.187
NP_440936.1_10 Forward -195 -176 1.00224 0.241
NP_440519.1_8 Forward -321 -305 7.82668 0.199
NP_441785.1_1 Forward -288 -274 15.3562 0.146
NP_440673.1_3 Forward -280 -273 9.67555 0.179
NP_441052.1_2 Reverse -113 -123 1.84832 0.225
NP_442813.1_1 Forward -297 -278 7.7676 0.224
NP_440296.1_10 Forward -374 -355 -14.9469 0.279
NP_441982.1_6 Forward -12 -3 10.7665 0.292
NP_440338.1_4 Forward -343 -324 9.24175 0.268
NP_440338.1_4 Forward -100 -81 6.1935 0.29
NP_441124.1_5 Reverse -14 -24 16.5414 0.168
NP_440431.1_4 Forward -31 -12 -8.26048 0.275
NP_440023.1_7 Reverse -328 -347 6.4893 0.269
NP_441333.1_1 Forward -186 -176 12.2572 0.238
NP_442320.1_2 Reverse -330 -349 24.2872 0.00509
NP_440313.1_5 Forward -35 -17 15.063 0.214
NP_440578.1_10 Forward -189 -170 8.94757 0.286
NP_440426.1_1 Reverse -30 -40 16.8829 0.144
NP_441022.1_1 Forward -27 -18 13.2728 0.216
NP_440250.1_4 Reverse -271 -290 11.405 0.208
NP_440847.1_3 Reverse -363 -377 13.2736 0.217
NP_439970.1_4 Reverse -218 -237 -4.91709 0.293
NP_443040.1_1 Forward -356 -342 11.8267 0.276
NP_441044.1_4 Forward -65 -47 6.214 0.223
NP_441609.1_1 Forward -25 -6 -0.000545616 0.225
NP_441671.1_10 Reverse -292 -311 0.786102 0.281
NP_441239.1_9 Forward -394 -382 8.00379 0.145
NP_440624.1_5 Reverse -9 -27 12.5841 0.192
NP_440219.1_1 Forward -189 -170 15.4197 0.158
NP_440833.1_6 Forward -257 -243 7.27547 0.282
NP_440546.1_6 Forward -265 -246 10.0292 0.247
NP_441497.1_3 Reverse -272 -291 -10.6203 0.294
NP_442402.1_10 Reverse -266 -276 13.2542 0.204
NP_442679.1_1 Forward -41 -22 -5.40875 0.293
NP_440825.1_6 Reverse -17 -36 7.27595 0.285
NP_440505.1_3 Reverse -43 -53 8.82982 0.133
NP_442360.1_5 Forward -265 -255 14.6313 0.201
NP_441252.1_6 Forward -261 -254 11.9372 0.25
NP_442322.1_4 Forward -49 -32 -6.84499 0.277
NP_442535.1_2 Forward -278 -259 8.06259 0.228
NP_441697.1_5 Reverse -8 -27 -1.48055 0.206
NP_441697.1_5 Forward -26 -7 -7.68752 0.248
NP_441697.1_5 Forward -102 -83 -9.50187 0.268
NP_441697.1_5 Reverse -9 -28 -10.2658 0.278
NP_441697.1_5 Reverse -145 -164 -10.6478 0.28
NP_440816.1_2 Reverse -170 -189 7.88715 0.259
NP_441527.1_4 Forward -368 -349 -10.5523 0.272
NP_441930.1_3 Forward -256 -237 4.40654 0.269
NP_440083.1_9 Forward -33 -14 11.8401 0.281
NP_440404.1_1 Reverse -6 -25 9.24257 0.285
NP_440404.1_9 Forward -29 -10 15.326 0.142
NP_440404.1_9 Forward -358 -339 10.3605 0.209
NP_440205.1_4 Forward -37 -18 12.7825 0.274
NP_439958.1_2 Forward -166 -152 11.0127 0.288
NP_441460.1_2 Reverse -351 -364 14.375 0.24
NP_441962.1_4 Forward -398 -379 -14.0619 0.282
NP_442352.1_10 Reverse -342 -360 3.46073 0.246
NP_441425.1_4 Forward -31 -17 14.8476 0.282
NP_440492.1_9 Forward -29 -15 17.385 0.193
NP_440766.1_5 Forward -261 -249 19.5923 0.0617
NP_441421.1_6 Forward -164 -147 9.79232 0.282
NP_439988.1_3 Reverse -379 -393 4.81781 0.292
NP_442930.1_1 Forward -27 -17 15.1225 0.202
NP_442930.1_1 Reverse -18 -28 12.5659 0.239
NP_441159.1_1 Forward -166 -147 -2.36049 0.226
NP_441159.1_8 Reverse -57 -76 -4.32786 0.296
NP_442703.1_9 Forward -269 -251 4.05072 0.262
NP_440898.1_10 Forward -131 -112 19.764 0.202
NP_441397.1_8 Forward -261 -248 16.1044 0.142
NP_441902.1_3 Forward -261 -251 13.4676 0.23
NP_441902.1_3 Forward -134 -124 12.1071 0.274
NP_442638.1_3 Forward -31 -12 10.7424 0.298
NP_441635.1_1 Reverse -83 -102 5.77684 0.259
NP_440216.1_9 Forward -33 -24 6.39124 0.289
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CAGTTTTGGCCCCTGGCACTATCTCACGGGAAGAATGGCTCAAGAGAAAACAAGCCAAATCCTAAATAAAATTTCAACCGTCAGTGACACTGAGGGATTCTTGCCCCGAGTAAGCTTTAACCATTGCGGGAAAGTACTTTGGGGCAAAAATAGCCCGGAGATTTAACTATAACCAAGATTGATAAGACCTATAAGTTTCTGTATATTAAATGACTTTTTTACTTTAGCTATTTAGCTAGAAAGTATTTAGATTTATCTGCTCCCACTTAGGAAACAATGCTGATAACCTCTCTATGACTCAAAACTTAACGGTTTTTTATTTCTAGCGCAATTACAAAAACGATGCTACTACCCCCTCACGGTCAACCCAAAGAAAAAATTTTCAAACTCCTTGAAAAAG

CDS

ATGGGACTTTTAAGTTATGGTCTTGAATTACTAGCCTTTACCCCCGGAGTTCTTCTACCCCCATACCCCACTAAAAAAGGCAACGGGCAAAAAAGGCCCATCGCCAATAACAAAAAAATAGTGCAAAATCCTGTAAATTTATTGGGAGGATCCACCGTTCCCCATTCAGTATTTAGAGGTTTGAAATGTTTCAGCGGCAAGGTCAGCCGCATCCTATAG

Protein

No sequence available