Your browser is old and dusty. Try Google Chrome!

Details for ssr6026

ORF ssr6026
Accession NP_942469.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -298 -291 8.39725 0.213
NP_441453.1_4 Forward -363 -355 4.34598 0.257
NP_442838.1_7 Reverse -44 -63 -11.1119 0.263
NP_440226.1_1 Reverse -354 -373 5.211 0.163
NP_440996.1_2 Forward -156 -147 13.9627 0.293
NP_442173.1_1 Reverse -50 -58 7.29591 0.176
NP_442173.1_1 Reverse -313 -321 4.93597 0.241
NP_443027.1_4 Forward -60 -50 7.64985 0.238
NP_442074.1_3 Forward -188 -175 16.7349 0.285
NP_440761.1_4 Forward -203 -184 -20.4534 0.287
NP_441802.1_1 Forward -328 -309 4.22769 0.296
NP_440304.1_4 Forward -323 -313 5.28991 0.218
NP_440304.1_4 Forward -60 -50 4.89658 0.244
NP_440044.1_8 Reverse -291 -310 -2.95047 0.274
NP_441365.1_5 Forward -380 -361 -6.88371 0.262
NP_440769.1_8 Forward -164 -145 6.88262 0.286
NP_441434.1_8 Reverse -335 -354 10.2463 0.248
NP_440109.1_5 Reverse -184 -203 17.2065 0.133
NP_442889.1_8 Reverse -108 -122 2.8506 0.299
NP_442920.1_3 Forward -253 -234 20.3871 0.104
NP_443018.1_3 Reverse -313 -320 10.7572 0.0907
NP_443018.1_3 Forward -320 -313 4.56234 0.241
NP_443018.1_3 Reverse -355 -362 4.26735 0.267
NP_443018.1_3 Forward -362 -355 4.07068 0.299
NP_440376.1_1 Reverse -25 -34 1.08137 0.258
NP_441002.1_4 Forward -324 -305 13.6675 0.291
NP_442687.1_1 Reverse -5 -18 10.7368 0.291
NP_442687.1_5 Reverse -276 -290 17.3132 0.277
NP_441077.1_2 Forward -205 -186 4.24897 0.228
NP_440571.1_5 Forward -283 -264 14.5524 0.221
NP_442296.1_5 Forward -361 -342 5.11266 0.251
NP_442658.1_1 Forward -323 -313 12.5659 0.0526
NP_442364.1_7 Reverse -376 -390 19.9601 0.222
NP_442690.1_1 Forward -176 -157 -15.4385 0.28
NP_441591.1_10 Forward -344 -325 5.211 0.297
NP_442002.1_9 Forward -218 -211 9.77388 0.258
NP_442438.1_10 Reverse -44 -58 1.47456 0.194
NP_442431.1_7 Reverse -135 -154 10.5209 0.199
NP_440377.1_1 Reverse -5 -22 15.7188 0.181
NP_440484.1_3 Forward -344 -330 9.14437 0.27
NP_440484.1_3 Forward -365 -351 8.35772 0.3
NP_439966.1_9 Reverse -310 -319 6.29291 0.253
NP_441514.1_6 Forward -348 -341 12.7238 0.29
NP_441079.1_7 Forward -23 -4 -4.52452 0.25
NP_440652.1_1 Reverse -68 -87 2.3594 0.298
NP_442933.1_1 Reverse -186 -205 9.69201 0.253
NP_442554.1_4 Forward -355 -336 6.4893 0.291
NP_442554.1_8 Forward -320 -310 2.43831 0.272
NP_442142.1_4 Reverse -309 -322 2.18201 0.299
NP_442292.1_1 Reverse -50 -59 5.40793 0.146
NP_442292.1_1 Forward -362 -353 5.21127 0.152
NP_440919.1_7 Forward -353 -335 13.1635 0.147
NP_443009.1_5 Forward -322 -311 3.8931 0.274
NP_442076.1_8 Forward -374 -355 11.7992 0.203
NP_441198.1_8 Forward -323 -313 12.9783 0.116
NP_441468.1_1 Forward -320 -313 4.07068 0.263
NP_441468.1_1 Reverse -355 -362 3.97235 0.277
NP_441468.1_1 Reverse -50 -57 3.67736 0.282
NP_441876.1_9 Forward -72 -62 12.4676 0.267
NP_442719.1_2 Reverse -338 -356 -8.33968 0.247
NP_441612.1_2 Reverse -77 -87 6.70984 0.277
NP_440145.1_3 Forward -331 -312 8.75091 0.0446
NP_442718.1_2 Forward -321 -302 -5.70374 0.295
NP_440558.1_2 Reverse -309 -328 -5.11376 0.253
NP_441433.1_8 Forward -271 -252 4.81767 0.178
NP_441458.1_8 Forward -137 -118 2.38824 0.295
NP_442192.1_8 Reverse -323 -342 11.1109 0.259
NP_442397.1_1 Reverse -250 -264 15.2698 0.257
NP_441037.1_4 Reverse -331 -341 7.12278 0.237
NP_441799.1_1 Forward -346 -332 3.73557 0.284
NP_441743.1_8 Reverse -13 -32 14.0608 0.185
NP_441957.1_10 Forward -55 -36 12.7825 0.263
NP_442158.1_4 Forward -269 -259 10.5998 0.285
NP_441704.1_8 Reverse -178 -197 9.7334 0.173
NP_440748.1_5 Reverse -98 -117 -2.95047 0.286
NP_440787.1_5 Forward -154 -140 10.816 0.256
NP_441750.1_1 Forward -330 -311 -9.73531 0.3
NP_441340.1_5 Reverse -313 -320 3.97235 0.274
NP_442714.1_5 Forward -380 -361 5.30933 0.238
NP_441027.1_1 Reverse -143 -157 14.3553 0.256
NP_440586.1_8 Reverse -355 -362 7.70858 0.227
NP_442959.1_5 Reverse -3 -22 5.99764 0.262
NP_441262.1_3 Reverse -354 -361 5.34899 0.181
NP_443038.1_1 Reverse -339 -358 3.73603 0.22
NP_440408.1_10 Forward -327 -308 14.5524 0.139
NP_441138.1_5 Forward -236 -223 8.65605 0.238
NP_441138.1_5 Forward -170 -157 5.31383 0.272
NP_442488.1_7 Forward -200 -181 10.7175 0.239
NP_442262.1_10 Reverse -313 -320 9.87221 0.164
NP_440350.1_5 Reverse -194 -213 -3.3438 0.26
NP_440350.1_5 Reverse -176 -195 -5.80207 0.292
NP_441896.1_3 Reverse -40 -59 -2.26216 0.28
NP_440600.1_4 Reverse -346 -364 -0.669169 0.155
NP_442147.1_8 Forward -341 -324 22.065 0.02
NP_442277.1_7 Reverse -155 -171 -1.71205 0.284
NP_442818.1_3 Forward -160 -143 0.727158 0.234
NP_442845.1_1 Reverse -329 -348 17.5024 0.155
NP_442845.1_2 Forward -327 -313 5.30946 0.237
NP_440380.1_5 Forward -326 -307 1.76941 0.299
NP_442966.1_8 Reverse -188 -206 22.5369 0.0332
NP_442710.1_7 Reverse -4 -23 3.34933 0.147
NP_442710.1_7 Reverse -266 -285 -6.26165 0.294
NP_442710.1_7 Forward -384 -365 -7.03052 0.294
NP_441469.1_8 Reverse -48 -57 12.8811 0.0929
NP_441469.1_8 Reverse -311 -320 5.89959 0.246
NP_440710.1_5 Forward -393 -374 17.8957 0.0788
NP_440148.1_1 Forward -283 -264 -4.52377 0.219
NP_441621.1_7 Reverse -310 -324 -4.22864 0.214
NP_440454.1_2 Reverse -223 -237 18.2506 0.119
NP_440516.1_2 Reverse -327 -345 1.29745 0.201
NP_442428.1_5 Forward -320 -313 4.46401 0.267
NP_442428.1_5 Reverse -355 -362 4.36568 0.271
NP_442859.1_2 Reverse -313 -332 6.4893 0.199
NP_440673.1_3 Reverse -314 -321 10.5605 0.123
NP_441851.1_10 Reverse -353 -363 4.20827 0.282
NP_441851.1_10 Reverse -311 -321 4.10993 0.287
NP_441349.1_10 Forward -44 -25 -9.53865 0.294
NP_440432.1_9 Reverse -355 -370 -5.82163 0.267
NP_440474.1_8 Forward -320 -306 9.6354 0.158
NP_441124.1_5 Forward -158 -148 13.1036 0.215
NP_441570.1_1 Reverse -49 -67 -14.8288 0.227
NP_441432.1_8 Forward -322 -313 5.3096 0.17
NP_441432.1_9 Forward -180 -167 8.21054 0.292
NP_440578.1_10 Reverse -329 -348 14.6508 0.246
NP_441072.1_2 Reverse -60 -79 8.06259 0.24
NP_441659.2_8 Forward -363 -353 0.963343 0.254
NP_440118.1_1 Forward -97 -78 0.58944 0.288
NP_442346.1_5 Forward -322 -312 9.32148 0.118
NP_442346.1_5 Reverse -353 -363 4.60159 0.281
NP_440224.1_4 Reverse -327 -346 2.45773 0.225
NP_442140.1_3 Forward -320 -310 7.84651 0.126
NP_442140.1_3 Reverse -355 -365 5.19158 0.221
NP_440875.1_9 Forward -319 -309 11.8762 0.147
NP_440567.1_1 Reverse -313 -327 2.35953 0.176
NP_440821.1_4 Reverse -47 -57 -0.806614 0.296
NP_441239.1_9 Forward -323 -311 9.38042 0.108
NP_441239.1_9 Reverse -310 -322 3.48056 0.285
NP_441727.1_3 Reverse -347 -366 5.60432 0.252
NP_442083.1_9 Forward -336 -317 9.24257 0.265
NP_441541.1_7 Reverse -151 -169 12.6721 0.218
NP_442216.1_4 Reverse -389 -397 8.08217 0.255
NP_440212.1_9 Reverse -81 -100 10.076 0.14
NP_442052.1_3 Reverse -182 -201 15.2408 0.128
NP_440546.1_6 Forward -120 -101 7.57094 0.268
NP_442499.1_1 Reverse -258 -277 5.80098 0.22
NP_442402.1_4 Forward -82 -63 -3.93454 0.22
NP_442402.1_10 Reverse -390 -400 11.091 0.269
NP_441848.1_4 Forward -199 -183 8.12362 0.288
NP_440825.1_6 Reverse -344 -363 8.35759 0.285
NP_441536.1_5 Forward -279 -260 10.4225 0.232
NP_442532.1_4 Forward -355 -337 7.96493 0.289
NP_441408.2_7 Forward -200 -181 2.85105 0.199
NP_441011.1_8 Reverse -334 -343 8.06287 0.16
NP_440263.1_5 Reverse -350 -364 11.8976 0.294
NP_439944.1_9 Reverse -355 -365 11.6814 0.0887
NP_441697.1_5 Reverse -365 -384 -1.19407 0.204
NP_441697.1_5 Forward -23 -4 -10.8388 0.286
NP_441697.1_5 Reverse -266 -285 -10.9342 0.287
NP_441028.1_6 Forward -72 -62 3.51951 0.292
NP_441527.1_4 Forward -214 -195 -2.43547 0.156
NP_441527.1_4 Forward -385 -366 -12.3666 0.285
NP_441527.1_4 Forward -388 -369 -12.6531 0.292
NP_441106.1_1 Forward -322 -313 4.71961 0.21
NP_441106.1_1 Forward -364 -355 4.42462 0.226
NP_440205.1_4 Forward -200 -181 13.8641 0.238
NP_442401.1_4 Forward -86 -76 15.5198 0.263
NP_441589.1_5 Reverse -332 -351 17.436 0.262
NP_441460.1_1 Forward -379 -360 18.3146 0.228
NP_441401.1_2 Reverse -219 -238 18.3873 0.124
NP_441962.1_4 Forward -326 -307 -4.13045 0.156
NP_442352.1_10 Reverse -352 -370 2.87075 0.246
NP_440114.1_10 Forward -321 -307 8.65272 0.198
NP_440935.1_3 Forward -137 -118 14.9458 0.169
NP_441500.1_6 Forward -352 -334 13.9821 0.259
NP_441272.1_7 Forward -86 -76 13.4514 0.257
NP_440766.1_5 Forward -117 -105 9.66112 0.275
NP_441237.1_9 Forward -362 -352 9.7148 0.272
NP_441133.1_3 Forward -330 -311 13.0775 0.272
NP_442680.1_5 Forward -398 -379 -1.19775 0.299
NP_443037.1_7 Reverse -35 -54 -11.3086 0.285
NP_442936.1_10 Forward -243 -229 16.5374 0.216
NP_440554.1_4 Reverse -313 -323 4.69992 0.181
NP_440554.1_4 Reverse -50 -60 4.69992 0.181
NP_442862.1_3 Reverse -338 -355 7.02034 0.258
NP_442862.1_3 Forward -352 -335 6.13536 0.267
NP_442703.1_8 Forward -131 -113 11.2281 0.265
NP_442341.1_7 Forward -77 -63 1.27789 0.295
NP_441173.1_9 Reverse -392 -400 11.3271 0.226
NP_440091.1_1 Reverse -308 -320 0.23564 0.259
NP_441902.1_3 Forward -327 -317 14.5365 0.218
NP_441207.1_7 Reverse -155 -169 10.8044 0.253
NP_442753.1_6 Reverse -233 -252 4.71854 0.29
NP_440804.1_7 Forward -85 -68 10.1662 0.234
NP_441875.1_7 Reverse -26 -36 15.2213 0.236
NP_440216.1_9 Forward -361 -352 14.356 0.183
NP_442116.1_6 Reverse -6 -23 9.50584 0.227
NP_442403.1_8 Reverse -26 -45 -0.983855 0.256
NP_442564.1_9 Reverse -312 -326 15.2817 0.227
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTGGGGGAATTGAATTAAAAGAATATGAAGACATTGAAACCATCGCAAAATTAGGGCAAGCCTTAGCAGAGCATGGAGAAGCAATGGCAGCTTATTACAAATGCTATGACAACTTAGAAAACTTTGAGGATTATTACCTTGGAGAATATGAAAGTGAGCAAGACTTTGTTTATGATTACTTCGAGCAAACAGGACAATTAGAAGCAATTGAAAAAGCAGGATTAGATAGCTTTTATATTGATTTTGAAAAATTAGCTCATGATTGGTTTATTAATGATTTTTATAGCGCAGAAATTAGCTATAACAAGGTTTATGTTTTTAGCCGTCATTAACCCCTAGTAATGCGACCTCAGCACGTCCTAAAAAGGCTGACCACTCAAATACTTCAGGATTTTTTACT

CDS

ATGCACCACGACACCAAAGAAGCGATCTCCCGTTGCCTTTATTTCATTGACCGAGAAAACAAAACCCAAGAAAACCCCATCATTGCGGTGATTGAGAAGGCCCTAGAGTTTGCCAAAAATGAGGTTAGCTTTTCAGACCCCTACGACCTATTAGCCCAGATTGAAAGTGTTCTGACCGAGGAAGAATTGGCCAACGACGACCGCTATTATTCCCGCCAGGAAACGGAAGACTACCACCGTAATTGGTTACATTTCTAA

Protein

No sequence available