Your browser is old and dusty. Try Google Chrome!

Details for ssr5092

ORF ssr5092
Accession NP_942248.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Forward -48 -34 12.1926 0.222
NP_440795.1_7 Forward -114 -107 5.74231 0.279
NP_441418.1_1 Reverse -284 -303 17.1404 0.0628
NP_442291.1_5 Reverse -105 -121 -2.30141 0.215
NP_441453.1_4 Reverse -106 -114 6.90259 0.121
NP_441453.1_4 Forward -115 -107 6.70593 0.121
NP_441453.1_7 Forward -391 -384 12.1338 0.295
NP_442838.1_5 Reverse -321 -340 12.3892 0.274
NP_440226.1_1 Forward -115 -96 8.65258 0.0836
NP_442287.1_5 Forward -225 -215 10.3048 0.291
NP_442173.1_1 Reverse -107 -115 11.7208 0.034
NP_442173.1_1 Forward -114 -106 7.49257 0.171
NP_443027.1_4 Forward -117 -107 11.0914 0.107
NP_443027.1_4 Reverse -141 -151 9.32148 0.166
NP_440784.1_7 Reverse -107 -114 6.43063 0.218
NP_440784.1_7 Forward -114 -107 6.23397 0.241
NP_440061.1_9 Forward -117 -103 9.14375 0.151
NP_440110.1_4 Forward -126 -107 3.83436 0.213
NP_441054.1_4 Reverse -96 -114 -0.669169 0.187
NP_442062.1_3 Reverse -284 -303 5.50599 0.182
NP_442062.1_8 Forward -115 -105 7.25653 0.104
NP_442062.1_8 Reverse -106 -116 5.28991 0.176
NP_441859.1_3 Forward -33 -14 2.26028 0.263
NP_441859.1_3 Forward -45 -26 1.76863 0.275
NP_441043.1_10 Reverse -2 -16 13.5693 0.263
NP_442242.1_4 Reverse -107 -114 13.3138 0.027
NP_440044.1_8 Reverse -107 -126 -2.16383 0.261
NP_440365.1_4 Forward -35 -16 9.24257 0.221
NP_441594.1_6 Forward -38 -19 7.37428 0.173
NP_441925.1_2 Forward -168 -149 2.75272 0.262
NP_441925.1_5 Forward -138 -124 19.8624 0.0337
NP_441083.1_5 Reverse -106 -116 8.23984 0.0429
NP_441083.1_5 Forward -115 -105 1.16001 0.215
NP_441434.1_1 Reverse -288 -302 9.27434 0.24
NP_441738.1_2 Reverse -108 -115 13.3134 0.0335
NP_441738.1_2 Forward -150 -143 6.03696 0.295
NP_440209.1_1 Forward -115 -107 8.27922 0.0687
NP_441713.1_2 Reverse -269 -288 14.2574 0.298
NP_441716.1_1 Reverse -73 -87 5.40779 0.231
NP_441327.1_1 Reverse -340 -359 3.25228 0.277
NP_440906.1_5 Reverse -107 -114 6.52896 0.199
NP_440906.1_5 Forward -114 -107 6.0373 0.262
NP_440747.1_10 Forward -118 -106 6.92215 0.012
NP_440747.1_10 Reverse -103 -115 -11.9574 0.178
NP_441486.1_1 Reverse -103 -117 -5.11362 0.222
NP_442145.1_4 Reverse -282 -301 6.54077 0.216
NP_442634.1_4 Forward -117 -103 -4.52363 0.206
NP_440470.1_5 Forward -299 -280 6.34979 0.279
NP_441695.1_8 Forward -82 -68 10.9143 0.269
NP_443018.1_3 Reverse -107 -114 5.15232 0.226
NP_443018.1_3 Forward -114 -107 5.05399 0.238
NP_441634.1_8 Forward -117 -103 -2.16369 0.295
NP_440376.1_1 Reverse -106 -115 0.196389 0.283
NP_440376.1_1 Forward -115 -106 -0.196935 0.285
NP_441077.1_6 Reverse -288 -304 11.0929 0.152
NP_441077.1_6 Reverse -344 -360 4.44078 0.255
NP_442485.1_3 Reverse -62 -81 -4.81876 0.285
NP_441029.1_10 Reverse -242 -261 16.7157 0.188
NP_440720.1_6 Reverse -293 -311 15.5554 0.281
NP_442937.1_5 Forward -120 -101 7.27595 0.258
NP_441958.1_5 Forward -116 -106 1.16001 0.114
NP_442836.1_10 Reverse -56 -66 9.32148 0.277
NP_442876.1_6 Reverse -41 -59 13.4663 0.23
NP_442876.1_7 Forward -194 -176 13.7855 0.292
NP_442690.1_1 Forward -300 -281 -14.7502 0.273
NP_442690.1_1 Reverse -150 -169 -15.8318 0.28
NP_442690.1_1 Forward -143 -124 -16.0285 0.283
NP_442690.1_1 Reverse -295 -314 -16.5201 0.289
NP_442690.1_1 Reverse -182 -201 -16.8151 0.291
NP_442911.1_2 Reverse -96 -115 5.30933 0.0341
NP_443055.1_6 Reverse -65 -83 6.99988 0.164
NP_441099.1_5 Forward -21 -2 -11.7019 0.288
NP_441099.1_10 Forward -364 -354 19.1541 0.0842
NP_441646.1_1 Reverse -66 -85 -0.197208 0.259
NP_442438.1_10 Reverse -101 -115 1.17956 0.204
NP_440377.1_1 Reverse -296 -313 11.0804 0.291
NP_440147.1_4 Forward -117 -104 12.999 0.0326
NP_441550.1_8 Forward -117 -107 5.28945 0.255
NP_441916.1_7 Reverse -106 -116 1.25834 0.289
NP_440345.1_5 Reverse -275 -289 14.143 0.276
NP_439966.1_7 Forward -117 -107 5.68278 0.214
NP_442941.1_3 Reverse -107 -117 9.81313 0.0263
NP_442941.1_3 Forward -114 -104 -1.10161 0.284
NP_441554.1_4 Reverse -42 -56 18.3461 0.22
NP_441514.1_4 Reverse -52 -71 13.3767 0.269
NP_442281.1_1 Forward -120 -106 12.2903 0.0385
NP_441079.1_7 Forward -153 -134 5.99684 0.136
NP_441079.1_7 Reverse -341 -360 -7.96609 0.298
NP_441860.1_1 Reverse -270 -284 14.2889 0.281
NP_441644.1_6 Reverse -106 -116 5.28945 0.199
NP_442215.1_2 Reverse -167 -183 -1.51476 0.186
NP_442247.1_8 Forward -117 -103 10.0294 0.247
NP_442933.1_6 Reverse -282 -301 13.4162 0.287
NP_442933.1_10 Reverse -106 -115 7.96454 0.0937
NP_442933.1_10 Forward -115 -106 7.76787 0.11
NP_440382.1_2 Reverse -288 -307 0.785326 0.299
NP_441751.2_8 Reverse -107 -121 -3.24533 0.137
NP_442554.1_8 Reverse -107 -117 13.5497 0.018
NP_442142.1_4 Reverse -26 -39 2.28034 0.295
NP_442142.1_4 Forward -118 -105 2.18201 0.299
NP_442292.1_1 Reverse -107 -116 16.421 0.00748
NP_442292.1_1 Forward -114 -105 -0.295266 0.24
NP_440125.1_1 Reverse -354 -373 16.2241 0.0538
NP_441371.1_3 Forward -37 -19 4.14905 0.296
NP_441715.1_4 Reverse -107 -117 16.1063 0.0144
NP_441758.1_10 Forward -336 -317 0.883656 0.197
NP_441468.1_1 Reverse -107 -114 13.0188 0.0383
NP_441468.1_1 Forward -114 -107 6.0373 0.223
NP_441673.1_1 Reverse -106 -115 1.37636 0.114
NP_441673.1_1 Forward -115 -106 1.1797 0.163
NP_442253.1_5 Forward -85 -68 3.28376 0.152
NP_441876.1_9 Reverse -379 -389 12.9592 0.267
NP_442868.1_6 Forward -117 -107 9.61647 0.0429
NP_442719.1_2 Forward -58 -40 -6.17641 0.224
NP_441251.1_7 Forward -311 -298 12.704 0.266
NP_442050.1_5 Reverse -104 -114 12.1726 0.0699
NP_442903.1_2 Reverse -281 -300 6.15881 0.18
NP_441114.1_3 Reverse -74 -83 7.86621 0.231
NP_440558.1_2 Forward -85 -66 0.196116 0.194
NP_441878.1_6 Reverse -72 -82 1.455 0.0979
NP_441878.1_6 Forward -82 -72 -7.19813 0.21
NP_441036.1_8 Reverse -105 -115 6.56821 0.225
NP_441557.1_5 Forward -115 -106 8.84951 0.0343
NP_441557.1_5 Reverse -106 -115 0.786375 0.106
NP_441590.1_4 Forward -80 -61 5.50519 0.277
NP_441458.1_8 Reverse -342 -361 5.55986 0.259
NP_442183.1_1 Forward -152 -138 5.01447 0.234
NP_442347.1_2 Forward -151 -142 6.19458 0.182
NP_442347.1_2 Reverse -107 -116 5.50626 0.229
NP_442347.1_2 Reverse -378 -387 3.7363 0.284
NP_441633.1_3 Forward -117 -104 -6.17557 0.238
NP_440136.1_2 Reverse -107 -114 6.52896 0.116
NP_440136.1_2 Forward -114 -107 6.13563 0.193
NP_442590.1_10 Forward -51 -32 4.32602 0.276
NP_441728.2_4 Reverse -281 -300 23.3474 0.00228
NP_442998.1_10 Reverse -108 -115 12.3305 0.0564
NP_440299.1_1 Forward -119 -106 7.88518 0.103
NP_441799.1_1 Reverse -102 -116 13.077 0.0362
NP_442158.1_2 Forward -360 -341 15.326 0.247
NP_441866.1_4 Forward -282 -269 12.175 0.293
NP_440215.1_6 Forward -125 -106 15.6332 0.228
NP_440695.1_6 Reverse -351 -365 9.73265 0.276
NP_442993.1_1 Reverse -368 -384 -13.4128 0.291
NP_442386.1_9 Forward -83 -74 6.68581 0.219
NP_442386.1_9 Reverse -105 -114 5.50585 0.25
NP_441750.1_7 Forward -231 -221 13.943 0.254
NP_441340.1_5 Reverse -107 -114 5.93897 0.198
NP_441340.1_5 Forward -114 -107 5.84064 0.208
NP_441340.1_9 Reverse -130 -140 15.1001 0.194
NP_440327.1_6 Reverse -319 -338 4.81767 0.266
NP_440161.1_3 Reverse -104 -123 8.25926 0.273
NP_442714.1_7 Reverse -73 -92 0.786102 0.226
NP_441027.1_1 Reverse -293 -307 13.4703 0.27
NP_442251.1_6 Reverse -107 -114 13.0188 0.0408
NP_443051.1_1 Forward -116 -107 0.589713 0.143
NP_439937.1_9 Forward -77 -60 -10.0899 0.221
NP_439937.1_9 Reverse -71 -88 -10.1882 0.224
NP_440398.1_2 Forward -44 -25 3.83436 0.231
NP_440398.1_6 Reverse -377 -396 13.9625 0.133
NP_440372.1_2 Reverse -107 -114 6.62729 0.151
NP_440372.1_2 Forward -114 -107 6.52896 0.188
NP_442663.1_2 Reverse -2 -20 10.4422 0.178
NP_442384.1_10 Reverse -106 -119 2.37923 0.228
NP_442384.1_10 Reverse -23 -36 0.904263 0.275
NP_442114.1_2 Reverse -289 -308 0.392778 0.262
NP_441877.1_5 Reverse -103 -122 -1.18052 0.283
NP_441877.1_9 Forward -303 -286 4.26707 0.284
NP_442262.1_10 Reverse -107 -114 10.6589 0.14
NP_442262.1_10 Reverse -11 -18 7.6106 0.274
NP_441689.1_5 Reverse -104 -114 5.58445 0.23
NP_442917.1_1 Reverse -281 -300 7.86512 0.254
NP_442556.1_7 Reverse -374 -393 10.6192 0.135
NP_440297.1_9 Forward -81 -71 6.17489 0.2
NP_442378.1_1 Forward -197 -180 16.5584 0.22
NP_440999.1_9 Reverse -102 -116 1.37622 0.166
NP_440888.1_2 Forward -115 -101 8.84875 0.145
NP_440888.1_2 Reverse -106 -120 6.68548 0.223
NP_441771.1_8 Reverse -284 -303 10.5514 0.11
NP_440179.1_6 Forward -114 -95 3.53937 0.266
NP_441543.1_2 Reverse -107 -116 7.17789 0.131
NP_441543.1_2 Forward -114 -105 4.22796 0.267
NP_441834.1_3 Forward -284 -265 20.1573 0.0667
NP_442578.1_7 Forward -114 -107 5.15232 0.291
NP_440148.1_1 Forward -202 -183 -6.78538 0.268
NP_441462.1_2 Forward -115 -105 0.766681 0.125
NP_441410.1_4 Reverse -321 -340 7.07848 0.297
NP_440504.1_7 Reverse -67 -86 -3.14714 0.244
NP_442780.1_1 Reverse -287 -306 11.5042 0.169
NP_442780.1_1 Reverse -286 -305 6.88262 0.291
NP_442872.1_1 Reverse -220 -239 -2.95047 0.205
NP_440516.1_8 Forward -115 -106 -0.393597 0.255
NP_442080.1_7 Forward -251 -232 18.4857 0.0136
NP_440128.1_4 Forward -156 -137 15.1424 0.125
NP_442428.1_5 Reverse -107 -114 6.3323 0.193
NP_442428.1_5 Forward -114 -107 6.13563 0.209
NP_441443.1_7 Forward -47 -28 -2.55715 0.27
NP_441052.1_2 Forward -11 -1 11.8781 0.0285
NP_441052.1_2 Reverse -73 -83 2.33998 0.209
NP_441052.1_2 Reverse -106 -116 2.04498 0.22
NP_441052.1_2 Forward -115 -105 0.766681 0.256
NP_442219.1_9 Forward -114 -105 8.84951 0.0681
NP_442219.1_9 Reverse -107 -116 8.25953 0.0681
NP_440436.1_4 Reverse -107 -116 7.47246 0.129
NP_440436.1_4 Forward -114 -105 6.29249 0.164
NP_441884.1_9 Forward -118 -99 -21.24 0.235
NP_442577.1_9 Forward -70 -56 15.6336 0.209
NP_441719.1_4 Reverse -107 -114 6.62729 0.151
NP_441719.1_4 Forward -114 -107 6.52896 0.188
NP_439949.1_7 Forward -282 -268 12.1926 0.269
NP_440296.1_6 Forward -359 -341 9.83765 0.298
NP_443054.1_2 Forward -83 -69 0.294584 0.269
NP_442586.1_5 Forward -218 -199 19.764 0.104
NP_441851.1_10 Forward -116 -106 7.55152 0.137
NP_442515.1_1 Forward -116 -102 1.96621 0.145
NP_442515.1_1 Reverse -374 -388 -4.91696 0.298
NP_442689.1_8 Reverse -154 -171 0.432165 0.191
NP_441349.1_10 Reverse -159 -178 -1.08219 0.0988
NP_441661.1_1 Reverse -55 -74 10.9142 0.147
NP_441409.1_6 Reverse -100 -119 -7.76869 0.156
NP_440432.1_9 Reverse -107 -122 -3.56002 0.183
NP_441124.1_5 Forward -308 -298 15.2045 0.198
NP_441124.1_5 Reverse -158 -168 11.4803 0.254
NP_441031.1_1 Forward -305 -286 6.72632 0.259
NP_441031.1_1 Reverse -280 -299 4.50898 0.288
NP_441031.1_1 Reverse -342 -361 3.83414 0.293
NP_441078.1_4 Reverse -106 -115 0.196389 0.205
NP_441078.1_4 Forward -115 -106 0.196389 0.205
NP_441432.1_8 Forward -116 -107 7.17789 0.102
NP_442320.1_8 Forward -121 -107 -5.21195 0.209
NP_441732.1_2 Forward -119 -103 -16.4611 0.167
NP_442447.1_1 Forward -314 -295 6.4893 0.258
NP_442797.1_9 Reverse -106 -124 14.8671 0.114
NP_442400.1_10 Forward -325 -312 9.13351 0.271
NP_442489.1_7 Reverse -106 -115 0.688044 0.152
NP_442489.1_7 Forward -115 -106 0.491382 0.178
NP_440559.1_1 Reverse -107 -116 7.66954 0.0999
NP_440559.1_1 Forward -114 -105 7.66954 0.0999
NP_441659.2_8 Reverse -106 -116 6.17489 0.084
NP_440363.1_9 Forward -90 -72 13.0972 0.254
NP_440708.1_5 Forward -117 -98 3.14605 0.292
NP_440335.1_9 Reverse -121 -139 16.4404 0.184
NP_442346.1_5 Forward -116 -106 6.56821 0.198
NP_442346.1_5 Reverse -105 -115 4.89658 0.269
NP_440352.1_5 Forward -317 -298 10.2223 0.278
NP_440250.1_4 Forward -299 -280 4.52188 0.253
NP_441943.1_2 Reverse -288 -307 10.9142 0.27
NP_442551.1_4 Forward -84 -69 -1.39674 0.245
NP_442603.1_7 Forward -115 -101 14.6503 0.0613
NP_441888.1_7 Forward -120 -106 2.65453 0.225
NP_441833.1_4 Reverse -107 -114 12.9205 0.0393
NP_441833.1_4 Forward -114 -107 6.13563 0.198
NP_441329.1_1 Forward -304 -285 8.16414 0.229
NP_441329.1_6 Forward -328 -309 4.24897 0.206
NP_441895.1_2 Reverse -126 -145 -18.0934 0.234
NP_442162.1_9 Reverse -107 -114 6.52896 0.178
NP_442162.1_9 Forward -114 -107 6.43063 0.208
NP_442404.1_9 Reverse -26 -40 8.16044 0.296
NP_440224.1_1 Forward -126 -107 2.3594 0.132
NP_440204.1_9 Forward -131 -112 19.0757 0.12
NP_442140.1_3 Forward -114 -104 3.42162 0.297
NP_441813.1_5 Forward -117 -107 8.33817 0.047
NP_440594.1_8 Forward -114 -101 11.5234 0.152
NP_440590.1_4 Forward -114 -101 -6.07724 0.299
NP_440567.1_1 Forward -114 -100 -0.0987402 0.264
NP_442497.1_10 Reverse -107 -116 0.688044 0.141
NP_440821.1_4 Reverse -104 -114 -0.314959 0.251
NP_440821.1_4 Forward -117 -107 -0.41329 0.257
NP_441541.1_1 Forward -302 -284 4.29912 0.171
NP_440546.1_4 Forward -115 -105 8.10685 0.203
NP_440675.1_3 Reverse -2 -21 13.3725 0.161
NP_442465.1_5 Reverse -299 -318 18.6683 0.0928
NP_440868.1_4 Forward -119 -107 4.95553 0.108
NP_440868.1_4 Reverse -102 -114 1.31728 0.186
NP_440401.1_9 Reverse -381 -388 14.5917 0.287
NP_442402.1_4 Reverse -369 -388 -3.54122 0.217
NP_441848.1_4 Forward -313 -297 10.7974 0.241
NP_442039.1_4 Reverse -107 -114 11.3472 0.086
NP_441811.1_2 Reverse -373 -392 13.5683 0.284
NP_441811.1_8 Reverse -100 -114 6.19444 0.283
NP_442696.1_2 Forward -116 -98 8.37728 0.295
NP_442696.1_3 Forward -89 -70 -0.688862 0.214
NP_442837.1_3 Reverse -107 -114 6.52896 0.2
NP_442837.1_3 Forward -114 -107 6.0373 0.25
NP_442053.1_1 Forward -115 -106 5.60459 0.176
NP_440505.1_3 Forward -117 -107 8.63316 0.138
NP_442532.1_1 Reverse -288 -302 10.9882 0.23
NP_440914.1_1 Reverse -106 -116 6.66328 0.269
NP_440914.1_1 Forward -115 -105 6.07773 0.297
NP_442533.1_6 Reverse -73 -82 6.48957 0.109
NP_442533.1_6 Forward -115 -106 6.19458 0.115
NP_442533.1_6 Forward -81 -72 4.32629 0.184
NP_442229.1_1 Forward -108 -94 6.48882 0.219
NP_443016.1_5 Forward -74 -55 3.83357 0.292
NP_439944.1_9 Forward -114 -104 13.648 0.0526
NP_441697.1_5 Forward -152 -133 -4.05883 0.22
NP_440115.1_6 Reverse -103 -113 6.96153 0.166
NP_440115.1_6 Forward -118 -108 6.76487 0.167
NP_441106.1_3 Forward -200 -181 18.3873 0.0583
NP_001035870.1_3 Reverse -319 -338 -5.01543 0.278
NP_441286.1_1 Forward -116 -104 2.59558 0.0573
NP_441286.1_1 Reverse -105 -117 -5.95921 0.235
NP_440670.1_8 Forward -115 -106 5.70292 0.14
NP_442614.1_2 Forward -115 -101 5.70279 0.298
NP_442401.1_2 Reverse -221 -240 12.7816 0.159
NP_442213.1_5 Forward -232 -213 0.0977854 0.273
NP_440326.1_7 Reverse -353 -367 18.9775 0.0312
NP_441463.1_3 Forward -21 -2 0.491109 0.131
NP_441463.1_3 Forward -269 -250 -9.34199 0.278
NP_442893.1_4 Forward -307 -288 -1.77127 0.273
NP_441626.1_2 Reverse -107 -114 6.0373 0.212
NP_441626.1_2 Forward -114 -107 5.93897 0.231
NP_441401.1_5 Reverse -241 -260 9.69201 0.297
NP_441836.1_2 Reverse -100 -119 6.09597 0.116
NP_441193.1_1 Forward -79 -60 9.14342 0.277
NP_440634.1_4 Reverse -236 -255 7.57094 0.257
NP_440634.1_10 Forward -35 -16 12.7816 0.164
NP_440634.1_10 Reverse -17 -36 5.70185 0.269
NP_441425.1_4 Forward -309 -295 13.7659 0.282
NP_440293.1_3 Reverse -65 -84 -5.80207 0.282
NP_439988.1_10 Forward -361 -342 9.40425 0.226
NP_440458.1_7 Forward -339 -320 3.24359 0.218
NP_443037.1_7 Forward -291 -272 -4.03212 0.276
NP_440524.1_2 Reverse -31 -50 1.37609 0.261
NP_442936.1_7 Forward -308 -289 2.94938 0.255
NP_440554.1_4 Reverse -107 -117 5.68323 0.135
NP_441885.1_5 Forward -115 -105 10.1081 0.0145
NP_441885.1_5 Reverse -106 -116 1.455 0.11
NP_442703.1_9 Reverse -38 -56 5.03403 0.244
NP_442341.1_7 Forward -116 -102 4.52282 0.188
NP_443000.1_7 Forward -117 -107 10.3048 0.0345
NP_443000.1_7 Reverse -360 -370 2.53664 0.226
NP_441842.1_1 Forward -113 -100 14.08 0.119
NP_440275.1_3 Forward -117 -107 5.28991 0.158
NP_440091.1_1 Reverse -102 -114 0.825626 0.227
NP_442275.1_3 Forward -207 -188 11.5042 0.274
NP_441389.1_5 Forward -128 -109 11.1109 0.251
NP_441105.1_3 Reverse -164 -183 -9.93197 0.298
NP_442127.1_9 Reverse -342 -361 11.1244 0.292
NP_440216.1_1 Reverse -106 -120 -12.1934 0.247
NP_440172.1_1 Forward -115 -105 15.418 0.00945
NP_441111.1_7 Reverse -107 -115 8.96754 0.0463
NP_441766.1_2 Forward -115 -106 14.0611 0.0111
NP_442403.1_9 Forward -35 -16 2.85105 0.285
NP_442226.1_8 Reverse -58 -68 14.9263 0.254
NP_440261.1_5 Forward -114 -101 -5.29059 0.19
NP_440261.1_5 Reverse -107 -120 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GTAGGCCACTCATTGGGGTTAAAGTCCATAGTGAACTCCTTAAAATTAGTAATTTATATTGTCCAATAGCTAAATAAAAATGACCACAAATATTGGAAAATTTAACTTTCTTTAAAGCTTTGCTGATTTATCCATTAATACTCTGACAACCCTGGTTAACTGCTGAGTTGATTGTTGGAGATGCTGTTAAGTAGGGTCTAAAATGTAACGATATTTACCAATGTCAGTAGCAAATTTTAGACAAGGTAATAGATCCCAATAATTTTTACTAGGGGTTTCTAACCTGGCGATCTCTACCAAGTCTGATTAAAGTTAGGTGGGCAAGGCCCTATCTGCCCAAATACTTTTTACTGCTGTTCAATGGTGCCGGTGATTATTACCATCAATCTCGTGATCAACA

CDS

ATGATTAACCAAGCTATTCAATTAGCCCAACTATTTGGCAATCTCTTAACTATGGCCGATTACAGCATGGCTTGCGCTTTGCTATCCCCGGAACGGCAACGGCAATATCCACCCATGGAACCGAATGATGTCGTCTGGTTATACGTTTCTTTAGAGGGGGAAGATTTTGTGGAGGCTGTATCGGTGATTATCGAAGATCGGGAAGGAAAATTAGCAATTCGTTGGCTTGAGTGGGGTAGGCCCTGA

Protein

No sequence available