Your browser is old and dusty. Try Google Chrome!

Details for ssr6062

ORF ssr6062
Accession NP_942505.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -321 -307 -2.16369 0.285
NP_440795.1_7 Reverse -258 -265 5.74231 0.279
NP_441418.1_1 Forward -88 -69 17.1404 0.0628
NP_440815.1_2 Forward -388 -374 10.5204 0.265
NP_442291.1_5 Forward -267 -251 -2.30141 0.215
NP_441453.1_4 Forward -266 -258 6.90259 0.121
NP_441453.1_4 Reverse -257 -265 6.70593 0.121
NP_442838.1_5 Forward -51 -32 12.3892 0.274
NP_441818.1_9 Reverse -304 -323 2.45773 0.186
NP_440226.1_1 Reverse -257 -276 3.83436 0.212
NP_441098.1_3 Reverse -59 -78 -7.6503 0.296
NP_442173.1_1 Forward -265 -257 11.7208 0.034
NP_442173.1_1 Reverse -258 -266 7.49257 0.171
NP_442752.1_4 Reverse -148 -155 9.18389 0.116
NP_443027.1_4 Reverse -255 -265 11.0914 0.107
NP_440784.1_7 Forward -265 -258 6.43063 0.218
NP_440784.1_7 Reverse -258 -265 6.23397 0.241
NP_442861.1_1 Forward -283 -264 11.8975 0.277
NP_440061.1_9 Reverse -255 -269 9.14375 0.151
NP_440110.1_4 Reverse -246 -265 3.83436 0.213
NP_442062.1_3 Forward -88 -69 5.50599 0.182
NP_442062.1_8 Reverse -257 -267 7.25653 0.104
NP_442062.1_8 Forward -266 -256 5.28991 0.176
NP_441859.1_3 Forward -322 -303 4.12856 0.228
NP_442242.1_4 Forward -265 -258 13.3138 0.027
NP_440044.1_8 Forward -265 -246 -2.16383 0.261
NP_441208.1_9 Forward -334 -320 7.27608 0.223
NP_442375.1_5 Forward -313 -299 12.5853 0.289
NP_441925.1_5 Reverse -234 -248 19.8624 0.0337
NP_441083.1_5 Forward -266 -256 8.23984 0.0429
NP_441083.1_5 Reverse -257 -267 1.16001 0.215
NP_441434.1_1 Forward -84 -70 9.27434 0.24
NP_441738.1_2 Forward -264 -257 13.3134 0.0335
NP_441645.1_1 Reverse -211 -230 11.11 0.191
NP_440209.1_1 Reverse -257 -265 8.27922 0.0687
NP_442445.1_2 Reverse -190 -209 8.45592 0.288
NP_441327.1_1 Forward -32 -13 3.25228 0.277
NP_441163.1_4 Forward -397 -378 11.6619 0.297
NP_441533.1_1 Forward -214 -195 12.5858 0.252
NP_440906.1_5 Forward -265 -258 6.52896 0.199
NP_440906.1_5 Reverse -258 -265 6.0373 0.262
NP_440747.1_10 Reverse -254 -266 6.92215 0.012
NP_440747.1_10 Forward -269 -257 -11.9574 0.178
NP_441486.1_1 Forward -269 -255 -5.11362 0.222
NP_442145.1_4 Forward -90 -71 6.54077 0.216
NP_442634.1_4 Reverse -255 -269 -4.52363 0.206
NP_440470.1_5 Reverse -73 -92 6.34979 0.279
NP_440470.1_5 Reverse -83 -102 5.77684 0.292
NP_443018.1_3 Forward -320 -313 9.38056 0.128
NP_443018.1_3 Forward -265 -258 5.15232 0.226
NP_443018.1_3 Reverse -258 -265 5.05399 0.238
NP_441634.1_8 Reverse -255 -269 -2.16369 0.295
NP_441182.1_5 Reverse -298 -317 8.84924 0.222
NP_440376.1_1 Forward -266 -257 0.196389 0.283
NP_440376.1_1 Reverse -257 -266 -0.196935 0.285
NP_441797.1_7 Reverse -347 -365 10.6389 0.286
NP_441077.1_2 Forward -99 -80 3.19856 0.251
NP_441077.1_6 Forward -84 -68 11.0929 0.152
NP_441077.1_6 Forward -28 -12 4.44078 0.255
NP_442530.1_2 Forward -214 -204 11.2881 0.284
NP_440642.1_10 Reverse -376 -390 2.35894 0.277
NP_440642.1_10 Reverse -349 -363 2.35894 0.277
NP_440800.1_2 Reverse -272 -291 13.6108 0.299
NP_442937.1_5 Reverse -252 -271 7.27595 0.258
NP_441958.1_5 Reverse -256 -266 1.16001 0.114
NP_442836.1_5 Forward -272 -253 6.78429 0.171
NP_440203.1_5 Reverse -325 -335 10.8943 0.209
NP_440984.1_7 Reverse -315 -329 6.19444 0.224
NP_442690.1_1 Forward -190 -171 -14.7502 0.273
NP_442690.1_1 Reverse -72 -91 -14.7502 0.273
NP_442690.1_1 Reverse -229 -248 -16.0285 0.283
NP_442911.1_2 Forward -276 -257 10.1275 0.0155
NP_440858.1_1 Forward -289 -270 -5.70374 0.281
NP_442064.1_1 Reverse -372 -391 -10.227 0.259
NP_443055.1_3 Reverse -313 -332 11.3136 0.26
NP_441099.1_10 Reverse -8 -18 19.1541 0.0842
NP_442438.1_10 Forward -271 -257 1.17956 0.204
NP_440377.1_1 Forward -76 -59 10.3074 0.298
NP_440484.1_1 Forward -150 -131 17.2065 0.119
NP_440147.1_4 Reverse -255 -268 12.999 0.0326
NP_441550.1_8 Reverse -255 -265 5.28945 0.255
NP_441916.1_7 Forward -266 -256 1.25834 0.289
NP_440345.1_5 Forward -97 -83 13.8565 0.276
NP_439966.1_4 Forward -282 -263 5.01433 0.293
NP_439966.1_7 Reverse -255 -265 5.68278 0.214
NP_442941.1_3 Forward -265 -255 9.81313 0.0263
NP_442941.1_3 Reverse -258 -268 -1.10161 0.284
NP_440983.1_5 Forward -328 -309 -6.58872 0.278
NP_442281.1_1 Reverse -252 -266 12.2903 0.0385
NP_441079.1_7 Reverse -219 -238 -3.63955 0.238
NP_441079.1_7 Forward -31 -12 -7.96609 0.298
NP_441644.1_6 Forward -321 -311 9.51767 0.0747
NP_441644.1_6 Forward -266 -256 5.28945 0.199
NP_442215.1_2 Forward -330 -314 -2.49807 0.198
NP_442215.1_2 Forward -395 -379 -6.03799 0.263
NP_442029.1_6 Reverse -301 -320 6.39097 0.238
NP_442247.1_8 Reverse -255 -269 10.0294 0.247
NP_440780.1_1 Reverse -218 -237 8.35512 0.274
NP_442933.1_2 Reverse -44 -62 5.63601 0.291
NP_442933.1_6 Forward -90 -71 13.4162 0.287
NP_442933.1_10 Forward -266 -257 7.96454 0.0937
NP_442933.1_10 Reverse -257 -266 7.76787 0.11
NP_440382.1_2 Forward -84 -65 0.785326 0.299
NP_441751.2_8 Forward -265 -251 -3.24533 0.137
NP_442554.1_8 Forward -265 -255 13.5497 0.018
NP_442554.1_8 Reverse -313 -323 9.61647 0.0576
NP_442142.1_4 Reverse -254 -267 2.18201 0.299
NP_442292.1_1 Forward -265 -256 16.421 0.00748
NP_442292.1_1 Reverse -258 -267 -0.295266 0.24
NP_441715.1_4 Forward -265 -255 16.1063 0.0144
NP_440379.1_5 Reverse -303 -322 -8.94866 0.257
NP_441758.1_10 Reverse -36 -55 0.883656 0.197
NP_441468.1_1 Forward -265 -258 13.0188 0.0383
NP_441468.1_1 Reverse -258 -265 6.0373 0.223
NP_439939.1_4 Reverse -367 -386 1.67108 0.199
NP_441673.1_1 Forward -266 -257 1.37636 0.114
NP_441673.1_1 Reverse -257 -266 1.1797 0.163
NP_442868.1_6 Reverse -255 -265 9.61647 0.0429
NP_442050.1_5 Forward -268 -258 12.1726 0.0699
NP_442903.1_2 Forward -91 -72 6.15881 0.18
NP_442342.1_9 Forward -323 -307 8.02334 0.194
NP_440334.1_1 Forward -299 -280 13.7982 0.298
NP_440346.1_6 Reverse -225 -235 13.5642 0.291
NP_440274.1_2 Reverse -347 -361 12.9786 0.236
NP_441878.1_6 Reverse -311 -321 0.668351 0.139
NP_441100.1_1 Forward -209 -190 11.7992 0.255
NP_441036.1_8 Forward -267 -257 6.56821 0.225
NP_441557.1_5 Reverse -257 -266 8.84951 0.0343
NP_441557.1_5 Forward -266 -257 0.786375 0.106
NP_441458.1_8 Forward -30 -11 5.55986 0.259
NP_442347.1_2 Forward -265 -256 5.50626 0.229
NP_440563.1_4 Forward -134 -121 18.2105 0.181
NP_441633.1_3 Reverse -255 -268 -6.17557 0.238
NP_440136.1_2 Forward -265 -258 6.52896 0.116
NP_440136.1_2 Reverse -258 -265 6.13563 0.193
NP_442590.1_10 Forward -328 -309 7.86593 0.218
NP_441728.2_4 Forward -91 -72 23.3474 0.00228
NP_442998.1_5 Forward -381 -371 11.7798 0.176
NP_442998.1_5 Forward -214 -204 11.3864 0.187
NP_442998.1_5 Forward -348 -338 9.32148 0.243
NP_442998.1_10 Forward -264 -257 12.3305 0.0564
NP_440299.1_1 Reverse -253 -266 7.88518 0.103
NP_441799.1_1 Forward -270 -256 13.077 0.0362
NP_442158.1_2 Reverse -12 -31 15.326 0.247
NP_442158.1_4 Reverse -375 -385 12.3697 0.253
NP_441866.1_6 Reverse -343 -362 13.9616 0.159
NP_441866.1_6 Reverse -375 -394 7.57013 0.271
NP_441704.1_2 Reverse -217 -236 7.07848 0.256
NP_440215.1_6 Reverse -247 -266 15.6332 0.228
NP_440695.1_6 Forward -21 -7 9.73265 0.276
NP_442386.1_9 Forward -322 -313 8.35743 0.201
NP_442386.1_9 Forward -267 -258 5.50585 0.25
NP_441340.1_5 Forward -265 -258 5.93897 0.198
NP_441340.1_5 Reverse -258 -265 5.84064 0.208
NP_441340.1_9 Forward -242 -232 15.1001 0.194
NP_441340.1_9 Forward -382 -372 8.15881 0.256
NP_440327.1_6 Forward -53 -34 4.81767 0.266
NP_440161.1_3 Forward -268 -249 8.25926 0.273
NP_441027.1_1 Forward -79 -65 13.4703 0.27
NP_442251.1_6 Forward -265 -258 13.0188 0.0408
NP_443051.1_1 Reverse -256 -265 0.589713 0.143
NP_439937.1_9 Forward -322 -305 -1.53514 0.124
NP_441595.1_2 Forward -217 -204 9.80195 0.277
NP_439943.1_2 Reverse -326 -345 11.2092 0.251
NP_440372.1_2 Forward -265 -258 6.62729 0.151
NP_440372.1_2 Reverse -258 -265 6.52896 0.188
NP_441138.1_5 Forward -231 -218 3.97694 0.297
NP_440210.1_10 Reverse -342 -361 4.22689 0.296
NP_442384.1_10 Forward -266 -253 2.37923 0.228
NP_442114.1_2 Forward -83 -64 0.392778 0.262
NP_441877.1_5 Forward -269 -250 -1.18052 0.283
NP_441877.1_9 Reverse -69 -86 4.26707 0.284
NP_442262.1_10 Forward -265 -258 10.6589 0.14
NP_442262.1_10 Forward -320 -313 9.47889 0.187
NP_441689.1_5 Forward -268 -258 5.58445 0.23
NP_442917.1_1 Forward -91 -72 7.86512 0.254
NP_440297.1_9 Forward -320 -310 -0.0199663 0.282
NP_442378.1_1 Reverse -175 -192 16.4601 0.22
NP_440894.1_10 Forward -333 -314 5.11266 0.238
NP_440999.1_9 Forward -270 -256 1.37622 0.166
NP_440888.1_2 Reverse -257 -271 8.84875 0.145
NP_440888.1_2 Forward -266 -252 6.68548 0.223
NP_441771.1_8 Forward -88 -69 10.5514 0.11
NP_442033.1_10 Reverse -320 -339 -11.9969 0.261
NP_442033.1_10 Forward -323 -304 -14.2585 0.298
NP_441543.1_2 Forward -265 -256 7.17789 0.131
NP_441543.1_2 Reverse -258 -267 4.22796 0.267
NP_442845.1_2 Forward -272 -258 7.27608 0.195
NP_442710.1_7 Forward -102 -83 1.23492 0.175
NP_442315.1_2 Reverse -143 -155 8.6921 0.293
NP_442578.1_7 Reverse -258 -265 5.15232 0.291
NP_440148.1_1 Reverse -170 -189 2.94938 0.186
NP_441462.1_2 Reverse -257 -267 0.766681 0.125
NP_441621.1_3 Reverse -185 -203 13.8838 0.186
NP_441410.1_4 Forward -51 -32 7.07848 0.297
NP_442780.1_1 Forward -85 -66 11.5042 0.169
NP_442780.1_1 Forward -86 -67 6.88262 0.291
NP_440516.1_8 Reverse -257 -266 -0.393597 0.255
NP_442080.1_7 Reverse -121 -140 5.50599 0.122
NP_442428.1_5 Forward -265 -258 6.3323 0.193
NP_442428.1_5 Reverse -258 -265 6.13563 0.209
NP_441052.1_2 Reverse -322 -332 2.24165 0.213
NP_441052.1_2 Forward -266 -256 2.04498 0.22
NP_441052.1_2 Reverse -257 -267 0.766681 0.256
NP_442219.1_9 Reverse -258 -267 8.84951 0.0681
NP_442219.1_9 Forward -265 -256 8.25953 0.0681
NP_440436.1_4 Forward -265 -256 7.47246 0.129
NP_440436.1_4 Reverse -258 -267 6.29249 0.164
NP_441884.1_2 Forward -302 -288 19.0145 0.132
NP_441884.1_7 Reverse -174 -187 17.0299 0.265
NP_441719.1_2 Reverse -374 -388 13.4445 0.286
NP_441719.1_4 Forward -265 -258 6.62729 0.151
NP_441719.1_4 Reverse -258 -265 6.52896 0.188
NP_442813.1_4 Forward -205 -186 -7.76869 0.299
NP_441231.1_3 Reverse -205 -224 11.995 0.261
NP_442695.1_3 Reverse -381 -395 18.0918 0.179
NP_440296.1_6 Reverse -13 -31 9.83765 0.298
NP_441851.1_10 Reverse -256 -266 7.55152 0.137
NP_442515.1_1 Reverse -256 -270 1.96621 0.145
NP_441409.1_6 Forward -272 -253 -7.67036 0.154
NP_440432.1_9 Forward -265 -250 -3.56002 0.183
NP_442843.1_1 Forward -274 -255 -11.5053 0.291
NP_439960.1_10 Forward -322 -304 -3.71743 0.279
NP_441124.1_5 Reverse -64 -74 15.2045 0.198
NP_441031.1_1 Reverse -67 -86 6.72632 0.259
NP_441031.1_1 Forward -92 -73 4.50898 0.288
NP_441031.1_1 Forward -30 -11 3.83414 0.293
NP_441975.1_5 Reverse -197 -216 14.5932 0.184
NP_441078.1_4 Reverse -257 -266 0.196389 0.205
NP_441078.1_4 Forward -266 -257 0.196389 0.205
NP_441432.1_8 Reverse -256 -265 7.17789 0.102
NP_442320.1_8 Reverse -251 -265 -5.21195 0.209
NP_441732.1_2 Reverse -253 -269 -16.4611 0.167
NP_440760.1_1 Reverse -257 -276 -15.4385 0.147
NP_442797.1_9 Forward -266 -248 14.8671 0.114
NP_441057.1_4 Reverse -297 -315 0.805796 0.253
NP_441057.1_4 Reverse -368 -386 -4.20908 0.299
NP_442400.1_10 Reverse -47 -60 9.13351 0.271
NP_442489.1_7 Forward -266 -257 0.688044 0.152
NP_442489.1_7 Reverse -257 -266 0.491382 0.178
NP_440941.1_7 Reverse -89 -103 17.7731 0.218
NP_440559.1_1 Reverse -258 -267 7.66954 0.0999
NP_440559.1_1 Forward -265 -256 7.66954 0.0999
NP_441659.2_8 Forward -266 -256 6.17489 0.084
NP_441659.2_8 Forward -321 -311 1.06167 0.251
NP_440708.1_5 Reverse -255 -274 12.6841 0.0574
NP_441807.1_5 Forward -277 -258 13.8641 0.117
NP_440335.1_9 Forward -251 -233 16.4404 0.184
NP_442346.1_5 Reverse -256 -266 6.56821 0.198
NP_442346.1_5 Forward -267 -257 4.89658 0.269
NP_440545.1_3 Reverse -308 -325 -3.5994 0.208
NP_440250.1_4 Reverse -73 -92 4.52188 0.253
NP_441943.1_2 Forward -84 -65 10.9142 0.27
NP_442603.1_7 Reverse -257 -271 14.6503 0.0613
NP_441888.1_7 Reverse -252 -266 2.65453 0.225
NP_441833.1_4 Forward -265 -258 12.9205 0.0393
NP_441833.1_4 Reverse -258 -265 6.13563 0.198
NP_441329.1_1 Reverse -68 -87 8.16414 0.229
NP_441895.1_2 Forward -246 -227 -18.0934 0.234
NP_442162.1_9 Forward -265 -258 6.52896 0.178
NP_442162.1_9 Reverse -258 -265 6.43063 0.208
NP_440671.1_4 Reverse -53 -67 7.57108 0.214
NP_440224.1_1 Reverse -246 -265 2.3594 0.132
NP_440204.1_9 Reverse -241 -260 19.0757 0.12
NP_442140.1_3 Forward -320 -310 8.92815 0.117
NP_442140.1_3 Reverse -258 -268 3.42162 0.297
NP_441813.1_5 Reverse -255 -265 8.33817 0.047
NP_440594.1_8 Reverse -258 -271 11.5234 0.152
NP_440590.1_4 Reverse -258 -271 -6.07724 0.299
NP_442497.1_4 Forward -390 -371 10.8379 0.271
NP_442497.1_10 Forward -265 -256 0.688044 0.141
NP_440821.1_4 Forward -268 -258 -0.314959 0.251
NP_440821.1_4 Reverse -255 -265 -0.41329 0.257
NP_440227.1_2 Reverse -201 -217 7.04003 0.295
NP_441239.1_9 Forward -323 -311 12.4287 0.0477
NP_441239.1_9 Reverse -310 -322 7.4138 0.161
NP_440156.1_4 Reverse -370 -380 11.6809 0.176
NP_441727.1_3 Reverse -299 -318 2.45773 0.3
NP_441541.1_1 Reverse -70 -88 4.29912 0.171
NP_440833.1_6 Forward -212 -198 13.5686 0.157
NP_440833.1_6 Reverse -268 -282 7.96378 0.277
NP_440833.1_6 Forward -345 -331 7.76712 0.278
NP_440876.1_5 Forward -185 -166 5.01433 0.283
NP_440354.1_5 Reverse -374 -393 7.37428 0.174
NP_441617.1_6 Reverse -371 -390 -5.40875 0.274
NP_440546.1_4 Reverse -257 -267 8.10685 0.203
NP_442349.1_6 Reverse -316 -335 5.01433 0.214
NP_442465.1_5 Forward -73 -54 26.6896 0.000426
NP_442611.1_1 Reverse -307 -326 3.53937 0.208
NP_440868.1_4 Reverse -253 -265 4.95553 0.108
NP_440868.1_4 Forward -270 -258 1.31728 0.186
NP_440401.1_9 Reverse -223 -230 14.5917 0.287
NP_441497.1_3 Forward -387 -368 -11.7019 0.294
NP_440532.1_6 Reverse -206 -225 9.0459 0.286
NP_441848.1_4 Reverse -59 -75 8.98304 0.288
NP_441848.1_7 Forward -211 -192 4.52188 0.215
NP_441084.1_6 Forward -369 -355 12.8346 0.152
NP_442039.1_4 Forward -265 -258 11.3472 0.086
NP_441811.1_8 Forward -272 -258 8.94771 0.227
NP_442837.1_3 Forward -265 -258 6.52896 0.2
NP_442837.1_3 Reverse -258 -265 6.0373 0.25
NP_442053.1_1 Reverse -257 -266 5.60459 0.176
NP_440505.1_3 Reverse -255 -265 8.63316 0.138
NP_442532.1_1 Forward -84 -70 10.9882 0.23
NP_442532.1_4 Forward -188 -170 7.28623 0.3
NP_440914.1_1 Forward -266 -256 6.66328 0.269
NP_440914.1_1 Reverse -257 -267 6.07773 0.297
NP_441699.1_7 Reverse -355 -374 2.55527 0.255
NP_442533.1_6 Reverse -257 -266 6.19458 0.115
NP_442533.1_6 Forward -321 -312 4.22796 0.186
NP_439944.1_9 Reverse -258 -268 13.648 0.0526
NP_441697.1_5 Reverse -59 -78 -8.35597 0.258
NP_441697.1_5 Forward -211 -192 -11.3162 0.295
NP_441028.1_6 Forward -294 -284 5.48612 0.255
NP_441527.1_4 Forward -359 -340 -0.907597 0.146
NP_440115.1_6 Forward -269 -259 6.96153 0.166
NP_440115.1_6 Reverse -254 -264 6.76487 0.167
NP_441869.1_2 Reverse -264 -283 8.55425 0.284
NP_001035870.1_3 Forward -53 -34 -5.01543 0.278
NP_441286.1_1 Reverse -256 -268 2.59558 0.0573
NP_441286.1_1 Forward -267 -255 -5.95921 0.235
NP_442674.1_3 Forward -323 -304 3.24359 0.294
NP_440670.1_8 Reverse -257 -266 5.70292 0.14
NP_440268.1_8 Forward -219 -200 12.5858 0.247
NP_440083.1_9 Forward -385 -366 16.2853 0.278
NP_442614.1_2 Reverse -319 -333 8.55439 0.255
NP_442614.1_2 Reverse -257 -271 5.70279 0.298
NP_442401.1_2 Forward -151 -132 7.4718 0.262
NP_442264.1_2 Reverse -302 -319 12.1336 0.171
NP_440326.1_7 Forward -19 -5 18.9775 0.0312
NP_442842.1_10 Reverse -340 -359 9.88192 0.206
NP_442893.1_4 Reverse -65 -84 -1.77127 0.273
NP_441626.1_2 Forward -265 -258 6.0373 0.212
NP_441626.1_2 Reverse -258 -265 5.93897 0.231
NP_441401.1_5 Forward -131 -112 9.97848 0.297
NP_441962.1_4 Forward -392 -373 -12.6852 0.263
NP_440387.1_1 Reverse -257 -273 -6.03799 0.262
NP_441836.1_2 Forward -272 -253 3.83436 0.147
NP_442352.1_10 Forward -230 -212 4.6407 0.246
NP_441425.1_4 Forward -383 -369 14.5526 0.282
NP_441425.1_4 Reverse -63 -77 13.7659 0.282
NP_442698.1_10 Forward -273 -254 2.45773 0.284
NP_440311.1_2 Forward -372 -353 10.1275 0.299
NP_440766.1_4 Reverse -308 -322 2.65453 0.176
NP_439988.1_10 Reverse -11 -30 9.40425 0.226
NP_441246.1_2 Forward -107 -88 3.34271 0.195
NP_442930.1_1 Reverse -370 -380 11.4843 0.258
NP_442930.1_1 Forward -211 -201 11.3859 0.259
NP_440458.1_7 Reverse -33 -52 3.24359 0.218
NP_440457.1_1 Reverse -308 -320 3.48056 0.195
NP_442936.1_7 Reverse -64 -83 2.94938 0.255
NP_440554.1_4 Forward -265 -255 5.68323 0.135
NP_441885.1_5 Reverse -257 -267 10.1081 0.0145
NP_441885.1_5 Forward -266 -256 1.455 0.11
NP_442703.1_8 Reverse -291 -309 11.7197 0.265
NP_442341.1_7 Reverse -256 -270 4.52282 0.188
NP_443000.1_7 Reverse -255 -265 10.3048 0.0345
NP_440507.2_8 Reverse -328 -347 8.84924 0.123
NP_441842.1_1 Reverse -259 -272 16.1449 0.0484
NP_440275.1_3 Reverse -255 -265 5.28991 0.158
NP_440091.1_1 Forward -270 -258 0.825626 0.227
NP_442451.1_2 Forward -274 -255 -11.2103 0.287
NP_442451.1_2 Forward -195 -176 -11.6036 0.297
NP_441389.1_5 Reverse -244 -263 11.1109 0.251
NP_441207.1_7 Forward -379 -365 8.38408 0.288
NP_440258.1_8 Reverse -368 -387 11.405 0.299
NP_441105.1_3 Forward -398 -379 -10.0303 0.3
NP_442127.1_9 Forward -30 -11 11.1244 0.292
NP_440216.1_1 Forward -266 -252 -12.1934 0.247
NP_440216.1_9 Forward -385 -376 12.3894 0.241
NP_440216.1_9 Forward -384 -375 6.19458 0.289
NP_440678.1_5 Forward -328 -309 8.25926 0.279
NP_440172.1_1 Reverse -257 -267 15.418 0.00945
NP_441111.1_7 Forward -265 -257 8.96754 0.0463
NP_440244.1_8 Reverse -56 -75 4.12936 0.27
NP_441766.1_2 Reverse -257 -266 14.0611 0.0111
NP_443052.1_9 Forward -323 -304 5.80098 0.139
NP_442116.1_6 Forward -221 -204 6.64108 0.273
NP_442116.1_6 Forward -220 -203 5.49518 0.296
NP_440261.1_5 Reverse -258 -271 -5.29059 0.19
NP_440261.1_5 Forward -265 -252 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGAATTTGCTGAAGCCAATGGAAAAATTTTCAGACTATGGATAAAGGGTAAGGTGAAGAACTTTCCTTGTGGATGTCCGCCCATGGCACCGGAAACATCAAAAAGTTAACCTCCATATTGGTCAAGAGTTGGTAGAGATCGCCAGGTTAGAAACCCCTAGTAAAAATTATTGGGGTTGATTTATCTGGACAAAATTTCCTATCTTCATTGGTAAATATCGCTACATTTTAGACCGTACTTAATAGCATCCCCAATAATCAATTCAGCAGTTAATCAAGGTTGTCAGAGTATTAGTGGACAAATCAATAAAGCTTTAAAGAAAGTTAAATTTTCCAATCTTTGTGGTCATTTTTATTTAGCTATTGGACAATATAAATTACTAATTTTAAGGAGTTCATC

CDS

ATGGATTTTAATCCCAATGAGTGGCCTACCCATAAACAAGGTGAGGTTGTCCGCCAACTAATACTAGAGGCGTTGGACAGTCCAAAGACCAAGGAAGAATTGTCCAGTTTGTGCAACAAGAGCGTTAGACAAATCACTAGACATTTACACCGTTTGTCCAGCGAAAACAAGATTTTGTCCACTGGAAAAGGGCAATTTGTCCGGCGGATTGCCGCTGGATTTTTACTCCTTTACGTTGGACAAATTTAG

Protein

No sequence available