Your browser is old and dusty. Try Google Chrome!

Details for ssr6048

ORF ssr6048
Accession NP_942491.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Reverse -188 -207 -2.0655 0.282
NP_440795.1_7 Forward -195 -188 14.6904 0.0123
NP_440795.1_7 Reverse -188 -195 14.6904 0.0123
NP_442291.1_5 Reverse -186 -202 2.71347 0.121
NP_441453.1_4 Reverse -187 -195 16.539 0.00633
NP_441453.1_4 Forward -196 -188 7.8859 0.0536
NP_442151.1_6 Reverse -187 -201 11.5043 0.0981
NP_442838.1_7 Forward -201 -182 -10.6203 0.232
NP_441818.1_1 Reverse -188 -199 9.79292 0.232
NP_441818.1_9 Reverse -171 -190 -9.83364 0.291
NP_440226.1_1 Forward -196 -177 4.22769 0.199
NP_442173.1_1 Forward -195 -187 15.4574 0.00633
NP_442173.1_1 Reverse -188 -196 14.1791 0.0165
NP_442752.1_4 Reverse -187 -194 13.8055 0.0199
NP_442752.1_4 Reverse -207 -214 5.54565 0.194
NP_443027.1_4 Forward -198 -188 17.188 0.0437
NP_443027.1_4 Reverse -185 -195 15.3197 0.0437
NP_441812.1_3 Reverse -186 -200 9.2427 0.245
NP_442975.1_10 Forward -200 -186 12.8803 0.0459
NP_442975.1_10 Reverse -183 -197 8.16044 0.105
NP_440784.1_7 Forward -195 -188 15.9687 0.0123
NP_440784.1_7 Reverse -188 -195 15.9687 0.0123
NP_440061.1_3 Reverse -251 -270 16.5191 0.235
NP_440061.1_4 Reverse -329 -348 19.2715 0.198
NP_440061.1_9 Forward -198 -184 9.43874 0.145
NP_441476.1_5 Reverse -83 -102 -4.42544 0.25
NP_440878.1_9 Reverse -332 -351 4.71934 0.174
NP_442062.1_8 Reverse -187 -197 9.61647 0.0587
NP_442062.1_8 Forward -235 -225 6.76487 0.117
NP_441859.1_3 Forward -197 -178 1.17865 0.293
NP_440304.1_4 Reverse -185 -195 18.9579 0.00406
NP_440304.1_4 Forward -198 -188 10.1081 0.051
NP_442242.1_4 Forward -195 -188 14.3954 0.0124
NP_442242.1_4 Reverse -188 -195 14.3954 0.0124
NP_440044.1_8 Forward -195 -176 26.1555 0.00272
NP_440044.1_8 Reverse -188 -207 1.57275 0.17
NP_441208.1_9 Reverse -184 -198 6.29277 0.252
NP_441594.1_6 Forward -73 -54 3.6377 0.226
NP_440518.1_9 Forward -262 -243 9.3409 0.293
NP_442110.1_7 Reverse -187 -201 11.406 0.0595
NP_440856.1_4 Reverse -180 -199 -1.67217 0.202
NP_441083.1_5 Forward -196 -186 1.94665 0.197
NP_441083.1_5 Reverse -187 -197 1.55333 0.204
NP_442827.1_8 Forward -204 -185 6.98015 0.0988
NP_441434.1_7 Reverse -344 -358 2.2612 0.288
NP_441571.1_6 Reverse -365 -384 13.4708 0.247
NP_441738.1_2 Forward -194 -187 15.28 0.0102
NP_441738.1_2 Reverse -189 -196 11.5435 0.084
NP_441558.1_5 Reverse -185 -204 13.8641 0.0544
NP_441942.1_3 Reverse -232 -251 16.0194 0.252
NP_440209.1_1 Reverse -187 -195 18.1123 0.00295
NP_440209.1_1 Forward -196 -188 8.47588 0.0457
NP_440447.1_6 Reverse -131 -149 1.88744 0.253
NP_441713.1_1 Reverse -181 -200 -14.6519 0.259
NP_441770.1_5 Reverse -179 -198 -2.45882 0.296
NP_440178.1_7 Reverse -186 -205 -14.9469 0.156
NP_442462.1_9 Reverse -174 -193 16.6174 0.197
NP_442111.1_4 Forward -197 -183 15.1426 0.0243
NP_440906.1_5 Forward -195 -188 15.8704 0.0124
NP_440906.1_5 Reverse -188 -195 15.8704 0.0124
NP_440906.1_5 Reverse -313 -320 5.64398 0.292
NP_440747.1_10 Reverse -184 -196 -11.6624 0.131
NP_440747.1_10 Forward -199 -187 -11.7607 0.142
NP_441486.1_1 Forward -199 -185 -5.40861 0.237
NP_442634.1_4 Reverse -185 -199 14.6509 0.0182
NP_442634.1_4 Forward -198 -184 -3.93365 0.176
NP_442848.1_1 Reverse -181 -195 5.30946 0.0854
NP_441012.1_4 Forward -265 -252 11.9173 0.252
NP_439978.1_2 Forward -267 -248 13.7649 0.237
NP_443018.1_3 Forward -195 -188 14.8871 0.0123
NP_443018.1_3 Reverse -188 -195 14.8871 0.0123
NP_443018.1_3 Forward -234 -227 8.49558 0.141
NP_441316.1_7 Forward -198 -183 -3.26502 0.273
NP_441634.1_8 Forward -198 -184 1.57289 0.188
NP_440376.1_1 Reverse -187 -196 9.73449 0.0365
NP_440376.1_1 Forward -196 -187 9.63616 0.0385
NP_440376.1_1 Reverse -342 -351 3.93297 0.188
NP_441002.1_3 Reverse -322 -341 12.585 0.25
NP_442687.1_7 Forward -352 -342 6.96153 0.147
NP_441846.1_10 Forward -351 -332 -13.9635 0.216
NP_440642.1_10 Reverse -5 -19 9.53707 0.186
NP_440642.1_10 Reverse -246 -260 1.47397 0.293
NP_441013.1_2 Reverse -247 -265 1.78911 0.242
NP_440533.1_6 Reverse -261 -280 7.86593 0.29
NP_442658.1_1 Reverse -185 -195 15.9091 0.00966
NP_442658.1_1 Forward -198 -188 11.1893 0.0915
NP_442658.1_1 Forward -339 -329 4.99446 0.288
NP_440141.1_8 Forward -367 -348 5.211 0.277
NP_442205.1_9 Reverse -181 -197 -0.236458 0.264
NP_442205.1_9 Forward -202 -186 -1.12144 0.264
NP_440656.1_8 Reverse -176 -195 -2.75381 0.19
NP_441487.1_9 Reverse -341 -360 -3.04881 0.298
NP_442937.1_5 Forward -111 -92 5.89931 0.295
NP_441958.1_5 Reverse -186 -196 12.0747 0.00222
NP_441958.1_5 Forward -197 -187 11.3864 0.0074
NP_441958.1_5 Forward -352 -342 -0.904945 0.222
NP_441127.1_1 Forward -360 -346 7.86607 0.3
NP_440318.1_1 Reverse -322 -341 4.22769 0.24
NP_442690.1_1 Reverse -128 -147 -11.2103 0.225
NP_442690.1_1 Reverse -229 -248 -15.9302 0.282
NP_442911.1_2 Reverse -177 -196 -2.36049 0.0974
NP_440153.1_5 Forward -195 -181 11.7993 0.0753
NP_440153.1_5 Reverse -188 -202 7.9644 0.149
NP_442064.1_4 Reverse -248 -267 7.57013 0.242
NP_440993.1_2 Forward -201 -185 18.3481 0.0442
NP_440602.1_8 Reverse -187 -201 13.9626 0.164
NP_441913.1_1 Forward -364 -348 17.4019 0.246
NP_440809.1_9 Reverse -178 -196 -7.45401 0.225
NP_441294.1_7 Reverse -183 -197 11.2664 0.15
NP_441294.1_7 Forward -200 -186 9.53859 0.241
NP_442438.1_10 Forward -201 -187 0.687908 0.218
NP_441000.1_5 Reverse -234 -253 12.88 0.176
NP_441000.1_6 Forward -197 -183 -4.4253 0.243
NP_441000.1_6 Reverse -186 -200 -5.01529 0.257
NP_440484.1_3 Reverse -185 -199 11.0127 0.242
NP_440147.1_4 Reverse -86 -99 4.93583 0.142
NP_440147.1_4 Forward -198 -185 3.06754 0.196
NP_441550.1_8 Reverse -185 -195 17.4824 0.00754
NP_441550.1_8 Forward -198 -188 9.81266 0.0836
NP_441550.1_8 Reverse -373 -383 4.99446 0.274
NP_441916.1_7 Forward -196 -186 10.6981 0.0261
NP_441916.1_7 Reverse -187 -197 9.61647 0.0333
NP_441041.1_4 Reverse -187 -206 -11.8003 0.252
NP_441041.1_7 Forward -354 -342 11.5962 0.0757
NP_441041.1_7 Forward -199 -187 7.80631 0.159
NP_442642.1_9 Forward -365 -348 7.512 0.192
NP_440174.1_2 Reverse -166 -185 13.8641 0.244
NP_440703.1_9 Forward -337 -324 7.2952 0.264
NP_441725.1_5 Reverse -188 -198 9.91146 0.0441
NP_441725.1_5 Forward -195 -185 8.92815 0.0553
NP_439966.1_7 Reverse -185 -195 13.8442 0.0234
NP_439966.1_7 Forward -198 -188 12.2709 0.0464
NP_439966.1_9 Forward -52 -43 3.83464 0.253
NP_439966.1_9 Reverse -185 -194 0.983037 0.253
NP_442941.1_3 Forward -195 -185 10.9931 0.0116
NP_442941.1_3 Reverse -188 -198 10.5014 0.0148
NP_440289.1_2 Forward -199 -186 -2.43899 0.255
NP_441076.1_1 Forward -255 -236 12.9031 0.208
NP_441514.1_6 Forward -333 -326 12.7238 0.29
NP_442281.1_1 Forward -201 -187 8.84875 0.075
NP_441334.1_7 Forward -198 -179 -11.7019 0.124
NP_442575.1_8 Forward -82 -63 6.98095 0.125
NP_442575.1_8 Forward -350 -331 -6.39206 0.281
NP_001035871.2_7 Forward -265 -255 11.6814 0.287
NP_440437.1_1 Forward -202 -183 1.37609 0.151
NP_441457.1_7 Reverse -185 -204 7.86593 0.165
NP_440498.1_1 Forward -205 -187 -0.865831 0.22
NP_441644.1_6 Reverse -187 -197 16.5975 0.00319
NP_441644.1_6 Forward -196 -186 9.71433 0.0705
NP_442215.1_2 Reverse -340 -356 5.56507 0.0785
NP_442215.1_2 Forward -99 -83 1.33684 0.136
NP_442215.1_2 Forward -346 -330 -5.448 0.25
NP_442215.1_2 Reverse -320 -336 -5.93965 0.262
NP_442215.1_2 Forward -243 -227 -6.82463 0.28
NP_442029.1_6 Reverse -177 -196 5.211 0.255
NP_440929.1_8 Forward -196 -187 17.4043 0.00289
NP_440929.1_8 Reverse -187 -196 17.4043 0.00289
NP_442933.1_10 Reverse -187 -196 9.04618 0.063
NP_442933.1_10 Forward -196 -187 8.94785 0.0643
NP_440382.1_2 Forward -31 -12 5.50519 0.264
NP_441751.2_8 Forward -195 -181 6.48943 0.0354
NP_441751.2_8 Reverse -188 -202 -3.147 0.134
NP_442554.1_8 Forward -195 -185 19.1546 0.00369
NP_442554.1_8 Reverse -188 -198 13.648 0.0164
NP_442863.1_10 Forward -70 -51 13.7658 0.233
NP_442075.1_10 Reverse -187 -206 12.1925 0.282
NP_441762.1_7 Forward -197 -185 -4.77924 0.182
NP_442142.1_4 Forward -199 -186 7.19687 0.144
NP_442292.1_1 Forward -195 -186 17.5026 0.00435
NP_442292.1_1 Reverse -188 -197 16.9127 0.00594
NP_442292.1_5 Reverse -183 -202 -1.86883 0.272
NP_442476.1_6 Forward -195 -181 11.7993 0.0543
NP_441523.1_6 Forward -266 -247 13.5691 0.161
NP_443009.1_5 Reverse -186 -197 14.7094 0.02
NP_443009.1_5 Forward -197 -186 6.05637 0.177
NP_443009.1_5 Reverse -40 -51 5.56471 0.197
NP_440947.1_9 Reverse -190 -209 8.75091 0.285
NP_441715.1_4 Forward -195 -185 7.25653 0.108
NP_441715.1_4 Reverse -188 -198 5.09324 0.233
NP_440620.1_4 Reverse -143 -157 13.5715 0.281
NP_441198.1_8 Reverse -185 -195 15.4199 0.0427
NP_441198.1_8 Forward -198 -188 11.8064 0.183
NP_440379.1_6 Reverse -187 -206 6.19431 0.266
NP_441468.1_1 Forward -195 -188 15.8704 0.0124
NP_441468.1_1 Reverse -188 -195 15.8704 0.0124
NP_441673.1_1 Reverse -187 -196 11.1111 0.0121
NP_441673.1_1 Forward -196 -187 11.0128 0.018
NP_441673.1_1 Forward -351 -342 -8.06341 0.254
NP_441826.1_2 Reverse -181 -195 0.88457 0.17
NP_441826.1_2 Forward -202 -188 -2.45868 0.271
NP_441826.1_2 Reverse -329 -343 -4.81863 0.3
NP_442868.1_6 Reverse -185 -195 8.63316 0.0555
NP_442719.1_2 Reverse -232 -250 2.57501 0.162
NP_442427.1_3 Reverse -182 -200 4.6407 0.171
NP_442542.1_2 Forward -360 -347 9.16406 0.139
NP_442542.1_9 Forward -203 -189 4.62054 0.292
NP_442113.1_3 Forward -343 -324 6.09597 0.254
NP_442113.1_10 Forward -200 -181 -8.35868 0.282
NP_442050.1_1 Forward -344 -325 8.65258 0.25
NP_442050.1_5 Forward -198 -188 17.4824 0.00791
NP_442050.1_5 Reverse -185 -195 17.1874 0.00812
NP_442792.1_6 Reverse -182 -201 3.14605 0.282
NP_441878.1_6 Reverse -186 -196 0.766681 0.134
NP_441878.1_6 Forward -197 -187 0.668351 0.139
NP_441878.1_6 Forward -352 -342 -7.49312 0.231
NP_441036.1_8 Forward -197 -187 14.7297 0.0187
NP_441036.1_8 Reverse -186 -196 6.07655 0.242
NP_441557.1_4 Forward -255 -241 10.7177 0.291
NP_441557.1_5 Forward -196 -187 17.4043 0.0023
NP_441557.1_5 Reverse -187 -196 10.8161 0.00464
NP_441445.1_1 Forward -106 -87 3.53937 0.212
NP_442066.2_4 Reverse -187 -206 -7.76869 0.286
NP_441308.1_8 Reverse -185 -195 12.4681 0.218
NP_441308.1_8 Forward -198 -188 11.8781 0.22
NP_441458.1_10 Forward -244 -225 5.40766 0.216
NP_442469.1_2 Forward -345 -327 13.2938 0.298
NP_442183.1_1 Reverse -187 -201 9.83269 0.0926
NP_441407.1_5 Forward -206 -187 10.7175 0.147
NP_441116.1_9 Forward -163 -149 18.5841 0.111
NP_442135.1_8 Forward -207 -189 11.0322 0.207
NP_442170.1_5 Reverse -187 -206 25.2705 0.00134
NP_442347.1_2 Forward -195 -186 3.34298 0.284
NP_441037.1_4 Reverse -185 -195 16.5761 0.0168
NP_441037.1_4 Forward -198 -188 6.24566 0.274
NP_441037.1_4 Forward -72 -62 5.95329 0.289
NP_440151.1_5 Forward -268 -249 16.4207 0.0742
NP_441633.1_3 Forward -198 -185 -1.75067 0.163
NP_441633.1_3 Reverse -86 -99 -6.76555 0.271
NP_440136.1_2 Forward -195 -188 15.9687 0.0123
NP_440136.1_2 Reverse -188 -195 15.9687 0.0123
NP_442998.1_5 Forward -252 -242 13.7464 0.157
NP_442998.1_5 Forward -332 -322 9.12481 0.252
NP_442998.1_5 Reverse -264 -274 7.55152 0.289
NP_442998.1_10 Forward -194 -187 15.5754 0.0102
NP_442998.1_10 Forward -304 -297 10.4622 0.0819
NP_442998.1_10 Reverse -189 -196 5.84064 0.235
NP_441799.1_1 Reverse -183 -197 15.4369 0.0182
NP_441799.1_1 Reverse -51 -65 4.03056 0.269
NP_441007.1_10 Reverse -182 -195 10.934 0.0646
NP_441007.1_10 Forward -201 -188 1.88757 0.203
NP_440256.1_1 Forward -199 -180 1.96607 0.0697
NP_442283.1_10 Forward -255 -238 18.9184 0.267
NP_440915.1_5 Forward -92 -73 15.2983 0.28
NP_440915.1_6 Reverse -183 -197 2.5562 0.115
NP_441296.1_5 Reverse -327 -346 15.2408 0.244
NP_442866.1_1 Reverse -182 -201 -3.54046 0.221
NP_440748.1_5 Forward -68 -49 -0.688862 0.26
NP_441464.1_8 Reverse -297 -311 8.55439 0.194
NP_440695.1_6 Forward -277 -263 10.8961 0.265
NP_441199.1_7 Forward -23 -4 5.30933 0.231
NP_442993.1_1 Reverse -187 -203 1.82849 0.0502
NP_442386.1_9 Reverse -186 -195 6.39082 0.219
NP_442386.1_9 Forward -197 -188 5.11253 0.266
NP_441340.1_5 Forward -195 -188 15.6737 0.0124
NP_441340.1_5 Reverse -188 -195 15.6737 0.0124
NP_441676.1_4 Reverse -258 -276 3.65739 0.292
NP_440586.1_8 Forward -195 -188 13.2151 0.026
NP_440586.1_8 Reverse -188 -195 13.2151 0.026
NP_442251.1_6 Forward -195 -188 15.2804 0.0124
NP_442251.1_6 Reverse -188 -195 15.2804 0.0124
NP_442959.1_4 Reverse -243 -262 6.88262 0.224
NP_441262.1_3 Forward -196 -189 14.8871 0.0223
NP_441262.1_3 Reverse -187 -194 14.7888 0.0223
NP_443051.1_1 Reverse -186 -195 19.5676 0.00335
NP_443051.1_1 Forward -197 -188 17.5026 0.0066
NP_441232.1_2 Forward -73 -54 8.55425 0.243
NP_439937.1_9 Forward -197 -180 -4.78005 0.157
NP_439937.1_9 Reverse -60 -77 -11.2699 0.248
NP_442294.1_3 Reverse -272 -286 13.372 0.269
NP_440439.1_1 Reverse -184 -197 11.3273 0.0339
NP_440439.1_1 Forward -199 -186 -1.06236 0.249
NP_440372.1_2 Forward -195 -188 16.3621 0.0124
NP_440372.1_2 Reverse -188 -195 16.3621 0.0124
NP_440372.1_3 Reverse -235 -249 16.1498 0.165
NP_442783.1_8 Reverse -66 -85 16.1249 0.216
NP_441572.1_1 Forward -73 -54 -2.75381 0.212
NP_441572.1_7 Forward -202 -183 -3.04881 0.206
NP_440267.1_2 Forward -201 -187 17.5018 0.0405
NP_442384.1_10 Forward -196 -183 1.00259 0.271
NP_442114.1_4 Forward -196 -185 8.61347 0.197
NP_441877.1_5 Reverse -239 -258 -2.16383 0.296
NP_442790.1_4 Reverse -178 -197 -15.7335 0.297
NP_442262.1_10 Forward -195 -188 14.1988 0.0123
NP_442262.1_10 Reverse -188 -195 14.1988 0.0123
NP_442262.1_10 Forward -234 -227 8.59391 0.22
NP_441689.1_5 Forward -198 -188 10.796 0.132
NP_441689.1_5 Reverse -185 -195 8.43603 0.132
NP_440344.1_10 Reverse -147 -164 -13.3342 0.282
NP_441640.1_8 Forward -350 -331 -5.01543 0.27
NP_440297.1_9 Reverse -188 -198 9.51814 0.0917
NP_440297.1_9 Forward -195 -185 -0.314959 0.282
NP_440700.1_8 Reverse -264 -278 10.226 0.292
NP_440999.1_9 Reverse -87 -101 1.76955 0.158
NP_440888.1_2 Forward -196 -182 7.07881 0.208
NP_440888.1_2 Reverse -187 -201 6.58715 0.228
NP_442454.1_2 Forward -31 -12 7.87766 0.291
NP_442871.1_4 Forward -194 -175 -0.492971 0.18
NP_441543.1_2 Forward -195 -186 15.9293 0.00518
NP_441543.1_2 Reverse -188 -197 6.39124 0.153
NP_441543.1_3 Reverse -70 -84 9.83206 0.226
NP_442845.1_2 Reverse -181 -195 11.701 0.124
NP_442845.1_2 Forward -202 -188 5.1128 0.243
NP_441469.1_4 Forward -347 -328 6.98095 0.282
NP_441469.1_8 Forward -197 -188 6.98123 0.227
NP_441469.1_8 Reverse -186 -195 6.5879 0.227
NP_442315.1_1 Forward -111 -93 4.9357 0.256
NP_442578.1_7 Forward -195 -188 14.5921 0.026
NP_442578.1_7 Reverse -188 -195 14.5921 0.026
NP_440071.1_5 Reverse -249 -268 8.35759 0.276
NP_441462.1_2 Reverse -187 -197 11.3864 0.00425
NP_441462.1_2 Forward -196 -186 10.4031 0.011
NP_441462.1_2 Reverse -342 -352 -1.00328 0.274
NP_441621.1_7 Forward -198 -184 -4.4253 0.223
NP_441929.1_3 Reverse -53 -72 2.94938 0.266
NP_443062.1_1 Reverse -187 -205 9.13097 0.14
NP_443062.1_1 Forward -196 -178 8.83844 0.145
NP_442204.1_1 Reverse -183 -194 0.451995 0.281
NP_442780.1_1 Reverse -119 -138 8.94757 0.241
NP_440516.1_8 Reverse -187 -196 9.53783 0.0136
NP_440516.1_8 Forward -196 -187 7.07956 0.0867
NP_442080.1_7 Reverse -330 -349 -2.45882 0.287
NP_442428.1_5 Forward -195 -188 15.8704 0.0124
NP_442428.1_5 Reverse -188 -195 15.8704 0.0124
NP_442120.1_10 Reverse -187 -206 -9.63698 0.244
NP_442120.1_10 Forward -70 -51 -13.2752 0.282
NP_440673.1_3 Forward -194 -187 12.4288 0.0426
NP_440673.1_3 Reverse -189 -196 5.34899 0.298
NP_441052.1_2 Forward -196 -186 1.84832 0.225
NP_441052.1_2 Reverse -187 -197 0.668351 0.256
NP_442219.1_9 Forward -195 -186 8.25953 0.0681
NP_440436.1_4 Forward -195 -186 9.24241 0.0871
NP_440436.1_4 Reverse -329 -338 5.80084 0.182
NP_440314.1_9 Forward -195 -176 -7.27704 0.238
NP_441719.1_4 Forward -195 -188 16.3621 0.0124
NP_441719.1_4 Reverse -188 -195 16.3621 0.0124
NP_441004.1_4 Forward -361 -351 9.22315 0.259
NP_442366.1_3 Forward -352 -334 2.18243 0.134
NP_442366.1_3 Forward -345 -327 -4.30741 0.268
NP_439949.1_10 Reverse -227 -246 18.99 0.106
NP_442873.1_9 Reverse -381 -400 4.81688 0.284
NP_441115.1_4 Reverse -186 -204 8.57317 0.244
NP_441115.1_4 Forward -197 -179 7.68819 0.278
NP_441228.1_7 Reverse -328 -346 15.8198 0.296
NP_442430.1_10 Forward -206 -187 9.63507 0.287
NP_441851.1_10 Reverse -186 -196 8.33817 0.118
NP_441851.1_10 Forward -197 -187 6.96153 0.151
NP_441396.1_5 Forward -78 -69 7.37455 0.279
NP_441683.1_7 Forward -298 -279 -4.81876 0.244
NP_441349.1_10 Reverse -177 -196 10.5209 0.0232
NP_441409.1_6 Reverse -181 -200 -0.197208 0.0678
NP_440432.1_9 Forward -195 -180 -2.47838 0.172
NP_440432.1_9 Reverse -188 -203 -3.16669 0.179
NP_439960.1_10 Reverse -348 -366 -2.73412 0.258
NP_440474.1_8 Reverse -188 -202 18.4851 0.0423
NP_440474.1_8 Forward -195 -181 12.2903 0.0894
NP_441477.1_10 Forward -268 -250 -1.06249 0.299
NP_441124.1_5 Forward -252 -242 16.1594 0.188
NP_441124.1_5 Reverse -237 -247 13.2946 0.215
NP_440588.1_2 Reverse -326 -345 8.16093 0.0467
NP_442006.1_2 Forward -360 -343 -16.6774 0.261
NP_441570.1_1 Reverse -187 -205 -9.81395 0.15
NP_441570.1_1 Forward -196 -178 -17.5821 0.283
NP_441078.1_4 Reverse -187 -196 9.93116 0.0203
NP_441078.1_4 Forward -196 -187 9.83282 0.0226
NP_442729.1_5 Forward -71 -61 9.32148 0.235
NP_440707.1_9 Forward -89 -70 0.982764 0.292
NP_440526.1_3 Forward -195 -184 2.31981 0.267
NP_440526.1_3 Reverse -188 -199 0.254868 0.292
NP_441432.1_8 Reverse -186 -195 16.8143 0.00595
NP_441432.1_8 Reverse -231 -240 6.98123 0.112
NP_441432.1_8 Forward -197 -188 6.98123 0.112
NP_441432.1_8 Reverse -296 -305 5.50626 0.151
NP_441432.1_9 Reverse -124 -137 8.59837 0.287
NP_442320.1_8 Reverse -181 -195 -2.36035 0.0871
NP_442320.1_8 Forward -202 -188 -4.7203 0.185
NP_442344.1_7 Reverse -188 -207 -6.78538 0.172
NP_442344.1_7 Reverse -343 -362 -9.63698 0.262
NP_441732.1_2 Forward -200 -184 -6.82463 0.0533
NP_440313.1_6 Forward -70 -51 20.354 0.0809
NP_442003.1_9 Forward -49 -30 4.916 0.243
NP_440461.1_3 Forward -352 -333 15.4374 0.213
NP_442298.1_10 Forward -195 -176 13.5691 0.219
NP_442353.1_4 Reverse -82 -101 3.34192 0.219
NP_442489.1_7 Reverse -187 -196 10.4228 0.0151
NP_442489.1_7 Forward -196 -187 10.3245 0.0193
NP_442489.1_7 Reverse -342 -351 -1.57357 0.213
NP_440559.1_1 Forward -195 -186 8.65285 0.0586
NP_440559.1_1 Reverse -188 -197 7.76787 0.0918
NP_441659.2_8 Reverse -187 -197 17.5813 0.0024
NP_441659.2_8 Forward -196 -186 11.3864 0.0184
NP_441659.2_8 Reverse -342 -352 3.42162 0.161
NP_441040.1_2 Reverse -333 -352 -11.8003 0.255
NP_442346.1_5 Reverse -186 -196 15.0247 0.00889
NP_442346.1_5 Forward -197 -187 6.8632 0.188
NP_440352.1_5 Forward -95 -76 13.4344 0.189
NP_440545.1_3 Reverse -183 -200 8.00365 0.0471
NP_440545.1_3 Forward -200 -183 3.77542 0.079
NP_440486.1_6 Forward -345 -326 8.84924 0.235
NP_441126.1_6 Forward -15 -1 14.4207 0.267
NP_442934.1_1 Reverse -135 -154 14.6508 0.229
NP_441047.1_2 Forward -266 -247 -3.44213 0.297
NP_441833.1_4 Forward -195 -188 15.9687 0.0124
NP_441833.1_4 Reverse -188 -195 15.9687 0.0124
NP_441329.1_6 Forward -153 -134 -3.29489 0.3
NP_441112.1_6 Forward -206 -187 -1.96717 0.296
NP_442699.1_8 Reverse -230 -249 -12.7836 0.257
NP_442162.1_9 Forward -195 -188 16.2637 0.0124
NP_442162.1_9 Reverse -188 -195 16.2637 0.0124
NP_440671.1_4 Forward -202 -188 12.3893 0.11
NP_440671.1_4 Forward -70 -56 5.1128 0.292
NP_442199.1_5 Forward -204 -185 -5.70374 0.253
NP_442140.1_3 Forward -195 -185 7.94484 0.124
NP_442021.1_6 Forward -89 -70 5.11266 0.268
NP_440875.1_9 Forward -194 -184 14.5042 0.0411
NP_442547.1_5 Forward -367 -348 17.4546 0.243
NP_441813.1_5 Forward -198 -188 15.123 0.0136
NP_441813.1_5 Reverse -185 -195 8.73149 0.0367
NP_440594.1_8 Forward -195 -182 9.36014 0.186
NP_440590.1_4 Forward -195 -182 -3.91395 0.256
NP_440590.1_4 Forward -350 -337 -5.97891 0.296
NP_440567.1_1 Forward -195 -181 20.4524 0.012
NP_442497.1_10 Forward -195 -186 17.601 0.00813
NP_442497.1_10 Reverse -188 -197 15.7327 0.0087
NP_440821.1_4 Reverse -185 -195 10.7964 0.0146
NP_440821.1_4 Forward -198 -188 10.5014 0.015
NP_441239.1_9 Forward -198 -186 12.1337 0.0494
NP_441239.1_9 Reverse -185 -197 10.7571 0.0723
NP_442044.1_9 Reverse -187 -206 6.58763 0.2
NP_441617.1_3 Forward -141 -122 17.6007 0.0493
NP_442052.1_8 Forward -339 -329 12.1731 0.285
NP_440546.1_4 Reverse -187 -197 6.65249 0.288
NP_440546.1_6 Forward -77 -58 6.68596 0.296
NP_440462.1_6 Reverse -185 -195 19.4496 0.00371
NP_440462.1_6 Forward -198 -188 8.23984 0.0687
NP_440868.1_4 Reverse -183 -195 17.0502 0.0124
NP_441249.1_8 Forward -262 -243 4.81767 0.253
NP_441672.1_6 Reverse -327 -346 12.585 0.198
NP_442402.1_10 Reverse -243 -253 10.501 0.288
NP_441848.1_4 Forward -17 -1 10.8929 0.239
NP_440696.1_6 Forward -102 -83 3.53937 0.288
NP_442039.1_4 Forward -195 -188 15.1821 0.0124
NP_442039.1_4 Reverse -188 -195 15.1821 0.0124
NP_441180.1_2 Forward -86 -67 12.1291 0.287
NP_441926.1_3 Reverse -187 -203 15.5948 0.0428
NP_442837.1_3 Forward -195 -188 15.7721 0.0124
NP_442837.1_3 Reverse -188 -195 15.7721 0.0124
NP_442837.1_3 Forward -58 -51 6.82395 0.184
NP_442053.1_1 Reverse -187 -196 9.34117 0.0666
NP_442053.1_1 Forward -196 -187 8.84951 0.072
NP_440505.1_3 Reverse -185 -195 15.418 0.0114
NP_440505.1_3 Reverse -295 -305 13.648 0.028
NP_440505.1_3 Reverse -205 -215 11.5831 0.0735
NP_440505.1_3 Forward -198 -188 5.28991 0.236
NP_442532.1_7 Forward -196 -182 2.06454 0.254
NP_440914.1_1 Reverse -187 -197 14.0802 0.0188
NP_440914.1_1 Forward -196 -186 7.24882 0.242
NP_440914.1_1 Forward -358 -348 6.17532 0.293
NP_441011.1_8 Forward -195 -186 16.6177 0.00602
NP_441011.1_8 Reverse -188 -197 8.94785 0.141
NP_442533.1_6 Reverse -187 -196 7.86621 0.0862
NP_442533.1_6 Forward -196 -187 7.37455 0.0898
NP_440263.1_5 Reverse -133 -147 9.2427 0.294
NP_442232.1_3 Reverse -179 -198 -14.8485 0.288
NP_442322.1_4 Reverse -69 -86 -9.89323 0.297
NP_441482.1_7 Reverse -181 -195 -12.3901 0.295
NP_441482.1_9 Forward -276 -263 15.9483 0.278
NP_439944.1_9 Forward -195 -185 17.7779 0.00341
NP_439944.1_9 Reverse -188 -198 15.418 0.0198
NP_441028.1_6 Reverse -5 -15 5.19112 0.265
NP_441028.1_6 Reverse -4 -14 4.7978 0.277
NP_440116.1_8 Forward -195 -176 -4.22878 0.164
NP_440115.1_6 Reverse -184 -194 16.008 0.0325
NP_440007.1_9 Forward -94 -80 1.96621 0.281
NP_440007.1_9 Reverse -183 -197 1.17956 0.29
NP_441680.1_4 Forward -266 -247 5.211 0.192
NP_441602.1_3 Reverse -323 -342 -1.47551 0.227
NP_441106.1_1 Reverse -186 -195 18.486 0.0028
NP_441106.1_1 Forward -197 -188 9.34117 0.0333
NP_442704.1_7 Forward -386 -367 13.6675 0.181
NP_441286.1_1 Forward -197 -185 3.97222 0.0397
NP_441286.1_1 Reverse -186 -198 -4.18925 0.152
NP_442674.1_2 Reverse -236 -255 9.83255 0.213
NP_440670.1_8 Reverse -187 -196 16.3227 0.00291
NP_440670.1_8 Forward -196 -187 15.1427 0.00768
NP_440886.1_7 Reverse -341 -351 5.68278 0.168
NP_442072.1_9 Reverse -186 -204 -2.53746 0.0317
NP_442800.1_7 Reverse -286 -305 5.50599 0.252
NP_440028.1_6 Forward -81 -63 14.6705 0.218
NP_440907.2_8 Forward -195 -185 19.1541 0.00362
NP_440907.2_8 Reverse -188 -198 7.64939 0.117
NP_441463.1_3 Reverse -177 -196 -3.73712 0.184
NP_441463.1_3 Forward -206 -187 -8.65367 0.272
NP_441626.1_2 Forward -195 -188 15.7721 0.0124
NP_441626.1_2 Reverse -188 -195 15.7721 0.0124
NP_442365.1_5 Forward -195 -176 9.24257 0.207
NP_442615.1_1 Reverse -178 -196 0.904127 0.0943
NP_442615.1_1 Forward -205 -187 -6.27403 0.241
NP_440387.1_1 Forward -196 -180 -0.629782 0.14
NP_440387.1_1 Forward -351 -335 -6.62797 0.298
NP_441431.1_2 Reverse -339 -353 11.9953 0.128
NP_442020.1_1 Reverse -144 -163 -0.39464 0.274
NP_441993.1_1 Forward -70 -51 6.62464 0.178
NP_440114.1_10 Reverse -187 -201 17.7975 0.00892
NP_440114.1_10 Forward -196 -182 6.78443 0.258
NP_441817.1_3 Reverse -176 -195 17.994 0.0425
NP_441510.2_2 Forward -200 -181 1.86696 0.29
NP_441552.1_3 Reverse -180 -199 11.995 0.292
NP_441720.1_2 Forward -200 -181 4.22689 0.236
NP_441979.1_2 Forward -367 -348 20.2401 0.0902
NP_442930.1_1 Reverse -241 -251 12.3692 0.239
NP_439910.1_2 Forward -204 -187 -2.61609 0.0305
NP_440457.1_1 Reverse -183 -195 9.87208 0.092
NP_440798.1_6 Forward -195 -182 10.4424 0.0754
NP_440798.1_6 Reverse -188 -201 2.87088 0.159
NP_440054.1_4 Forward -171 -152 14.4541 0.135
NP_440473.1_1 Reverse -332 -351 12.7999 0.213
NP_440473.1_9 Reverse -176 -195 -11.8986 0.295
NP_442514.1_5 Reverse -59 -78 -7.86776 0.28
NP_440734.1_9 Forward -361 -342 12.2908 0.24
NP_440554.1_4 Reverse -188 -198 17.3846 0.0189
NP_440554.1_4 Forward -195 -185 15.418 0.0199
NP_441885.1_5 Reverse -187 -197 2.24165 0.0822
NP_441885.1_5 Forward -196 -186 1.55333 0.109
NP_442341.1_7 Forward -352 -338 1.08123 0.299
NP_441173.1_9 Forward -271 -263 10.9338 0.242
NP_441173.1_9 Reverse -245 -253 10.9338 0.242
NP_442534.1_7 Forward -345 -326 6.78429 0.272
NP_440423.1_6 Forward -359 -340 -20.65 0.263
NP_443000.1_7 Reverse -185 -195 10.7964 0.0345
NP_443000.1_7 Forward -198 -188 8.4365 0.0459
NP_441842.1_1 Forward -194 -181 11.6217 0.248
NP_441842.1_10 Reverse -180 -194 17.3058 0.0246
NP_440275.1_3 Reverse -185 -195 18.6629 0.0082
NP_440275.1_3 Forward -198 -188 9.22315 0.055
NP_440091.1_1 Reverse -183 -195 10.2654 0.0498
NP_440091.1_1 Forward -200 -188 8.6921 0.0602
NP_443010.1_10 Forward -199 -182 2.48089 0.275
NP_441105.1_3 Reverse -176 -195 2.45773 0.103
NP_441105.1_3 Forward -207 -188 -9.93197 0.298
NP_440216.1_1 Reverse -187 -201 6.09611 0.0162
NP_440216.1_1 Forward -196 -182 -2.26202 0.0484
NP_440216.1_1 Reverse -342 -356 -5.40861 0.129
NP_440172.1_1 Reverse -187 -197 10.9931 0.0445
NP_440172.1_1 Forward -196 -186 7.74818 0.0738
NP_442371.1_1 Forward -253 -243 14.0409 0.191
NP_440167.1_3 Forward -347 -328 8.25926 0.281
NP_441226.1_7 Forward -195 -188 14.4934 0.0123
NP_441226.1_7 Reverse -188 -195 14.4934 0.0123
NP_441111.1_7 Forward -195 -187 18.7023 0.00294
NP_441111.1_7 Reverse -188 -196 8.96754 0.0463
NP_442379.1_10 Forward -203 -186 6.03703 0.12
NP_442379.1_10 Reverse -180 -197 -3.5994 0.264
NP_441766.1_2 Forward -196 -187 16.2243 0.0047
NP_441766.1_2 Reverse -187 -196 9.14451 0.0337
NP_441766.1_9 Reverse -250 -269 -3.24547 0.298
NP_440416.1_9 Reverse -328 -347 -21.0434 0.29
NP_443052.1_8 Forward -206 -187 1.96607 0.0587
NP_443052.1_8 Forward -331 -312 -9.93197 0.198
NP_443052.1_8 Reverse -177 -196 -12.1936 0.249
NP_443052.1_9 Reverse -347 -366 -1.57384 0.23
NP_442403.1_8 Forward -88 -69 6.4893 0.187
NP_442154.1_1 Forward -108 -90 -15.9105 0.228
NP_442154.1_1 Forward -111 -93 -19.3521 0.298
NP_442564.1_10 Reverse -257 -271 8.06273 0.296
NP_440261.1_5 Forward -195 -182 -2.83231 0.0932
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGCGGCTCAGATTGTGACTGATCAGACGAAAAAAGTTGCTGGCACAATGGGCAGTCGGCGAGGAGCAAGGGCAAGAACCTACGATCATCTTATGTCCTATTGCCAGTATGTGCAGGAAAAGACACCAATTTTAGCCCAGGGTCAGGACTGGGAAAATTTAGTCAAAGCCATTGAAATGATACATAACTATCCCCTTAAGCAAAATGCGATCGCCTCCCTAAACCGTGAACTAAAGGCGGGTATTTCTGATGAAGATTTAGCGCAAAAAGTAACTTATCTTATGGAGCATGATGCGTTGTGTGTGGTGACTGCTGATGGAGAATTTGAGGGGGCAAAGGTGATTTGCTCGCTGGGATTATTTCAACGTTAAGATCAAACTATATTAACTGAGGAAAAATCA

CDS

ATGACAATAACAACACAAGCTCAAATTGTTGAAATGCTGGAACAGTTACCAGATGGTGCTTTAGATGAAGTGAAATCATTTTTAGCAGCATTACAAAATCGTTATCCTGCAAAACATGCCCCAAAGTTGAGTGAGGGCATGGCTTATATTGAGCAAGTTCGGGGAAAAATGCAGTGTGATATGACCACCGATGAAATTATGGCGCTGACAAGGGGTGAGGATGATTAA

Protein

No sequence available