Your browser is old and dusty. Try Google Chrome!

Details for ssr5121

ORF ssr5121
Accession NP_942277.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -117 -131 -2.16369 0.285
NP_441418.1_6 Reverse -170 -189 -28.9099 0.213
NP_441418.1_6 Reverse -305 -324 -30.4831 0.28
NP_442291.1_5 Forward -369 -353 3.10679 0.114
NP_442272.1_2 Reverse -22 -41 15.899 0.15
NP_442272.1_2 Reverse -199 -218 12.2703 0.223
NP_441453.1_4 Reverse -359 -367 7.09925 0.0962
NP_441453.1_4 Forward -368 -360 7.00092 0.107
NP_442151.1_6 Reverse -359 -373 14.0609 0.0406
NP_442151.1_6 Forward -368 -354 6.09611 0.248
NP_440561.1_9 Reverse -377 -390 17.1289 0.269
NP_441818.1_1 Forward -367 -356 15.2011 0.0343
NP_440226.1_1 Reverse -359 -378 7.96426 0.0959
NP_440259.1_4 Reverse -98 -112 14.4203 0.201
NP_440150.1_6 Forward -133 -114 4.12936 0.245
NP_442173.1_1 Reverse -360 -368 12.9008 0.0296
NP_442173.1_1 Forward -367 -359 5.72262 0.203
NP_442752.1_4 Forward -120 -113 6.52896 0.154
NP_442975.1_10 Reverse -355 -369 3.34225 0.259
NP_441225.1_2 Reverse -334 -353 10.2259 0.127
NP_440784.1_7 Forward -367 -360 6.3323 0.228
NP_440784.1_7 Reverse -360 -367 6.13563 0.241
NP_440061.1_9 Reverse -114 -128 7.96378 0.185
NP_440061.1_9 Reverse -357 -371 5.70218 0.275
NP_442062.1_8 Reverse -359 -369 15.713 0.00658
NP_442062.1_8 Reverse -237 -247 8.63316 0.0733
NP_442062.1_8 Forward -368 -358 7.74818 0.0897
NP_441900.1_2 Reverse -326 -344 -5.29143 0.288
NP_440304.1_4 Reverse -357 -367 9.02648 0.0637
NP_442242.1_4 Reverse -360 -367 11.8388 0.0776
NP_441935.1_1 Forward -178 -159 15.5357 0.126
NP_441594.1_6 Reverse -350 -369 -0.000545616 0.294
NP_441365.1_5 Reverse -280 -299 -6.78538 0.262
NP_442726.1_7 Forward -186 -168 3.06741 0.215
NP_441925.1_4 Reverse -112 -131 -14.3576 0.262
NP_441925.1_4 Reverse -109 -128 -14.5542 0.263
NP_441925.1_4 Reverse -117 -136 -17.5041 0.296
NP_441083.1_5 Forward -368 -358 10.5998 0.0192
NP_441083.1_5 Reverse -359 -369 10.5014 0.0197
NP_441141.1_2 Reverse -313 -332 14.4533 0.228
NP_441738.1_2 Forward -366 -359 13.8051 0.0221
NP_441645.1_6 Reverse -117 -131 11.602 0.254
NP_440209.1_1 Forward -368 -360 8.37755 0.0576
NP_440209.1_1 Reverse -359 -367 8.27922 0.0687
NP_442889.1_8 Reverse -356 -370 3.53891 0.275
NP_440178.1_7 Reverse -358 -377 -22.6167 0.268
NP_441716.1_1 Forward -368 -354 3.93283 0.259
NP_441598.1_4 Reverse -276 -295 18.7807 0.237
NP_440906.1_5 Forward -367 -360 6.13563 0.241
NP_440906.1_5 Reverse -360 -367 6.13563 0.241
NP_440747.1_10 Forward -371 -359 5.15219 0.0179
NP_440747.1_10 Reverse -356 -368 -2.32097 0.0331
NP_441486.1_1 Reverse -356 -370 13.6676 0.00805
NP_441486.1_1 Forward -371 -357 3.04785 0.0689
NP_441695.1_4 Reverse -118 -136 13.4905 0.216
NP_441014.1_8 Forward -260 -241 1.96607 0.214
NP_441014.1_8 Reverse -115 -134 -7.4737 0.28
NP_441014.1_8 Reverse -160 -179 -8.85033 0.288
NP_443018.1_3 Reverse -360 -367 12.0355 0.0639
NP_443018.1_3 Forward -367 -360 5.64398 0.181
NP_440376.1_1 Reverse -359 -368 16.0277 0.00493
NP_440376.1_1 Forward -368 -359 9.73449 0.0365
NP_440376.1_1 Forward -179 -170 5.50626 0.131
NP_440376.1_1 Reverse -237 -246 1.86802 0.238
NP_441588.1_4 Reverse -361 -371 6.66654 0.185
NP_442687.1_7 Forward -369 -359 9.02648 0.0994
NP_442687.1_7 Forward -327 -317 5.09324 0.221
NP_442485.1_3 Reverse -168 -187 -6.1954 0.299
NP_441846.1_10 Forward -137 -118 -13.0786 0.197
NP_441846.1_10 Forward -136 -117 -13.2752 0.201
NP_441846.1_10 Forward -130 -111 -19.6667 0.256
NP_441846.1_10 Forward -135 -116 -20.4534 0.256
NP_441846.1_10 Forward -132 -113 -20.4534 0.256
NP_441846.1_10 Forward -133 -114 -21.9284 0.257
NP_441846.1_10 Forward -246 -227 -23.01 0.275
NP_441846.1_10 Forward -126 -107 -23.2067 0.279
NP_442530.1_2 Reverse -365 -375 14.828 0.203
NP_441950.1_7 Forward -130 -111 -0.885524 0.191
NP_442658.1_1 Forward -248 -238 8.14104 0.199
NP_442658.1_1 Forward -370 -360 5.19112 0.28
NP_442782.1_2 Forward -246 -232 0.196253 0.293
NP_442496.1_5 Forward -125 -107 9.95058 0.217
NP_440656.1_2 Forward -275 -256 1.57275 0.258
NP_441414.1_9 Reverse -359 -378 7.07928 0.0358
NP_442937.1_5 Forward -84 -65 9.24257 0.198
NP_441958.1_5 Forward -369 -359 2.53664 0.0409
NP_441958.1_5 Reverse -358 -368 2.43831 0.0422
NP_441127.1_1 Forward -335 -321 10.226 0.255
NP_442836.1_5 Reverse -353 -372 2.26107 0.266
NP_442816.1_7 Forward -48 -29 19.1457 0.0347
NP_439905.1_1 Reverse -360 -373 8.57408 0.232
NP_440984.1_7 Forward -373 -359 11.3077 0.122
NP_440984.1_7 Forward -183 -169 10.4227 0.126
NP_439990.1_5 Reverse -354 -367 9.06573 0.153
NP_439990.1_5 Reverse -82 -95 8.67241 0.166
NP_442911.1_1 Forward -45 -32 14.3856 0.291
NP_442911.1_2 Forward -378 -359 0.58944 0.0657
NP_441580.1_6 Forward -257 -238 -7.86702 0.247
NP_440153.1_8 Reverse -167 -180 4.24752 0.202
NP_439975.1_3 Forward -237 -224 17.4239 0.201
NP_441099.1_5 Forward -189 -170 3.34271 0.0515
NP_441294.1_7 Forward -97 -83 10.4985 0.185
NP_441646.1_1 Forward -375 -356 0.392778 0.251
NP_441000.1_6 Forward -180 -166 -4.32697 0.237
NP_440147.1_4 Forward -370 -357 8.77074 0.0465
NP_441175.1_7 Reverse -359 -378 17.7974 0.0564
NP_441550.1_8 Forward -370 -360 5.09279 0.267
NP_441041.1_4 Forward -246 -227 -11.9969 0.256
NP_441041.1_7 Reverse -167 -179 4.98816 0.282
NP_442396.1_5 Forward -372 -359 11.4257 0.0975
NP_441725.1_5 Forward -367 -357 1.74999 0.125
NP_441725.1_5 Reverse -360 -370 0.471689 0.173
NP_439966.1_7 Reverse -357 -367 5.97777 0.199
NP_442941.1_3 Forward -367 -357 10.2065 0.0213
NP_442941.1_3 Reverse -360 -370 1.25834 0.15
NP_440289.1_2 Reverse -356 -369 3.65753 0.0754
NP_440289.1_2 Reverse -167 -180 -5.09393 0.297
NP_440983.1_5 Reverse -272 -291 -2.55715 0.231
NP_440983.1_9 Forward -353 -334 2.65439 0.292
NP_442281.1_1 Forward -373 -359 5.30886 0.163
NP_442500.1_8 Reverse -24 -38 8.82869 0.285
NP_441556.1_4 Reverse -275 -294 12.5117 0.214
NP_442982.1_5 Reverse -150 -169 9.14423 0.12
NP_441644.1_6 Reverse -359 -369 13.4509 0.019
NP_441644.1_6 Forward -368 -358 8.04271 0.11
NP_442215.1_2 Reverse -357 -373 3.40179 0.0967
NP_442215.1_2 Reverse -270 -286 1.5335 0.132
NP_442215.1_2 Forward -370 -354 -3.48138 0.216
NP_442029.1_10 Forward -193 -174 5.211 0.287
NP_440253.1_2 Forward -368 -350 2.77242 0.131
NP_440929.1_8 Forward -368 -359 9.53783 0.0296
NP_440929.1_8 Reverse -359 -368 9.4395 0.0326
NP_442933.1_10 Reverse -359 -368 7.86621 0.103
NP_442933.1_10 Forward -368 -359 7.86621 0.103
NP_441751.2_8 Forward -367 -353 4.03116 0.0563
NP_442554.1_8 Forward -367 -357 6.76487 0.107
NP_442554.1_8 Reverse -360 -370 6.07655 0.126
NP_442075.1_1 Forward -139 -120 5.99764 0.269
NP_442142.1_4 Reverse -356 -369 10.6384 0.0697
NP_442292.1_1 Forward -367 -358 8.94785 0.0261
NP_442292.1_1 Reverse -360 -369 8.65285 0.0335
NP_440919.1_7 Forward -312 -294 11.3318 0.171
NP_442476.1_6 Reverse -360 -374 0.88457 0.238
NP_442381.1_8 Reverse -167 -186 0.491109 0.119
NP_441711.1_2 Reverse -110 -129 13.47 0.233
NP_441523.1_6 Reverse -125 -144 4.52268 0.251
NP_443009.1_5 Forward -369 -358 7.92465 0.118
NP_443009.1_5 Reverse -358 -369 4.8764 0.226
NP_441715.1_4 Reverse -360 -370 5.38824 0.205
NP_441715.1_4 Forward -367 -357 5.09324 0.233
NP_440357.1_3 Reverse -303 -322 -0.885524 0.296
NP_440015.1_9 Forward -368 -350 6.70565 0.112
NP_440379.1_5 Forward -191 -172 -9.93197 0.27
NP_441468.1_1 Reverse -360 -367 6.3323 0.202
NP_441468.1_1 Forward -367 -360 6.13563 0.209
NP_441015.1_10 Forward -133 -114 -9.14533 0.28
NP_441015.1_10 Forward -131 -112 -10.817 0.288
NP_441673.1_1 Forward -368 -359 11.1111 0.0121
NP_441673.1_1 Reverse -359 -368 11.0128 0.018
NP_441673.1_1 Forward -179 -170 -7.86675 0.187
NP_441673.1_1 Reverse -170 -179 -7.96508 0.206
NP_441826.1_2 Reverse -353 -367 3.04785 0.115
NP_441637.1_9 Reverse -80 -98 -0.177514 0.292
NP_442868.1_6 Forward -370 -360 6.56821 0.107
NP_442868.1_6 Reverse -357 -367 0.0783647 0.248
NP_442868.1_6 Forward -181 -171 -0.0199663 0.255
NP_442719.1_3 Reverse -261 -274 18.1116 0.292
NP_442227.1_2 Reverse -113 -132 13.5691 0.143
NP_442227.1_2 Reverse -117 -136 12.0942 0.164
NP_442227.1_2 Reverse -114 -133 7.86593 0.181
NP_443058.1_7 Forward -355 -336 6.4893 0.233
NP_442427.1_8 Forward -377 -358 15.4374 0.0863
NP_442808.1_1 Forward -248 -238 8.3377 0.0525
NP_442808.1_1 Forward -78 -68 2.73286 0.256
NP_440145.1_3 Reverse -349 -368 -4.52377 0.238
NP_442542.1_2 Forward -128 -115 7.78743 0.17
NP_442050.1_1 Forward -128 -109 14.0608 0.187
NP_442050.1_5 Reverse -357 -367 6.66608 0.286
NP_440334.1_2 Forward -107 -94 16.2439 0.203
NP_441114.1_3 Reverse -267 -276 6.98123 0.254
NP_441518.1_3 Reverse -349 -368 -13.8652 0.264
NP_441878.1_6 Reverse -358 -368 2.14332 0.0501
NP_441878.1_6 Forward -369 -359 1.25834 0.108
NP_441878.1_6 Forward -97 -87 -7.78811 0.266
NP_441878.1_6 Forward -180 -170 -7.88644 0.278
NP_441557.1_4 Forward -231 -217 12.0943 0.291
NP_441557.1_5 Forward -368 -359 10.2261 0.0144
NP_441557.1_5 Reverse -359 -368 10.1278 0.0188
NP_441557.1_8 Reverse -117 -127 10.8943 0.273
NP_441445.1_1 Reverse -350 -369 5.89931 0.162
NP_441445.1_1 Reverse -78 -97 2.3594 0.235
NP_441445.1_1 Forward -135 -116 -0.295539 0.289
NP_441590.1_4 Reverse -118 -137 7.27514 0.249
NP_441590.1_4 Reverse -119 -138 4.52188 0.286
NP_441433.1_8 Forward -240 -221 4.42435 0.185
NP_441433.1_8 Reverse -292 -311 -1.08219 0.258
NP_442777.1_3 Reverse -113 -131 0.0184138 0.298
NP_442830.1_5 Reverse -225 -239 4.03056 0.239
NP_441564.1_2 Forward -131 -112 -5.50708 0.274
NP_442166.1_7 Forward -178 -164 11.5043 0.19
NP_440086.1_2 Forward -52 -33 7.76679 0.29
NP_442645.1_2 Forward -376 -357 -12.4886 0.144
NP_442645.1_2 Reverse -351 -370 -19.5684 0.288
NP_442594.1_8 Forward -134 -115 2.16274 0.295
NP_442508.1_8 Forward -133 -116 20.1967 0.157
NP_442508.1_8 Reverse -245 -262 16.1651 0.223
NP_441633.1_3 Forward -370 -357 0.215946 0.13
NP_442764.1_8 Reverse -177 -196 3.04771 0.272
NP_440136.1_1 Forward -278 -262 11.5625 0.238
NP_440136.1_2 Reverse -360 -367 13.4121 0.0388
NP_440136.1_2 Forward -367 -360 6.23397 0.171
NP_442590.1_10 Reverse -163 -182 8.55425 0.206
NP_442590.1_10 Reverse -110 -129 5.40766 0.26
NP_442998.1_5 Reverse -258 -268 13.1564 0.158
NP_442998.1_10 Reverse -361 -368 12.5271 0.0457
NP_442998.1_10 Forward -366 -359 6.23397 0.157
NP_440299.1_1 Forward -372 -359 3.7553 0.232
NP_441799.1_1 Forward -372 -358 14.5519 0.0228
NP_441559.1_8 Reverse -232 -246 1.76955 0.153
NP_441559.1_8 Reverse -165 -179 -4.4253 0.223
NP_440915.1_6 Forward -130 -116 -1.96703 0.254
NP_440915.1_6 Forward -135 -121 -2.65535 0.278
NP_440915.1_6 Reverse -166 -180 -3.54032 0.298
NP_442158.1_4 Forward -30 -20 15.418 0.167
NP_441296.1_7 Reverse -302 -321 13.3725 0.267
NP_440717.1_1 Forward -181 -162 7.86593 0.265
NP_440717.1_3 Reverse -114 -128 9.83206 0.25
NP_440717.1_3 Reverse -117 -131 9.73373 0.25
NP_441866.1_3 Forward -116 -103 15.0639 0.177
NP_442993.1_1 Forward -368 -352 11.2683 0.0145
NP_442386.1_9 Forward -369 -360 10.1274 0.139
NP_442386.1_9 Forward -247 -238 7.17747 0.219
NP_440570.1_5 Forward -244 -225 -0.787193 0.264
NP_440570.1_5 Reverse -75 -94 -1.47551 0.273
NP_441750.1_1 Reverse -173 -192 -9.24366 0.3
NP_441340.1_5 Forward -367 -360 6.23397 0.132
NP_441340.1_5 Reverse -360 -367 6.13563 0.175
NP_442484.1_2 Forward -379 -360 1.57275 0.229
NP_442240.1_2 Forward -291 -272 -15.7335 0.222
NP_442251.1_6 Reverse -360 -367 11.9372 0.0749
NP_441262.1_3 Reverse -359 -366 11.5438 0.0584
NP_440523.1_5 Forward -264 -245 10.7175 0.203
NP_440027.1_3 Forward -103 -85 7.98318 0.2
NP_440027.1_3 Reverse -160 -178 4.93494 0.249
NP_440027.1_3 Forward -333 -315 3.36165 0.273
NP_440027.1_3 Reverse -117 -135 2.18168 0.292
NP_443051.1_1 Forward -369 -360 0.688044 0.134
NP_443051.1_1 Reverse -358 -367 0.589713 0.143
NP_443051.1_5 Reverse -19 -38 8.94757 0.235
NP_439937.1_8 Reverse -244 -263 -4.6221 0.286
NP_440840.1_10 Reverse -168 -186 12.0155 0.279
NP_440372.1_2 Forward -367 -360 6.62729 0.151
NP_440372.1_2 Reverse -360 -367 6.52896 0.188
NP_441138.1_5 Forward -30 -17 2.92653 0.297
NP_441789.1_7 Forward -189 -170 -4.42619 0.281
NP_440819.1_5 Reverse -257 -265 7.98423 0.228
NP_440819.1_5 Reverse -258 -266 7.68924 0.266
NP_440316.1_10 Forward -127 -117 6.8632 0.251
NP_442384.1_10 Reverse -359 -372 6.70579 0.0963
NP_442384.1_10 Reverse -170 -183 0.904263 0.275
NP_442114.1_8 Reverse -23 -37 3.73557 0.281
NP_440476.1_1 Reverse -8 -27 16.7542 0.243
NP_442262.1_10 Reverse -360 -367 12.4288 0.0538
NP_441689.1_5 Reverse -357 -367 5.48612 0.251
NP_440163.1_10 Reverse -356 -366 11.6814 0.169
NP_440531.1_6 Reverse -351 -370 1.47442 0.176
NP_440297.1_9 Forward -367 -357 0.865012 0.282
NP_440888.1_2 Forward -368 -354 7.47213 0.194
NP_440888.1_2 Reverse -359 -373 7.47213 0.194
NP_440822.1_1 Reverse -112 -131 15.0063 0.203
NP_440491.1_1 Reverse -356 -375 9.54836 0.21
NP_439969.1_1 Forward -192 -173 13.3725 0.0856
NP_441543.1_2 Forward -367 -358 7.86621 0.107
NP_441543.1_2 Reverse -360 -369 7.27622 0.13
NP_442845.1_2 Reverse -353 -367 3.8345 0.275
NP_441178.1_6 Reverse -115 -134 3.14526 0.269
NP_441178.1_6 Reverse -108 -127 1.6703 0.279
NP_441918.1_7 Reverse -358 -377 -2.75381 0.297
NP_440982.1_1 Reverse -117 -136 10.1267 0.212
NP_442710.1_7 Reverse -25 -44 7.67428 0.0963
NP_442637.1_1 Forward -243 -224 18.584 0.00163
NP_443064.1_6 Forward -368 -358 8.97947 0.254
NP_443064.1_6 Reverse -359 -369 8.97947 0.254
NP_440071.1_6 Forward -130 -116 14.5805 0.241
NP_441462.1_2 Forward -368 -358 1.84832 0.081
NP_441462.1_2 Reverse -359 -369 1.74999 0.0811
NP_441462.1_2 Reverse -170 -180 -0.609952 0.24
NP_441462.1_4 Reverse -113 -132 -2.36049 0.192
NP_441621.1_7 Reverse -244 -258 6.19444 0.068
NP_441621.1_7 Forward -257 -243 -3.63866 0.192
NP_443062.1_6 Reverse -309 -328 5.211 0.209
NP_441601.1_2 Reverse -353 -372 -0.688862 0.219
NP_440454.1_2 Reverse -17 -31 10.6112 0.291
NP_440516.1_8 Forward -368 -359 7.17789 0.0754
NP_440516.1_8 Reverse -359 -368 7.07956 0.0867
NP_442428.1_5 Reverse -360 -367 6.43063 0.148
NP_442428.1_5 Forward -367 -360 6.13563 0.209
NP_440818.1_10 Forward -87 -68 16.0274 0.198
NP_440673.1_3 Reverse -361 -368 9.77388 0.167
NP_440673.1_3 Reverse -267 -274 8.29892 0.221
NP_440673.1_7 Reverse -361 -380 1.37609 0.251
NP_440077.1_5 Reverse -173 -192 18.6823 0.101
NP_441052.1_2 Forward -368 -358 10.5014 0.0285
NP_441052.1_2 Reverse -359 -369 10.3048 0.0289
NP_442219.1_9 Forward -367 -358 8.06287 0.0696
NP_442219.1_9 Reverse -360 -369 7.96454 0.0696
NP_440436.1_4 Reverse -360 -369 13.9623 0.0193
NP_440436.1_4 Forward -367 -358 7.66912 0.124
NP_441884.1_8 Forward -173 -154 -10.6203 0.268
NP_441884.1_9 Reverse -302 -321 -23.2067 0.284
NP_441884.1_10 Reverse -89 -99 18.9579 0.233
NP_440314.1_9 Forward -322 -303 -9.53865 0.269
NP_442907.1_5 Reverse -40 -59 13.9625 0.262
NP_441719.1_4 Forward -367 -360 6.62729 0.151
NP_441719.1_4 Reverse -360 -367 6.52896 0.188
NP_441719.1_6 Reverse -223 -242 9.53674 0.269
NP_441004.1_1 Reverse -240 -259 -10.3253 0.219
NP_441004.1_1 Forward -346 -327 -17.6018 0.292
NP_442813.1_4 Reverse -72 -91 -6.58872 0.299
NP_442366.1_3 Forward -289 -271 -0.374176 0.19
NP_442873.1_5 Forward -186 -167 9.63507 0.248
NP_443054.1_2 Reverse -357 -371 0.294584 0.269
NP_442586.1_6 Forward -132 -113 12.0942 0.227
NP_441851.1_10 Reverse -358 -368 14.1397 0.0219
NP_441851.1_10 Forward -369 -359 6.07655 0.187
NP_442856.1_7 Forward -178 -159 0.687771 0.189
NP_441668.1_4 Forward -378 -359 16.8141 0.0435
NP_442515.1_1 Forward -369 -355 6.58777 0.0975
NP_442515.1_1 Reverse -358 -372 4.32615 0.107
NP_442515.1_1 Forward -97 -83 3.04785 0.125
NP_441046.1_2 Forward -379 -360 0.687771 0.263
NP_441349.1_10 Reverse -349 -368 5.01433 0.0477
NP_440432.1_9 Reverse -318 -333 -6.31328 0.296
NP_442843.1_1 Forward -322 -303 -10.227 0.277
NP_439960.1_10 Reverse -122 -140 -1.75081 0.245
NP_439960.1_10 Reverse -175 -193 -3.02911 0.264
NP_439960.1_10 Forward -189 -171 -3.12744 0.267
NP_440474.1_8 Forward -367 -353 5.01387 0.26
NP_440431.1_4 Reverse -21 -40 -1.19407 0.215
NP_441031.1_1 Reverse -33 -52 13.6676 0.125
NP_442006.1_2 Reverse -187 -204 -18.0541 0.287
NP_440483.1_1 Reverse -292 -311 -1.47551 0.208
NP_441570.1_1 Forward -368 -350 -17.1888 0.267
NP_441078.1_4 Forward -368 -359 10.4228 0.0105
NP_441078.1_4 Reverse -359 -368 10.3245 0.0119
NP_441078.1_4 Reverse -170 -179 -1.86856 0.272
NP_442443.1_1 Reverse -172 -191 -6.78538 0.298
NP_440526.1_3 Forward -367 -356 8.31797 0.126
NP_441432.1_8 Forward -369 -360 17.7976 0.00595
NP_441432.1_8 Reverse -358 -367 7.17789 0.102
NP_442320.1_8 Reverse -353 -367 -5.11362 0.206
NP_442344.1_7 Reverse -360 -379 -9.44032 0.251
NP_441732.1_7 Reverse -361 -380 10.8159 0.298
NP_440760.1_1 Reverse -359 -378 5.01433 0.0148
NP_440199.1_10 Reverse -356 -366 7.15819 0.235
NP_442400.1_10 Forward -314 -301 12.3802 0.211
NP_440713.1_4 Forward -136 -117 6.98095 0.184
NP_442489.1_7 Reverse -359 -368 17.601 0.00221
NP_442489.1_7 Forward -368 -359 10.4228 0.0151
NP_440941.1_1 Forward -127 -117 16.9913 0.223
NP_441452.1_1 Reverse -114 -133 21.0423 0.0742
NP_440386.1_1 Reverse -81 -100 -9.047 0.28
NP_440559.1_1 Forward -367 -358 14.1594 0.0317
NP_440559.1_1 Reverse -360 -369 7.57121 0.106
NP_441659.2_8 Forward -368 -358 8.73149 0.0401
NP_441659.2_8 Reverse -359 -369 8.33817 0.0443
NP_442913.1_7 Reverse -210 -226 16.4791 0.279
NP_442913.1_10 Forward -377 -358 -0.590531 0.161
NP_441040.1_2 Forward -192 -173 -8.85033 0.236
NP_441040.1_2 Forward -139 -120 -10.7186 0.248
NP_441968.1_1 Reverse -21 -29 15.162 0.257
NP_441807.1_5 Forward -379 -360 12.9791 0.129
NP_442346.1_5 Forward -369 -359 13.943 0.0183
NP_442346.1_5 Reverse -358 -368 7.55152 0.165
NP_442346.1_5 Forward -275 -265 7.05986 0.183
NP_442346.1_5 Forward -327 -317 6.66654 0.195
NP_440486.1_6 Reverse -247 -266 11.5042 0.207
NP_440459.1_2 Reverse -357 -374 7.80699 0.278
NP_440847.1_3 Reverse -118 -132 16.6169 0.119
NP_440847.1_3 Reverse -119 -133 10.422 0.294
NP_441948.1_4 Reverse -163 -181 -2.83245 0.177
NP_441948.1_4 Forward -186 -168 -5.88071 0.279
NP_441358.1_2 Forward -131 -112 8.84924 0.246
NP_441833.1_4 Forward -367 -360 6.23397 0.163
NP_441833.1_4 Reverse -360 -367 6.13563 0.198
NP_441329.1_6 Reverse -16 -35 -1.19407 0.291
NP_442162.1_9 Reverse -360 -367 12.6255 0.0393
NP_442162.1_9 Forward -367 -360 6.52896 0.178
NP_440671.1_4 Reverse -353 -367 15.7325 0.039
NP_440224.1_1 Reverse -348 -367 -0.39387 0.141
NP_440224.1_4 Forward -211 -192 1.0811 0.26
NP_442140.1_3 Reverse -315 -325 5.28991 0.216
NP_441813.1_5 Reverse -357 -367 6.07655 0.104
NP_442028.1_1 Forward -38 -25 10.9479 0.251
NP_442028.1_1 Forward -39 -26 7.60564 0.292
NP_440590.1_4 Reverse -360 -373 -1.94734 0.233
NP_440590.1_4 Forward -367 -354 -5.19226 0.277
NP_442497.1_10 Forward -367 -358 0.688044 0.141
NP_442497.1_10 Reverse -360 -369 0.589713 0.153
NP_440821.1_4 Reverse -357 -367 8.4365 0.0503
NP_440821.1_4 Forward -370 -360 -0.314959 0.251
NP_441239.1_9 Reverse -120 -132 4.07055 0.264
NP_441009.1_4 Forward -246 -227 10.4225 0.27
NP_442897.1_7 Reverse -254 -273 13.6675 0.289
NP_440665.1_1 Reverse -117 -136 -16.8151 0.293
NP_442643.1_1 Forward -137 -118 -10.817 0.231
NP_440989.1_3 Forward -328 -309 15.2408 0.138
NP_441874.1_1 Forward -238 -224 10.1277 0.263
NP_442216.1_4 Forward -313 -305 8.1805 0.255
NP_440212.1_9 Forward -44 -25 10.1721 0.14
NP_442138.1_10 Forward -368 -349 -3.44213 0.238
NP_442141.1_6 Reverse -20 -39 22.0833 0.0435
NP_442465.1_9 Reverse -191 -205 13.4709 0.216
NP_442499.1_1 Reverse -279 -298 4.12936 0.246
NP_441474.1_1 Reverse -119 -138 -1.67294 0.262
NP_442402.1_6 Forward -239 -230 15.1427 0.241
NP_442402.1_10 Forward -267 -257 12.5659 0.206
NP_439948.1_2 Reverse -18 -36 13.7528 0.259
NP_441084.1_6 Forward -105 -91 9.44108 0.282
NP_439942.1_1 Reverse -26 -45 21.7221 0.014
NP_442039.1_4 Reverse -360 -367 14.3954 0.0271
NP_441926.1_3 Forward -368 -352 15.1032 0.0428
NP_440825.1_7 Reverse -360 -370 12.3241 0.168
NP_442837.1_3 Forward -367 -360 6.0373 0.25
NP_442837.1_3 Reverse -360 -367 5.93897 0.265
NP_440160.1_2 Forward -247 -228 -3.73712 0.26
NP_442053.1_1 Forward -368 -359 8.65285 0.0741
NP_442053.1_1 Reverse -359 -368 8.55452 0.0784
NP_440505.1_3 Reverse -357 -367 13.2547 0.0351
NP_440505.1_3 Forward -370 -360 7.55152 0.151
NP_442456.1_5 Reverse -248 -266 10.0489 0.26
NP_440914.1_1 Forward -368 -358 15.6417 0.00456
NP_440914.1_1 Reverse -359 -369 8.32233 0.197
NP_442101.1_10 Reverse -76 -95 -13.2752 0.288
NP_442533.1_1 Forward -135 -116 -13.0786 0.236
NP_442533.1_1 Forward -130 -111 -13.5702 0.237
NP_442533.1_6 Forward -368 -359 8.65285 0.0727
NP_442533.1_6 Reverse -359 -368 7.96454 0.0838
NP_442533.1_6 Reverse -170 -179 4.52295 0.179
NP_440263.1_5 Forward -311 -297 7.07942 0.294
NP_440263.1_6 Reverse -348 -367 13.6675 0.205
NP_442322.1_4 Reverse -114 -131 8.88789 0.141
NP_442322.1_4 Reverse -116 -133 -10.0899 0.298
NP_442322.1_4 Reverse -115 -132 -10.1882 0.298
NP_439944.1_9 Forward -367 -357 9.51814 0.1
NP_441028.1_6 Reverse -221 -231 9.71433 0.21
NP_441028.1_6 Forward -400 -390 5.68278 0.243
NP_441028.1_6 Forward -266 -256 5.38779 0.255
NP_441527.1_4 Reverse -17 -36 -1.95801 0.152
NP_441527.1_4 Reverse -16 -35 -2.24448 0.155
NP_441527.1_4 Reverse -18 -37 -5.20473 0.197
NP_441527.1_4 Reverse -23 -42 -10.7433 0.274
NP_441527.1_4 Reverse -26 -45 -11.5072 0.282
NP_441527.1_7 Reverse -89 -108 8.06178 0.284
NP_441680.1_4 Reverse -118 -137 -1.86883 0.266
NP_441347.1_9 Forward -45 -32 12.0725 0.171
NP_441170.1_4 Reverse -324 -342 2.18243 0.285
NP_441106.1_1 Forward -94 -85 2.35967 0.287
NP_441420.1_1 Reverse -86 -105 -5.01543 0.292
NP_439903.1_6 Reverse -356 -375 -0.591301 0.283
NP_442588.1_6 Forward -172 -153 -1.96717 0.28
NP_441286.1_1 Forward -369 -357 11.642 0.0119
NP_441286.1_1 Reverse -358 -370 3.08724 0.05
NP_442674.1_3 Forward -186 -167 2.85027 0.297
NP_440670.1_8 Reverse -359 -368 15.1427 0.00768
NP_440670.1_8 Forward -368 -359 8.65285 0.0627
NP_440886.1_7 Forward -369 -359 5.38779 0.185
NP_440886.1_7 Reverse -169 -179 4.69947 0.22
NP_440886.1_7 Forward -256 -246 3.51951 0.279
NP_442614.1_1 Forward -169 -151 19.292 0.071
NP_442614.1_2 Forward -126 -112 11.996 0.172
NP_442614.1_2 Reverse -185 -199 8.84938 0.244
NP_441463.1_6 Reverse -357 -371 9.31494 0.25
NP_441626.1_2 Reverse -360 -367 6.43063 0.147
NP_441626.1_2 Forward -367 -360 6.0373 0.212
NP_442794.1_1 Forward -372 -360 6.72548 0.163
NP_441962.1_4 Forward -101 -82 -5.50708 0.169
NP_440387.1_1 Reverse -359 -375 1.82849 0.0943
NP_441993.1_1 Forward -368 -349 2.62889 0.256
NP_442805.1_5 Reverse -108 -127 -6.29447 0.284
NP_440114.1_10 Forward -368 -354 6.78443 0.258
NP_442437.1_3 Reverse -229 -248 10.2251 0.254
NP_440293.1_3 Forward -133 -114 -2.45882 0.241
NP_441237.1_5 Forward -282 -264 15.1621 0.202
NP_441237.1_9 Reverse -360 -370 11.9764 0.146
NP_439910.1_2 Reverse -351 -368 -21.889 0.195
NP_439910.1_2 Reverse -229 -246 -22.6756 0.285
NP_442867.1_8 Forward -133 -114 5.50599 0.276
NP_442867.1_8 Forward -193 -174 5.211 0.276
NP_440457.1_1 Forward -130 -118 13.9036 0.0783
NP_440457.1_1 Forward -183 -171 1.80894 0.223
NP_440457.1_1 Forward -180 -168 0.23564 0.25
NP_440457.1_1 Forward -125 -113 -0.0593532 0.25
NP_440457.1_1 Forward -131 -119 -1.04266 0.289
NP_441436.1_8 Forward -369 -350 7.07928 0.293
NP_442509.1_5 Reverse -162 -179 17.3443 0.151
NP_441496.1_1 Forward -274 -260 13.285 0.294
NP_441159.1_4 Forward -334 -315 3.44104 0.254
NP_441885.1_5 Forward -368 -358 11.7798 0.00668
NP_441885.1_5 Reverse -359 -369 11.0914 0.00874
NP_440478.1_9 Reverse -167 -186 9.3409 0.255
NP_442341.1_7 Forward -369 -355 6.78443 0.118
NP_442341.1_7 Reverse -358 -372 3.93283 0.208
NP_441756.1_5 Forward -133 -114 -3.3438 0.29
NP_441756.1_5 Forward -187 -168 -3.73712 0.29
NP_441756.1_5 Reverse -168 -187 -4.03212 0.29
NP_441756.1_5 Reverse -114 -133 -4.13045 0.292
NP_441173.1_9 Forward -265 -257 9.75379 0.284
NP_443000.1_3 Forward -129 -110 10.7468 0.267
NP_443000.1_7 Reverse -357 -367 7.25653 0.0927
NP_443000.1_7 Forward -370 -360 0.57002 0.294
NP_440507.2_3 Reverse -350 -369 10.7167 0.202
NP_440091.1_1 Reverse -355 -367 6.62715 0.0938
NP_440091.1_1 Forward -97 -85 3.2839 0.163
NP_440091.1_1 Forward -327 -315 0.333971 0.254
NP_442354.1_7 Reverse -356 -375 4.62101 0.281
NP_440679.1_10 Reverse -239 -258 -21.83 0.3
NP_439962.1_4 Reverse -171 -190 8.25926 0.134
NP_439962.1_4 Reverse -170 -189 1.67108 0.197
NP_439962.1_4 Reverse -113 -132 -7.4737 0.289
NP_439962.1_4 Forward -195 -176 -8.16202 0.292
NP_440149.1_8 Reverse -359 -378 -6.09707 0.24
NP_441105.1_3 Reverse -348 -367 -9.14533 0.284
NP_441105.1_3 Reverse -361 -380 -9.44032 0.289
NP_440216.1_1 Reverse -359 -373 -10.6202 0.145
NP_440216.1_1 Forward -179 -165 -11.2101 0.169
NP_440216.1_1 Forward -368 -354 -11.5051 0.192
NP_440216.1_1 Forward -142 -128 -12.3901 0.264
NP_440216.1_9 Reverse -20 -29 5.80125 0.289
NP_440172.1_1 Reverse -359 -369 11.9764 0.0334
NP_440172.1_1 Forward -368 -358 11.7798 0.0344
NP_441226.1_7 Forward -367 -360 5.64364 0.286
NP_441111.1_7 Forward -367 -359 8.96754 0.0463
NP_441111.1_7 Reverse -360 -368 8.86921 0.0589
NP_441766.1_2 Forward -368 -359 7.76787 0.0714
NP_441766.1_2 Reverse -359 -368 7.66954 0.0723
NP_440416.1_9 Forward -187 -168 -19.5684 0.276
NP_443052.1_9 Reverse -115 -134 7.37428 0.134
NP_443052.1_9 Reverse -118 -137 0.0977854 0.203
NP_443052.1_9 Reverse -168 -187 -3.14714 0.245
NP_440072.1_1 Forward -96 -82 17.6985 0.189
NP_440072.1_5 Forward -132 -114 7.59063 0.234
NP_440072.1_5 Forward -136 -118 5.23069 0.236
NP_440072.1_5 Forward -129 -111 -2.24246 0.269
NP_440072.1_5 Forward -135 -117 -3.91409 0.286
NP_442154.1_1 Forward -129 -111 -17.1888 0.249
NP_440261.1_5 Reverse -360 -373 -10.3055 0.201
NP_440988.1_10 Reverse -357 -371 5.96377 0.238
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTGCCTCCCATCATTAACCAGCAAGAACTTTTGGCAATCGCCATTTACCGATTAGCGTGGTGCGGCGCACAAGGGGCAACCATCGTAGAATTCCCCGCAAGGTTTAGGGTTGTTCCTTTGGTGTTGAGCAATGATTTTTCCCCGCCGCTATACCGGCAAACCCTGTGGAATGGGGGAATATCAAAGTTCAGGCTTATCTCTTGCTGTCTTGCCCCCACTCGGGGGGCCGCCGGTCAGTGACTTTGTGCCTTGATAGTTAGCTTTCGTCCGGCGGGGGGGTGGGGAGGCAGTAAAAAAAGGGAGGGACGACGACCACAAAGTGCCGGGAACCACATCTTTATTCTTACCTTCCTGATATTAAAGTTTATTCTTTTTTCTTGGTTTAAATGAAACTAGAAAT

CDS

ATGCTCAAATTTATAGGCATTGCATTACTTGCTGCATTGGTAGGCTATGCTTTTGGTGTTATGGCTGGAATCTTCATTGTCAATAATTTCTCCACTAATGTTCAGGATAAACCCTTGGAATTAGCGATGACCTCAATCTTTTTCTTTGGCCCAGTGGGAGCTTTGATAGGATTGATTATTGCAGTTGTGTATCAACTTTTACACCGATATTTATGA

Protein

No sequence available