Your browser is old and dusty. Try Google Chrome!

Details for ssr5020

ORF ssr5020
Accession NP_942176.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -69 -83 4.22782 0.153
NP_441061.1_2 Forward -76 -62 -0.000409212 0.219
NP_441061.1_2 Reverse -160 -174 -1.5737 0.265
NP_440795.1_7 Forward -76 -69 14.6904 0.0123
NP_440795.1_7 Reverse -69 -76 14.6904 0.0123
NP_441418.1_6 Forward -162 -143 -12.1936 0.0614
NP_442291.1_3 Forward -318 -299 9.34008 0.281
NP_442291.1_5 Reverse -67 -83 9.89163 0.0483
NP_441453.1_4 Reverse -68 -76 16.539 0.00633
NP_441453.1_4 Forward -77 -69 16.539 0.00633
NP_441453.1_7 Reverse -231 -238 11.6422 0.298
NP_442151.1_6 Reverse -68 -82 13.6676 0.0474
NP_442151.1_6 Forward -77 -63 8.75105 0.164
NP_441818.1_1 Reverse -69 -80 18.8393 0.00301
NP_441818.1_9 Forward -162 -143 -7.57203 0.272
NP_440226.1_1 Reverse -68 -87 8.25926 0.0904
NP_442655.1_10 Reverse -255 -274 -10.6203 0.22
NP_442173.1_1 Forward -76 -68 15.4574 0.00633
NP_442173.1_1 Reverse -69 -77 15.4574 0.00633
NP_442752.1_4 Forward -77 -70 13.8055 0.0199
NP_442752.1_4 Reverse -68 -75 13.8055 0.0199
NP_443027.1_4 Forward -79 -69 14.0414 0.0452
NP_443027.1_4 Reverse -368 -378 12.3697 0.079
NP_441812.1_3 Reverse -67 -81 11.5043 0.21
NP_442975.1_10 Forward -81 -67 13.1753 0.0459
NP_442975.1_10 Reverse -64 -78 1.37564 0.299
NP_440784.1_7 Forward -76 -69 15.9687 0.0123
NP_440784.1_7 Reverse -69 -76 15.9687 0.0123
NP_442909.1_7 Reverse -69 -83 13.9619 0.12
NP_440061.1_9 Forward -79 -65 9.14375 0.151
NP_440110.1_4 Reverse -57 -76 8.45592 0.131
NP_440878.1_9 Reverse -58 -77 2.16274 0.177
NP_442062.1_3 Reverse -100 -119 5.60432 0.182
NP_442062.1_8 Forward -77 -67 17.3846 0.00193
NP_442062.1_8 Reverse -68 -78 17.3846 0.00193
NP_441802.1_1 Forward -391 -372 6.39097 0.269
NP_440304.1_4 Forward -79 -69 10.8948 0.051
NP_440304.1_4 Reverse -66 -76 1.84832 0.299
NP_442242.1_4 Forward -76 -69 14.3954 0.0124
NP_442242.1_4 Reverse -69 -76 14.3954 0.0124
NP_442242.1_4 Reverse -371 -378 10.0689 0.174
NP_440044.1_8 Reverse -69 -88 8.06259 0.0788
NP_440044.1_8 Forward -76 -57 6.39097 0.0916
NP_441620.1_3 Forward -84 -65 18.584 0.132
NP_441352.1_2 Forward -342 -323 3.24438 0.222
NP_441619.1_8 Forward -399 -385 9.53707 0.215
NP_441619.1_8 Reverse -62 -76 8.75042 0.237
NP_442110.1_7 Reverse -68 -82 8.84938 0.0807
NP_440856.1_7 Reverse -252 -271 -6.88371 0.246
NP_441083.1_5 Forward -77 -67 20.3345 0.00053
NP_441083.1_5 Reverse -68 -78 20.3345 0.00053
NP_441083.1_5 Forward -277 -267 3.42162 0.172
NP_441083.1_5 Reverse -153 -163 0.176696 0.241
NP_442245.1_9 Reverse -157 -176 19.2723 0.25
NP_440109.1_4 Forward -147 -128 18.289 0.225
NP_441738.1_2 Forward -75 -68 15.28 0.0102
NP_441738.1_2 Reverse -70 -77 15.28 0.0102
NP_441738.1_4 Forward -87 -68 6.78429 0.203
NP_440209.1_1 Reverse -68 -76 18.1123 0.00295
NP_440209.1_1 Forward -77 -69 18.1123 0.00295
NP_440209.1_1 Forward -162 -154 5.32929 0.139
NP_440209.1_1 Reverse -153 -161 2.37936 0.222
NP_440209.1_2 Reverse -222 -238 10.8749 0.251
NP_442889.1_8 Forward -80 -66 13.1753 0.0588
NP_442889.1_8 Reverse -65 -79 9.73373 0.0945
NP_441713.1_3 Reverse -144 -163 5.30933 0.253
NP_440178.1_7 Reverse -67 -86 13.7658 0.00536
NP_441716.1_1 Forward -162 -148 4.52282 0.255
NP_441716.1_1 Reverse -68 -82 4.12949 0.258
NP_441327.1_5 Reverse -1 -10 14.356 0.192
NP_442111.1_4 Reverse -369 -383 2.75286 0.266
NP_442111.1_4 Forward -78 -64 1.76955 0.294
NP_441163.1_1 Reverse -137 -154 6.23297 0.264
NP_440906.1_5 Forward -76 -69 15.8704 0.0124
NP_440906.1_5 Reverse -69 -76 15.8704 0.0124
NP_440906.1_5 Forward -378 -371 9.47889 0.116
NP_440906.1_5 Forward -161 -154 8.20058 0.19
NP_440906.1_5 Reverse -154 -161 8.20058 0.19
NP_440747.1_10 Reverse -65 -77 14.887 0.00223
NP_440747.1_10 Forward -80 -68 7.51213 0.00286
NP_441486.1_1 Forward -80 -66 23.5007 0.00162
NP_441486.1_1 Reverse -65 -79 12.586 0.0112
NP_440403.1_4 Forward -186 -167 -6.58872 0.235
NP_440842.1_6 Reverse -134 -153 9.7334 0.297
NP_440842.1_8 Reverse -300 -318 16.9321 0.234
NP_441014.1_10 Reverse -67 -86 9.83173 0.123
NP_442848.1_1 Forward -83 -69 15.4376 0.015
NP_443018.1_3 Forward -76 -69 14.8871 0.0123
NP_443018.1_3 Reverse -69 -76 14.8871 0.0123
NP_441634.1_8 Reverse -66 -80 -4.62196 0.295
NP_440376.1_1 Forward -77 -68 19.4693 0.000692
NP_440376.1_1 Reverse -68 -77 19.4693 0.000692
NP_441588.1_4 Forward -75 -65 15.9097 0.0369
NP_441588.1_4 Reverse -70 -80 8.63316 0.14
NP_441588.1_4 Reverse -155 -165 8.33817 0.151
NP_442687.1_7 Forward -78 -68 8.92815 0.0994
NP_442687.1_7 Reverse -67 -77 8.92815 0.0994
NP_442687.1_7 Reverse -152 -162 4.50326 0.245
NP_442946.1_6 Forward -140 -121 19.7187 0.291
NP_441846.1_10 Reverse -236 -255 -13.2752 0.201
NP_441846.1_10 Reverse -292 -311 -15.0452 0.243
NP_441846.1_10 Reverse -294 -313 -23.6983 0.295
NP_440533.1_9 Reverse -258 -277 3.93269 0.238
NP_442296.1_9 Forward -390 -371 -5.60541 0.288
NP_442658.1_1 Reverse -66 -76 6.76441 0.214
NP_442658.1_1 Forward -79 -69 6.76441 0.214
NP_440141.1_8 Reverse -229 -248 13.4708 0.156
NP_440141.1_8 Reverse -296 -315 7.27595 0.243
NP_440141.1_8 Forward -358 -339 6.19431 0.268
NP_442782.1_7 Forward -85 -66 1.47442 0.197
NP_442205.1_9 Forward -83 -67 4.48343 0.149
NP_441414.1_9 Forward -77 -58 7.17762 0.0358
NP_441414.1_9 Reverse -68 -87 -2.26216 0.112
NP_441256.1_1 Forward -270 -251 5.70265 0.115
NP_442937.1_5 Reverse -63 -82 10.8159 0.152
NP_442937.1_5 Forward -82 -63 9.3409 0.196
NP_441958.1_5 Forward -78 -68 12.2714 0.00183
NP_441958.1_5 Reverse -67 -77 12.2714 0.00183
NP_442685.1_2 Forward -339 -329 14.0414 0.275
NP_440203.1_5 Forward -311 -301 11.091 0.205
NP_440203.1_5 Forward -274 -264 9.616 0.25
NP_439905.1_1 Forward -304 -291 7.19745 0.264
NP_440984.1_7 Reverse -63 -77 11.0127 0.122
NP_439990.1_5 Reverse -63 -76 7.6891 0.186
NP_442911.1_2 Forward -87 -68 -3.3438 0.111
NP_442911.1_2 Reverse -58 -77 -3.54046 0.114
NP_442064.1_1 Reverse -63 -82 -12.5869 0.277
NP_442064.1_4 Reverse -64 -83 5.30853 0.271
NP_440934.1_2 Reverse -133 -152 2.45773 0.252
NP_440138.1_6 Forward -161 -142 2.16195 0.273
NP_441099.1_5 Reverse -143 -162 -11.3086 0.276
NP_441294.1_7 Forward -81 -67 14.914 0.033
NP_442438.1_10 Forward -82 -68 8.84938 0.0718
NP_442438.1_10 Reverse -305 -319 2.5562 0.173
NP_442431.1_10 Reverse -241 -259 6.11567 0.195
NP_441398.1_5 Reverse -149 -168 16.3224 0.174
NP_440879.1_6 Reverse -148 -167 4.52268 0.208
NP_441000.1_6 Reverse -131 -145 -3.83532 0.225
NP_441000.1_6 Reverse -67 -81 -4.7203 0.251
NP_442771.1_1 Forward -319 -301 -10.1089 0.242
NP_440484.1_1 Forward -303 -284 13.175 0.191
NP_440147.1_4 Reverse -66 -79 11.3273 0.0326
NP_440147.1_4 Forward -79 -66 2.18257 0.209
NP_441550.1_8 Reverse -66 -76 14.6309 0.0132
NP_441550.1_8 Forward -79 -69 12.3692 0.0336
NP_441916.1_7 Forward -77 -67 10.3048 0.0261
NP_441916.1_7 Reverse -68 -78 10.3048 0.0261
NP_441916.1_7 Reverse -136 -146 10.1081 0.0283
NP_441916.1_10 Forward -85 -66 4.12936 0.223
NP_441041.1_4 Reverse -68 -87 4.71934 0.0555
NP_441041.1_4 Forward -180 -161 -13.1769 0.282
NP_442396.1_5 Reverse -64 -77 21.1604 0.00421
NP_440569.1_10 Forward -122 -103 4.24897 0.266
NP_442004.1_6 Reverse -68 -82 2.94952 0.254
NP_441725.1_5 Reverse -69 -79 11.2881 0.0247
NP_441725.1_5 Forward -76 -66 2.04498 0.115
NP_439966.1_7 Forward -79 -69 15.8108 0.0124
NP_439966.1_7 Reverse -66 -76 7.25606 0.15
NP_442941.1_3 Reverse -69 -79 19.9412 0.00262
NP_442941.1_3 Forward -76 -66 11.0914 0.0116
NP_440289.1_2 Forward -80 -67 13.294 0.0132
NP_440289.1_2 Reverse -65 -78 -4.9956 0.294
NP_442281.1_1 Forward -82 -68 15.9285 0.00992
NP_442281.1_1 Reverse -63 -77 8.94708 0.0747
NP_441079.1_7 Reverse -205 -224 -5.70449 0.267
NP_442256.1_2 Reverse -151 -169 -9.22396 0.254
NP_441556.1_4 Reverse -293 -312 14.729 0.165
NP_440498.1_1 Forward -86 -68 -3.42244 0.261
NP_442982.1_5 Reverse -140 -159 -0.885524 0.262
NP_441644.1_6 Forward -77 -67 17.3841 0.00127
NP_441644.1_6 Reverse -68 -78 17.3841 0.00127
NP_443049.1_6 Reverse -304 -314 11.4458 0.257
NP_441071.1_2 Forward -338 -319 15.2305 0.279
NP_440867.1_10 Forward -305 -286 1.27776 0.298
NP_442215.1_2 Reverse -66 -82 5.17175 0.0796
NP_442215.1_2 Forward -79 -63 -4.85801 0.24
NP_440253.1_2 Reverse -68 -86 6.90232 0.0752
NP_440253.1_2 Forward -77 -59 -3.71743 0.3
NP_440929.1_8 Forward -77 -68 19.2726 0.000701
NP_440929.1_8 Reverse -68 -77 19.2726 0.000701
NP_442933.1_10 Forward -77 -68 17.601 0.00325
NP_442933.1_10 Reverse -68 -77 17.601 0.00325
NP_441751.2_8 Reverse -69 -83 4.12949 0.0534
NP_441751.2_8 Forward -76 -62 -3.04867 0.134
NP_441751.2_8 Forward -266 -252 -5.80194 0.239
NP_442554.1_8 Reverse -69 -79 15.9097 0.00747
NP_442554.1_8 Forward -76 -66 15.3197 0.00882
NP_441762.1_7 Forward -78 -66 0.432302 0.0747
NP_441762.1_7 Reverse -67 -79 -6.84419 0.284
NP_442142.1_4 Forward -80 -67 14.1783 0.0311
NP_442142.1_4 Forward -270 -257 3.65697 0.248
NP_442142.1_4 Reverse -65 -78 2.96866 0.269
NP_442292.1_1 Forward -76 -67 18.486 0.00229
NP_442292.1_1 Reverse -69 -78 18.486 0.00229
NP_442476.1_6 Forward -76 -62 10.9143 0.0601
NP_443009.1_5 Reverse -67 -78 8.90795 0.0965
NP_443009.1_5 Forward -78 -67 8.90795 0.0965
NP_441715.1_4 Reverse -69 -79 14.828 0.0268
NP_441715.1_4 Forward -76 -66 7.94484 0.107
NP_440464.1_10 Forward -76 -66 13.0082 0.169
NP_441468.1_1 Forward -76 -69 15.8704 0.0124
NP_441468.1_1 Reverse -69 -76 15.8704 0.0124
NP_439939.1_9 Forward -151 -132 18.3113 0.259
NP_441020.2_6 Forward -147 -130 6.23369 0.27
NP_441673.1_1 Forward -77 -68 20.8459 0.000698
NP_441673.1_1 Reverse -68 -77 20.8459 0.000698
NP_441339.1_4 Reverse -177 -196 -5.60541 0.28
NP_441826.1_2 Forward -83 -69 4.32615 0.104
NP_441826.1_2 Reverse -68 -82 -0.590395 0.215
NP_442868.1_6 Forward -79 -69 9.91146 0.038
NP_442868.1_6 Reverse -66 -76 9.81313 0.038
NP_441056.1_1 Reverse -68 -87 7.27595 0.102
NP_441612.1_2 Reverse -68 -78 8.54929 0.21
NP_441612.1_2 Forward -77 -67 8.54929 0.21
NP_442427.1_8 Forward -86 -67 15.4374 0.0863
NP_442427.1_8 Reverse -59 -78 9.3409 0.184
NP_442808.1_1 Reverse -67 -77 8.63269 0.0481
NP_442808.1_1 Forward -78 -68 8.63269 0.0481
NP_440145.1_3 Forward -87 -68 0.786102 0.133
NP_442718.1_2 Forward -192 -173 14.2574 0.0601
NP_442050.1_5 Forward -79 -69 16.4991 0.00812
NP_442050.1_5 Reverse -66 -76 7.64939 0.243
NP_440558.1_2 Forward -86 -67 3.73603 0.153
NP_440558.1_2 Forward -178 -159 -2.36049 0.226
NP_440111.2_2 Reverse -142 -161 1.76941 0.201
NP_440111.2_2 Reverse -294 -313 0.58944 0.21
NP_440274.1_4 Reverse -141 -159 11.4255 0.157
NP_441518.1_3 Forward -87 -68 -4.81876 0.121
NP_441878.1_6 Forward -78 -68 10.4031 0.0176
NP_441878.1_6 Reverse -67 -77 10.4031 0.0176
NP_441878.1_6 Reverse -135 -145 -7.88644 0.278
NP_441878.1_6 Reverse -304 -314 -7.98478 0.285
NP_441036.1_8 Forward -78 -68 8.33817 0.174
NP_441036.1_8 Reverse -67 -77 8.33817 0.174
NP_441036.1_8 Reverse -300 -310 6.76487 0.215
NP_441557.1_5 Forward -77 -68 19.9609 0.000699
NP_441557.1_5 Reverse -68 -77 19.9609 0.000699
NP_441445.1_1 Forward -86 -67 13.3725 0.0607
NP_441445.1_1 Forward -323 -304 -0.39387 0.291
NP_441445.1_8 Reverse -232 -251 -5.9004 0.277
NP_441590.1_4 Forward -254 -235 11.7 0.249
NP_442066.2_9 Reverse -64 -77 11.1307 0.154
NP_441308.1_8 Forward -381 -371 10.1081 0.22
NP_441458.1_10 Reverse -59 -78 4.81767 0.226
NP_442183.1_1 Reverse -68 -82 14.3559 0.0336
NP_442183.1_1 Forward -77 -63 11.5043 0.0702
NP_442397.1_9 Forward -77 -58 4.22769 0.254
NP_441819.1_5 Reverse -329 -348 9.88299 0.261
NP_442347.1_2 Forward -76 -67 12.4878 0.056
NP_442347.1_2 Reverse -69 -78 12.4878 0.056
NP_442347.1_2 Reverse -133 -142 3.44131 0.284
NP_442645.1_2 Forward -85 -66 5.11266 0.0216
NP_442965.1_8 Reverse -40 -59 15.4374 0.24
NP_441037.1_4 Reverse -66 -76 7.9999 0.237
NP_442317.1_6 Reverse -63 -82 4.12936 0.247
NP_441633.1_3 Reverse -66 -79 1.10092 0.109
NP_441633.1_3 Forward -316 -303 -4.01229 0.179
NP_441633.1_3 Forward -79 -66 -5.97891 0.236
NP_442764.1_8 Forward -185 -166 5.50599 0.241
NP_442764.1_8 Forward -306 -287 2.16274 0.291
NP_440136.1_2 Forward -76 -69 15.9687 0.0123
NP_440136.1_2 Reverse -69 -76 15.9687 0.0123
NP_442590.1_10 Reverse -132 -151 4.62101 0.273
NP_442590.1_10 Forward -165 -146 4.32602 0.276
NP_442590.1_10 Reverse -153 -172 3.24438 0.294
NP_442998.1_10 Forward -75 -68 15.5754 0.0102
NP_442998.1_10 Reverse -70 -77 15.5754 0.0102
NP_442998.1_10 Reverse -155 -162 5.74231 0.255
NP_440299.1_1 Reverse -64 -77 12.9984 0.0319
NP_440299.1_1 Forward -81 -68 4.44361 0.207
NP_441799.1_1 Reverse -64 -78 15.8302 0.0163
NP_441799.1_1 Forward -81 -67 10.0287 0.0797
NP_441007.1_10 Reverse -63 -76 8.27909 0.115
NP_441007.1_10 Forward -82 -69 2.77255 0.183
NP_441007.1_10 Reverse -365 -378 -0.570702 0.287
NP_442201.1_10 Reverse -226 -245 -9.047 0.236
NP_440256.1_1 Reverse -65 -84 3.93269 0.0488
NP_440256.1_1 Forward -80 -61 -3.14714 0.127
NP_441866.1_6 Reverse -223 -242 9.34008 0.248
NP_441704.1_8 Forward -88 -69 12.29 0.122
NP_441838.1_1 Reverse -320 -339 21.3373 0.0189
NP_440695.1_5 Reverse -68 -87 -1.37718 0.284
NP_441199.1_6 Forward -323 -304 1.86774 0.207
NP_441417.1_8 Forward -214 -195 11.6025 0.282
NP_442993.1_1 Reverse -68 -84 0.156866 0.0653
NP_442386.1_9 Reverse -67 -76 13.8639 0.0289
NP_442386.1_9 Forward -78 -69 13.8639 0.0289
NP_440570.1_5 Forward -93 -74 5.211 0.204
NP_441340.1_5 Forward -76 -69 15.6737 0.0124
NP_441340.1_5 Reverse -69 -76 15.6737 0.0124
NP_440586.1_8 Forward -76 -69 13.2151 0.026
NP_440586.1_8 Reverse -69 -76 13.2151 0.026
NP_440586.1_8 Reverse -371 -378 9.3802 0.156
NP_442251.1_6 Forward -76 -69 15.2804 0.0124
NP_442251.1_6 Reverse -69 -76 15.2804 0.0124
NP_442251.1_6 Forward -266 -259 7.11894 0.274
NP_440684.1_3 Forward -349 -330 13.9625 0.29
NP_440684.1_9 Reverse -62 -76 12.586 0.168
NP_441262.1_3 Reverse -68 -75 14.7888 0.0223
NP_441262.1_3 Forward -77 -70 14.7888 0.0223
NP_441262.1_3 Reverse -370 -377 5.15232 0.265
NP_443051.1_1 Reverse -67 -76 10.4228 0.00754
NP_443051.1_1 Forward -78 -69 10.4228 0.00754
NP_440408.1_3 Forward -186 -167 -2.95047 0.257
NP_440626.1_1 Forward -76 -57 8.4551 0.299
NP_440439.1_1 Reverse -298 -311 -1.65234 0.275
NP_439943.1_4 Reverse -153 -172 4.916 0.287
NP_440372.1_2 Forward -76 -69 16.3621 0.0124
NP_440372.1_2 Reverse -69 -76 16.3621 0.0124
NP_442384.1_10 Forward -77 -64 15.8506 0.00946
NP_442384.1_10 Reverse -68 -81 1.10092 0.268
NP_441018.1_7 Reverse -64 -83 12.2908 0.163
NP_442790.1_4 Reverse -59 -78 -8.26035 0.166
NP_442262.1_10 Forward -76 -69 14.1988 0.0123
NP_442262.1_10 Reverse -69 -76 14.1988 0.0123
NP_441689.1_5 Forward -79 -69 15.3192 0.0403
NP_441689.1_5 Reverse -66 -76 5.78111 0.197
NP_440163.1_10 Reverse -241 -251 12.0747 0.169
NP_440163.1_10 Forward -80 -70 11.3864 0.169
NP_440163.1_10 Reverse -147 -157 10.2065 0.203
NP_440344.1_10 Forward -84 -67 3.0871 0.0274
NP_440344.1_10 Reverse -61 -78 -2.02611 0.06
NP_440344.1_10 Reverse -146 -163 -5.1727 0.104
NP_440234.1_3 Reverse -346 -365 15.3391 0.176
NP_442123.1_3 Reverse -136 -155 10.0292 0.294
NP_441965.1_3 Reverse -58 -77 0.58944 0.233
NP_441965.1_3 Reverse -143 -162 -1.08219 0.279
NP_441965.1_10 Forward -80 -64 10.3833 0.107
NP_440297.1_9 Reverse -69 -79 9.32148 0.0917
NP_440297.1_9 Forward -76 -66 -0.118297 0.282
NP_442280.1_10 Reverse -277 -295 5.64923 0.283
NP_440990.1_7 Reverse -56 -75 6.19431 0.248
NP_441679.1_6 Reverse -63 -82 8.75091 0.09
NP_440999.1_2 Reverse -160 -179 8.65258 0.288
NP_440999.1_9 Forward -318 -304 -2.16369 0.261
NP_440999.1_9 Forward -184 -170 -3.54032 0.296
NP_440888.1_2 Reverse -68 -82 16.3219 0.00724
NP_440888.1_2 Forward -77 -63 7.07881 0.208
NP_440600.1_4 Reverse -60 -78 -1.25915 0.163
NP_442948.1_2 Forward -99 -80 11.7992 0.128
NP_441543.1_2 Forward -76 -67 16.9127 0.00359
NP_441543.1_2 Reverse -69 -78 16.9127 0.00359
NP_442845.1_2 Reverse -62 -76 13.2743 0.0955
NP_442845.1_2 Forward -83 -69 6.78443 0.202
NP_441469.1_8 Forward -78 -69 6.48957 0.227
NP_441469.1_8 Reverse -67 -76 6.48957 0.227
NP_443064.1_6 Forward -77 -67 12.5669 0.0796
NP_443064.1_6 Reverse -68 -78 12.5669 0.0796
NP_443064.1_6 Forward -267 -257 8.88251 0.262
NP_442578.1_7 Forward -76 -69 14.5921 0.026
NP_442578.1_7 Reverse -69 -76 14.5921 0.026
NP_441462.1_2 Forward -77 -67 11.5831 0.00406
NP_441462.1_2 Reverse -68 -78 11.5831 0.00406
NP_441462.1_2 Forward -162 -152 -1.29827 0.299
NP_443062.1_1 Reverse -68 -86 14.8839 0.0427
NP_443062.1_1 Reverse -153 -171 3.47554 0.297
NP_440516.1_8 Forward -77 -68 16.9127 0.00442
NP_440516.1_8 Reverse -68 -77 16.9127 0.00442
NP_440516.1_8 Forward -162 -153 8.25953 0.0391
NP_441785.1_1 Reverse -68 -82 13.2231 0.231
NP_442428.1_5 Forward -76 -69 15.8704 0.0124
NP_442428.1_5 Reverse -69 -76 15.8704 0.0124
NP_441032.1_5 Reverse -144 -163 19.9606 0.0349
NP_441443.1_7 Reverse -235 -254 -2.26216 0.268
NP_442120.1_10 Reverse -68 -87 -9.53865 0.243
NP_440673.1_2 Reverse -58 -77 14.4868 0.0986
NP_440673.1_3 Forward -75 -68 12.4288 0.0426
NP_440673.1_3 Reverse -70 -77 12.4288 0.0426
NP_440673.1_3 Forward -312 -305 9.38056 0.192
NP_441052.1_2 Forward -77 -67 19.9412 0.00106
NP_441052.1_2 Reverse -68 -78 19.9412 0.00106
NP_441052.1_2 Reverse -153 -163 1.16001 0.25
NP_442219.1_8 Reverse -149 -168 15.7045 0.103
NP_442219.1_8 Forward -87 -68 7.10414 0.277
NP_442219.1_9 Forward -76 -67 17.7976 0.00718
NP_442219.1_9 Reverse -69 -78 17.7976 0.00718
NP_440436.1_4 Forward -76 -67 17.2072 0.00233
NP_440436.1_4 Reverse -69 -78 17.2072 0.00233
NP_440436.1_4 Reverse -154 -163 10.7174 0.0743
NP_440436.1_4 Forward -44 -35 6.09583 0.172
NP_441884.1_8 Reverse -304 -323 -8.65367 0.262
NP_441884.1_9 Forward -165 -146 -13.2752 0.138
NP_441884.1_9 Forward -80 -61 -15.5368 0.138
NP_441884.1_9 Reverse -148 -167 -23.4033 0.284
NP_440314.1_9 Forward -76 -57 1.17943 0.0933
NP_441719.1_2 Reverse -65 -79 13.925 0.278
NP_441719.1_4 Forward -76 -69 16.3621 0.0124
NP_441719.1_4 Reverse -69 -76 16.3621 0.0124
NP_441004.1_1 Reverse -232 -251 -5.50708 0.176
NP_441004.1_1 Forward -232 -213 -11.1119 0.234
NP_441004.1_2 Reverse -227 -246 9.53756 0.147
NP_441004.1_4 Reverse -235 -245 9.41981 0.259
NP_441004.1_5 Reverse -234 -248 10.3243 0.248
NP_442366.1_5 Reverse -65 -75 15.4175 0.0374
NP_442206.1_10 Forward -77 -62 4.30646 0.178
NP_443054.1_2 Forward -79 -65 1.57289 0.245
NP_440864.1_3 Reverse -141 -160 8.45592 0.297
NP_441851.1_10 Forward -78 -68 15.8113 0.00552
NP_441851.1_10 Reverse -67 -77 15.8113 0.00552
NP_441668.1_4 Reverse -58 -77 0.884433 0.229
NP_442515.1_1 Forward -78 -64 13.3726 0.0278
NP_442515.1_1 Reverse -67 -81 9.43936 0.0629
NP_440593.1_3 Forward -150 -131 -2.26216 0.224
NP_440593.1_3 Forward -167 -148 -5.80207 0.266
NP_440165.1_5 Reverse -369 -388 -4.03212 0.22
NP_441349.1_10 Forward -87 -68 6.4893 0.0358
NP_441349.1_10 Reverse -58 -77 3.04771 0.0704
NP_441349.1_10 Reverse -248 -267 -5.11376 0.192
NP_441409.1_6 Reverse -62 -81 0.687771 0.0648
NP_440432.1_9 Forward -76 -61 -1.98672 0.167
NP_439960.1_10 Forward -306 -288 -2.53746 0.255
NP_442450.1_5 Reverse -130 -140 12.0747 0.115
NP_442450.1_5 Forward -79 -69 9.32148 0.115
NP_442450.1_5 Reverse -66 -76 7.55152 0.13
NP_440588.1_2 Reverse -249 -268 2.85105 0.112
NP_440588.1_2 Reverse -59 -78 -2.95047 0.174
NP_440588.1_2 Forward -150 -131 -3.3438 0.185
NP_442006.1_2 Forward -154 -137 -14.4158 0.203
NP_442006.1_2 Reverse -151 -168 -16.9724 0.267
NP_442006.1_2 Reverse -296 -313 -18.4474 0.291
NP_441570.1_1 Reverse -68 -86 9.0656 0.0123
NP_441570.1_1 Forward -162 -144 -7.06068 0.0841
NP_441570.1_1 Reverse -370 -388 -12.4689 0.214
NP_441078.1_4 Forward -77 -68 19.6659 0.0007
NP_441078.1_4 Reverse -68 -77 19.6659 0.0007
NP_442729.1_8 Reverse -64 -77 10.639 0.125
NP_440707.1_9 Forward -152 -133 -0.000545616 0.293
NP_440526.1_3 Reverse -69 -80 10.1862 0.0646
NP_440526.1_3 Reverse -154 -165 5.85971 0.229
NP_440526.1_3 Forward -76 -65 1.04151 0.267
NP_441432.1_8 Reverse -67 -76 16.8143 0.00595
NP_441432.1_8 Forward -78 -69 16.8143 0.00595
NP_442320.1_8 Forward -83 -69 13.9626 0.0144
NP_442320.1_8 Reverse -62 -76 4.62115 0.0472
NP_442320.1_8 Forward -168 -154 -5.80194 0.249
NP_442344.1_7 Reverse -69 -88 9.43923 0.0407
NP_441732.1_2 Forward -81 -65 -16.4611 0.167
NP_441732.1_2 Reverse -64 -80 -16.8544 0.207
NP_440497.1_2 Forward -161 -142 4.62101 0.287
NP_440629.1_4 Forward -186 -167 9.93088 0.244
NP_440760.1_1 Forward -77 -58 -7.4737 0.0704
NP_440760.1_1 Reverse -68 -87 -10.817 0.0847
NP_442797.1_1 Reverse -137 -156 2.45773 0.212
NP_440199.1_10 Forward -80 -70 16.7946 0.0381
NP_441057.1_4 Forward -163 -145 9.45892 0.141
NP_442489.1_2 Forward -88 -69 11.6025 0.151
NP_442489.1_7 Forward -77 -68 20.1576 0.000695
NP_442489.1_7 Reverse -68 -77 20.1576 0.000695
NP_442079.1_7 Forward -76 -57 0.392778 0.286
NP_440559.1_1 Forward -76 -67 17.4043 0.00658
NP_440559.1_1 Reverse -69 -78 17.4043 0.00658
NP_440559.1_1 Reverse -154 -163 4.71961 0.217
NP_441659.2_8 Forward -77 -67 18.1713 0.00133
NP_441659.2_8 Reverse -68 -78 18.1713 0.00133
NP_442913.1_10 Forward -86 -67 9.0459 0.0462
NP_441040.1_2 Reverse -221 -240 -9.73531 0.238
NP_442346.1_5 Forward -78 -68 16.6963 0.00248
NP_442346.1_5 Reverse -67 -77 16.6963 0.00248
NP_440545.1_3 Forward -260 -243 -2.61609 0.189
NP_440545.1_3 Reverse -301 -318 -3.10775 0.199
NP_440831.1_1 Forward -252 -233 9.73422 0.288
NP_441786.1_10 Forward -86 -67 11.5042 0.157
NP_440486.1_6 Forward -233 -214 6.09597 0.283
NP_440486.1_6 Reverse -245 -264 5.30933 0.298
NP_440010.1_4 Reverse -143 -162 3.53858 0.22
NP_440010.1_10 Forward -165 -146 11.1109 0.209
NP_442603.1_7 Forward -77 -63 7.17714 0.211
NP_440170.1_2 Forward -168 -149 6.68596 0.296
NP_441833.1_4 Forward -76 -69 15.9687 0.0124
NP_441833.1_4 Reverse -69 -76 15.9687 0.0124
NP_441833.1_4 Forward -378 -371 4.46401 0.256
NP_442162.1_9 Forward -76 -69 16.2637 0.0124
NP_442162.1_9 Reverse -69 -76 16.2637 0.0124
NP_440671.1_4 Forward -83 -69 15.3392 0.0454
NP_441044.1_4 Forward -340 -322 7.88563 0.223
NP_442199.1_5 Forward -85 -66 -2.45882 0.185
NP_442140.1_3 Forward -76 -66 12.2714 0.0632
NP_442140.1_3 Forward -161 -151 5.68323 0.198
NP_442140.1_3 Reverse -69 -79 4.40493 0.243
NP_442021.1_3 Reverse -270 -289 -6.58872 0.257
NP_441671.1_1 Forward -156 -137 5.70265 0.263
NP_441813.1_5 Forward -79 -69 15.9097 0.01
NP_441813.1_5 Reverse -66 -76 8.63316 0.0367
NP_440590.1_4 Reverse -154 -167 7.29578 0.0533
NP_440590.1_4 Reverse -69 -82 2.57589 0.0845
NP_440590.1_4 Forward -76 -63 0.805932 0.143
NP_440567.1_1 Forward -76 -62 11.406 0.0286
NP_440567.1_1 Reverse -69 -83 -0.0987402 0.264
NP_442497.1_10 Forward -76 -67 10.4228 0.0087
NP_442497.1_10 Reverse -69 -78 10.4228 0.0087
NP_440821.1_4 Forward -79 -69 18.2696 0.00448
NP_440821.1_4 Reverse -66 -76 9.41981 0.0286
NP_440227.1_10 Forward -83 -64 11.995 0.212
NP_441239.1_9 Forward -316 -304 9.28209 0.11
NP_441239.1_9 Forward -79 -67 4.36554 0.253
NP_441239.1_9 Reverse -66 -78 3.38223 0.285
NP_441727.1_3 Reverse -61 -80 10.8159 0.161
NP_441892.1_1 Reverse -144 -161 0.0388413 0.176
NP_441892.1_1 Forward -86 -69 -1.92778 0.215
NP_441017.1_6 Forward -81 -67 14.1586 0.157
NP_440354.1_7 Forward -151 -133 7.29564 0.269
NP_442138.1_3 Forward -146 -127 15.2408 0.166
NP_442052.1_8 Reverse -134 -144 12.3697 0.271
NP_440546.1_4 Forward -77 -67 10.046 0.109
NP_440546.1_4 Reverse -68 -78 10.046 0.109
NP_440024.1_8 Reverse -274 -293 22.2214 0.0736
NP_441603.1_8 Forward -327 -308 24.5813 0.00435
NP_440462.1_6 Forward -79 -69 7.74818 0.0699
NP_440462.1_6 Reverse -66 -76 1.35667 0.294
NP_440868.1_4 Reverse -64 -76 8.10212 0.0602
NP_440868.1_4 Forward -81 -69 5.93884 0.0879
NP_440868.1_4 Forward -145 -133 -0.649339 0.28
NP_442402.1_4 Forward -241 -222 -8.75273 0.284
NP_440696.1_9 Reverse -243 -262 16.3215 0.296
NP_441843.2_9 Reverse -70 -88 13.3126 0.205
NP_442039.1_4 Forward -76 -69 15.1821 0.0124
NP_442039.1_4 Reverse -69 -76 15.1821 0.0124
NP_442380.1_6 Forward -245 -226 19.1731 0.228
NP_442380.1_10 Forward -163 -145 9.45892 0.262
NP_442829.1_2 Reverse -206 -222 9.20406 0.287
NP_440825.1_7 Forward -76 -66 12.9096 0.152
NP_442837.1_3 Forward -76 -69 15.7721 0.0124
NP_442837.1_3 Reverse -69 -76 15.7721 0.0124
NP_442053.1_1 Forward -77 -68 18.3876 0.0007
NP_442053.1_1 Reverse -68 -77 18.3876 0.0007
NP_440505.1_3 Forward -79 -69 16.303 0.00696
NP_440505.1_3 Reverse -66 -76 9.22315 0.122
NP_440505.1_3 Reverse -242 -252 5.68323 0.217
NP_441252.1_6 Forward -345 -338 14.1004 0.25
NP_442532.1_7 Forward -379 -365 7.57108 0.171
NP_442532.1_7 Reverse -305 -319 3.14618 0.206
NP_442532.1_7 Forward -162 -148 2.85119 0.22
NP_442532.1_7 Forward -192 -178 2.2612 0.25
NP_440914.1_1 Forward -77 -67 17.5935 0.000537
NP_440914.1_1 Reverse -68 -78 17.5935 0.000537
NP_441011.1_8 Forward -76 -67 8.25953 0.144
NP_441011.1_8 Reverse -69 -78 8.25953 0.144
NP_442533.1_1 Reverse -255 -274 -15.4385 0.254
NP_442533.1_6 Forward -77 -68 17.2076 0.00137
NP_442533.1_6 Reverse -68 -77 17.2076 0.00137
NP_442533.1_6 Forward -145 -136 3.04799 0.228
NP_442232.1_3 Reverse -297 -316 -12.8819 0.282
NP_441482.1_7 Forward -83 -69 0.491246 0.0558
NP_439944.1_9 Reverse -69 -79 19.0562 0.00329
NP_439944.1_9 Forward -76 -66 10.5014 0.0887
NP_441697.1_5 Forward -223 -204 -11.4117 0.295
NP_440116.1_8 Reverse -154 -173 -2.75381 0.139
NP_440116.1_8 Reverse -69 -88 -7.96535 0.242
NP_440115.1_6 Reverse -302 -312 5.68323 0.227
NP_440007.1_9 Forward -383 -369 1.17956 0.29
NP_440007.1_9 Forward -81 -67 0.88457 0.29
NP_441680.1_4 Reverse -145 -164 -3.54046 0.299
NP_441059.1_2 Reverse -226 -245 -6.29373 0.265
NP_440608.1_6 Forward -76 -57 3.34192 0.29
NP_441972.1_5 Reverse -288 -307 -1.57384 0.177
NP_441972.1_5 Reverse -154 -173 -4.72043 0.211
NP_441972.1_5 Forward -76 -57 -4.72043 0.211
NP_441106.1_1 Forward -78 -69 9.63616 0.0311
NP_441106.1_1 Reverse -67 -76 9.63616 0.0311
NP_439903.1_6 Forward -382 -363 4.52188 0.193
NP_439903.1_6 Forward -80 -61 0.195343 0.268
NP_440797.1_2 Forward -88 -69 21.7254 0.0269
NP_441286.1_1 Reverse -67 -79 21.3768 0.00196
NP_441286.1_1 Forward -78 -66 12.9203 0.00815
NP_441286.1_1 Forward -163 -151 10.9537 0.0145
NP_440670.1_8 Forward -77 -68 18.3876 0.000699
NP_440670.1_8 Reverse -68 -77 18.3876 0.000699
NP_440886.1_7 Forward -78 -68 7.94438 0.0805
NP_440886.1_7 Reverse -67 -77 7.94438 0.0805
NP_440907.2_8 Forward -76 -66 7.64939 0.117
NP_440841.1_4 Forward -79 -60 0.687771 0.119
NP_440841.1_4 Forward -287 -268 -8.752 0.25
NP_441463.1_3 Forward -87 -68 8.35759 0.0487
NP_441463.1_6 Forward -79 -65 8.0587 0.25
NP_441626.1_2 Forward -76 -69 15.7721 0.0124
NP_441626.1_2 Reverse -69 -76 15.7721 0.0124
NP_442794.1_1 Reverse -64 -76 9.28209 0.0795
NP_442794.1_1 Forward -383 -371 5.44718 0.221
NP_442615.1_1 Reverse -59 -77 4.24738 0.048
NP_442615.1_1 Forward -86 -68 -2.93078 0.153
NP_441962.1_4 Forward -82 -63 0.58944 0.111
NP_441962.1_4 Reverse -139 -158 -8.26035 0.198
NP_441962.1_4 Reverse -69 -88 -13.7669 0.277
NP_440387.1_1 Forward -77 -61 5.17175 0.0343
NP_440387.1_1 Reverse -68 -84 -4.66135 0.194
NP_440855.1_2 Forward -263 -244 17.5015 0.241
NP_441488.1_8 Forward -167 -153 10.6187 0.146
NP_441993.1_1 Reverse -68 -87 0.777198 0.292
NP_441174.1_1 Reverse -236 -251 10.8946 0.262
NP_440358.1_8 Forward -219 -200 -0.0988766 0.263
NP_440467.1_3 Reverse -154 -173 11.2562 0.281
NP_440114.1_10 Reverse -68 -82 12.291 0.0866
NP_442323.1_7 Forward -384 -365 1.86696 0.276
NP_442323.1_7 Forward -100 -81 1.47364 0.279
NP_441510.2_6 Forward -87 -68 11.8967 0.298
NP_440293.1_10 Reverse -235 -254 -2.95047 0.278
NP_440766.1_5 Forward -390 -378 6.70087 0.294
NP_439988.1_7 Reverse -138 -152 18.8785 0.292
NP_441237.1_9 Forward -76 -66 14.828 0.0242
NP_441246.1_9 Reverse -232 -249 3.28376 0.24
NP_439910.1_2 Forward -85 -68 -13.6292 0.162
NP_440457.1_1 Reverse -301 -313 9.57708 0.092
NP_440457.1_1 Forward -149 -137 5.34885 0.141
NP_440457.1_1 Forward -81 -69 0.0389777 0.25
NP_440457.1_1 Reverse -264 -276 -1.23932 0.3
NP_441436.1_2 Reverse -168 -187 -7.08038 0.297
NP_442509.1_9 Forward -77 -67 8.14104 0.192
NP_442509.1_9 Reverse -68 -78 8.14104 0.192
NP_442509.1_9 Forward -162 -152 6.17443 0.286
NP_442439.1_8 Forward -303 -284 14.1591 0.153
NP_442514.1_5 Reverse -136 -155 -9.34271 0.295
NP_440554.1_4 Reverse -69 -79 7.05986 0.106
NP_442862.1_3 Forward -336 -319 6.33202 0.267
NP_442737.1_5 Reverse -152 -171 11.1337 0.294
NP_441885.1_5 Forward -77 -67 20.9245 0.000538
NP_441885.1_5 Reverse -68 -78 20.9245 0.000538
NP_442341.1_7 Forward -78 -64 13.6676 0.0334
NP_442341.1_7 Reverse -67 -81 8.35772 0.0881
NP_442341.1_9 Reverse -66 -80 8.65209 0.166
NP_441173.1_9 Reverse -336 -344 9.85212 0.275
NP_440423.1_6 Forward -85 -66 -16.0285 0.229
NP_443000.1_7 Forward -79 -69 17.0896 0.00865
NP_443000.1_7 Reverse -66 -76 10.3048 0.0345
NP_440507.2_3 Forward -86 -67 15.0432 0.106
NP_443059.1_10 Reverse -145 -164 -0.984623 0.296
NP_442513.1_5 Forward -85 -66 10.2251 0.266
NP_441842.1_10 Reverse -61 -75 7.86607 0.241
NP_440275.1_3 Forward -79 -69 8.1415 0.0602
NP_440275.1_3 Reverse -66 -76 8.04317 0.0602
NP_440091.1_1 Forward -81 -69 16.4603 0.0153
NP_443060.1_2 Forward -87 -68 4.52268 0.183
NP_443060.1_5 Reverse -60 -79 6.78348 0.235
NP_442451.1_2 Forward -85 -66 -11.2103 0.287
NP_441207.1_4 Forward -214 -195 6.09597 0.214
NP_440149.1_8 Reverse -68 -87 1.96607 0.116
NP_440149.1_8 Forward -77 -58 -2.55715 0.172
NP_441105.1_3 Reverse -63 -82 -4.42544 0.2
NP_440216.1_1 Reverse -68 -82 -1.8687 0.0412
NP_440216.1_1 Forward -77 -63 -10.6202 0.145
NP_440216.1_9 Forward -294 -285 14.651 0.172
NP_440172.1_1 Forward -77 -67 15.0247 0.00945
NP_440172.1_1 Reverse -68 -78 15.0247 0.00945
NP_442015.1_10 Reverse -64 -77 1.39592 0.204
NP_442015.1_10 Forward -81 -68 0.60927 0.221
NP_442015.1_10 Forward -152 -139 0.412608 0.227
NP_441226.1_7 Forward -76 -69 14.4934 0.0123
NP_441226.1_7 Reverse -69 -76 14.4934 0.0123
NP_441111.1_7 Forward -76 -68 18.7023 0.00294
NP_441111.1_7 Reverse -69 -77 18.7023 0.00294
NP_441766.1_2 Forward -77 -68 17.5026 0.00297
NP_441766.1_2 Reverse -68 -77 17.5026 0.00297
NP_440416.1_1 Reverse -68 -87 -2.36049 0.116
NP_440416.1_1 Forward -128 -109 -13.3736 0.281
NP_443052.1_8 Forward -87 -68 -9.83364 0.197
NP_443052.1_9 Reverse -134 -153 -5.31042 0.266
NP_442154.1_1 Reverse -253 -271 -18.5654 0.282
NP_440261.1_5 Forward -76 -63 -10.3055 0.201
NP_440261.1_5 Reverse -137 -150 -12.2721 0.277
NP_440988.1_7 Reverse -240 -259 -2.16383 0.281
NP_440988.1_10 Forward -79 -65 8.28727 0.205
NP_440988.1_10 Reverse -142 -156 4.99564 0.247
NP_440988.1_10 Forward -155 -141 4.89883 0.249
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AGAGATATTCTGGCGCACCAATATGATCGCATTAACCTTAATACTCTTTGGGATGTTGTGCAAAAAGATGTTCCCGAACTAGAGGCTCTCATCGCCCCCCTTGTGTCCAATGCAAAGCAATAAGCAGATCCACCTCGATTACCATGCCACAACCCCCGTTGACCCAAGGGTTACCGAAAAGGTTGTGGAATTTATGACGACGCAGTTTGGTAATGCCAGCAGTGTTGACCATTCCATTGACGATCGTGCCCGTGGGGCCGTCGATCAAGCTAAACAGTCGGTTGTTTACCAACGTTTTAACCGCAGACCAACTTCGTAGAAATGGCGATCGCCAAAATAGAACCGTAAAGCGTTTAACGCTCCTCGTTATATACTGGATTTAGTCCACTTATTTTCCCCT

CDS

GTGATTCGTAACTTTAAAGATAAAGAAGCTCAAAAAATCTTTGAACGACAACGCTCCCGCAAACTGCCTGGCGACATCCAACAAGTTGCCCTCAGAAAGCTCCGAATGCTAAACCGAGCCGAGACATTACAAGACCTTAAAGTTCCCCCAGCTAATCGATTAGAAGCTTTGAAAGGCGATCGCCAAGGACAATATAGCATTCGCATTAATGCCCAATGGCGTATCTGTTTCCAATGGGAGAACGGAGAAGCCCTCGACGTAGAAATTATTGACTACCATTAA

Protein

No sequence available