Your browser is old and dusty. Try Google Chrome!

Details for ssr5009

ORF ssr5009
Accession NP_942165.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -257 -250 5.74231 0.279
NP_440795.1_7 Forward -50 -43 5.74231 0.279
NP_441418.1_6 Forward -124 -105 -29.2048 0.219
NP_440815.1_2 Reverse -127 -141 10.5204 0.265
NP_442291.1_5 Reverse -248 -264 4.3851 0.093
NP_441453.1_4 Reverse -249 -257 6.90259 0.121
NP_441453.1_4 Reverse -42 -50 6.90259 0.121
NP_441453.1_4 Forward -258 -250 6.70593 0.121
NP_441818.1_1 Reverse -250 -261 15.2011 0.0343
NP_441818.1_9 Forward -211 -192 4.22769 0.169
NP_440226.1_1 Forward -258 -239 10.9142 0.0579
NP_440226.1_1 Reverse -42 -61 3.53937 0.221
NP_440259.1_4 Reverse -53 -67 9.11791 0.281
NP_442173.1_1 Reverse -250 -258 11.7208 0.034
NP_442173.1_1 Forward -257 -249 7.49257 0.171
NP_442173.1_1 Forward -50 -42 7.49257 0.171
NP_442173.1_1 Reverse -43 -51 4.54265 0.27
NP_442752.1_4 Forward -367 -360 9.18389 0.116
NP_443027.1_4 Forward -260 -250 11.0914 0.107
NP_443027.1_4 Reverse -113 -123 8.4365 0.202
NP_443027.1_4 Forward -53 -43 6.8632 0.262
NP_441812.1_3 Reverse -285 -299 7.07942 0.287
NP_440784.1_7 Reverse -250 -257 6.43063 0.218
NP_440784.1_7 Reverse -43 -50 6.43063 0.218
NP_440784.1_7 Forward -257 -250 6.23397 0.241
NP_440784.1_7 Forward -50 -43 6.23397 0.241
NP_442861.1_1 Reverse -232 -251 11.8975 0.277
NP_440061.1_9 Forward -260 -246 9.14375 0.151
NP_442062.1_8 Forward -258 -248 7.25653 0.104
NP_442062.1_8 Reverse -249 -259 5.28991 0.176
NP_441859.1_3 Reverse -193 -212 1.27698 0.29
NP_442242.1_4 Reverse -250 -257 13.3138 0.027
NP_442242.1_4 Reverse -43 -50 13.3138 0.027
NP_440044.1_8 Reverse -250 -269 6.78429 0.0881
NP_439918.1_2 Forward -102 -83 -4.42544 0.277
NP_441208.1_9 Reverse -181 -195 7.27608 0.223
NP_440370.1_10 Reverse -33 -52 10.0292 0.211
NP_441925.1_5 Forward -281 -267 19.8624 0.0337
NP_441083.1_5 Reverse -249 -259 8.23984 0.0429
NP_441083.1_5 Forward -258 -248 1.16001 0.215
NP_441083.1_5 Forward -51 -41 -1.10161 0.295
NP_441738.1_2 Reverse -251 -258 13.3134 0.0335
NP_441738.1_2 Forward -122 -115 6.03696 0.295
NP_441558.1_5 Reverse -40 -59 5.89931 0.236
NP_440209.1_1 Forward -258 -250 8.27922 0.0687
NP_440209.1_1 Forward -51 -43 5.32929 0.139
NP_440178.1_7 Reverse -48 -67 -23.01 0.287
NP_442445.1_2 Forward -325 -306 8.45592 0.288
NP_441533.1_1 Reverse -301 -320 12.5858 0.252
NP_440906.1_5 Reverse -250 -257 6.52896 0.199
NP_440906.1_5 Reverse -43 -50 6.52896 0.199
NP_440906.1_5 Forward -257 -250 6.0373 0.262
NP_440906.1_5 Forward -50 -43 6.0373 0.262
NP_440747.1_10 Forward -261 -249 -2.81262 0.0713
NP_440747.1_10 Reverse -246 -258 -11.9574 0.178
NP_441130.1_10 Forward -53 -39 10.521 0.112
NP_441486.1_1 Forward -261 -247 -3.04867 0.175
NP_441486.1_1 Reverse -246 -260 -5.11362 0.222
NP_442634.1_4 Forward -260 -246 -4.52363 0.206
NP_442848.1_1 Reverse -36 -50 1.08123 0.25
NP_442848.1_1 Forward -57 -43 -1.47537 0.263
NP_442848.1_5 Reverse -199 -217 -3.6191 0.294
NP_443018.1_3 Reverse -195 -202 9.38056 0.128
NP_443018.1_3 Reverse -250 -257 5.15232 0.226
NP_443018.1_3 Reverse -43 -50 5.15232 0.226
NP_443018.1_3 Forward -257 -250 5.05399 0.238
NP_443018.1_3 Forward -50 -43 5.05399 0.238
NP_441634.1_8 Forward -260 -246 -2.16369 0.295
NP_440376.1_1 Reverse -249 -258 0.196389 0.283
NP_440376.1_1 Forward -258 -249 -0.196935 0.285
NP_442191.1_4 Reverse -29 -43 13.7079 0.132
NP_441797.1_7 Forward -168 -150 20.3737 0.0631
NP_441846.1_10 Reverse -28 -47 -23.5016 0.289
NP_442530.1_2 Reverse -301 -311 11.2881 0.284
NP_440642.1_10 Forward -166 -152 2.35894 0.277
NP_440642.1_10 Forward -139 -125 2.35894 0.277
NP_441013.1_2 Forward -42 -24 -4.8974 0.299
NP_440181.1_3 Reverse -155 -174 9.0459 0.225
NP_440887.1_8 Reverse -51 -65 16.2242 0.263
NP_442658.1_1 Reverse -40 -50 7.0594 0.214
NP_442658.1_1 Forward -53 -43 6.86274 0.214
NP_441855.2_4 Forward -307 -288 9.04103 0.291
NP_441487.1_9 Forward -58 -39 -3.04881 0.298
NP_442937.1_5 Forward -263 -244 8.94757 0.205
NP_441958.1_5 Forward -259 -249 1.16001 0.114
NP_441137.1_3 Forward -280 -261 11.3154 0.289
NP_442836.1_5 Reverse -243 -262 6.78429 0.171
NP_440203.1_5 Forward -190 -180 10.8943 0.209
NP_440984.1_7 Forward -200 -186 6.19444 0.224
NP_442690.1_1 Reverse -325 -344 -14.7502 0.273
NP_442690.1_1 Forward -286 -267 -16.0285 0.283
NP_442911.1_2 Reverse -239 -258 12.0942 0.0129
NP_440858.1_1 Reverse -226 -245 -5.80207 0.281
NP_442064.1_1 Forward -143 -124 -10.227 0.259
NP_443055.1_3 Forward -202 -183 11.3136 0.26
NP_440993.1_2 Reverse -37 -53 10.9733 0.0866
NP_442438.1_10 Reverse -37 -51 2.06454 0.188
NP_442438.1_10 Reverse -244 -258 1.17956 0.204
NP_442431.1_10 Forward -214 -196 -0.964162 0.298
NP_441000.1_6 Forward -52 -38 -5.21195 0.266
NP_440484.1_1 Reverse -365 -384 8.65176 0.293
NP_440147.1_4 Forward -260 -247 12.999 0.0326
NP_440147.1_4 Reverse -96 -109 2.18257 0.209
NP_441550.1_8 Reverse -40 -50 5.58445 0.242
NP_441550.1_8 Forward -260 -250 5.28945 0.255
NP_441916.1_7 Reverse -249 -259 1.25834 0.289
NP_441041.1_7 Reverse -39 -51 8.00067 0.151
NP_441725.1_5 Forward -50 -40 -0.118297 0.232
NP_439966.1_4 Reverse -233 -252 6.58763 0.253
NP_439966.1_7 Forward -53 -43 8.53436 0.135
NP_439966.1_7 Forward -260 -250 5.68278 0.214
NP_439966.1_9 Forward -53 -44 9.83282 0.215
NP_442941.1_3 Reverse -250 -260 9.81313 0.0263
NP_442941.1_3 Forward -257 -247 -1.10161 0.284
NP_440289.1_2 Forward -54 -41 2.96921 0.0835
NP_440983.1_5 Reverse -187 -206 -8.16202 0.294
NP_441514.1_6 Reverse -160 -167 12.7238 0.29
NP_442281.1_1 Forward -263 -249 12.192 0.0396
NP_441079.1_7 Reverse -205 -224 -7.76943 0.298
NP_441457.1_7 Reverse -40 -59 3.14605 0.246
NP_441556.1_4 Forward -63 -44 10.1979 0.286
NP_441644.1_6 Reverse -194 -204 9.51767 0.0747
NP_441644.1_6 Reverse -249 -259 5.28945 0.199
NP_442215.1_2 Reverse -185 -201 -2.49807 0.198
NP_442177.1_5 Forward -112 -98 7.66941 0.293
NP_442247.1_8 Forward -260 -246 10.0294 0.247
NP_440253.1_2 Reverse -249 -267 3.85406 0.111
NP_442933.1_10 Reverse -249 -258 7.96454 0.0937
NP_442933.1_10 Forward -258 -249 7.76787 0.11
NP_441751.2_8 Reverse -43 -57 -4.13031 0.163
NP_441751.2_8 Reverse -250 -264 -5.50694 0.214
NP_442554.1_8 Reverse -250 -260 13.5497 0.018
NP_442554.1_8 Forward -202 -192 9.61647 0.0576
NP_442554.1_8 Reverse -43 -53 3.81494 0.209
NP_441762.1_7 Reverse -41 -53 15.0836 0.0142
NP_442292.1_1 Reverse -250 -259 16.421 0.00748
NP_442292.1_1 Forward -257 -248 -0.295266 0.24
NP_442476.1_6 Forward -50 -36 8.75105 0.098
NP_441715.1_4 Reverse -250 -260 16.1063 0.0144
NP_440379.1_5 Forward -212 -193 -10.522 0.28
NP_441468.1_1 Reverse -250 -257 13.0188 0.0383
NP_441468.1_1 Reverse -43 -50 13.0188 0.0383
NP_441468.1_1 Forward -257 -250 6.0373 0.223
NP_441468.1_1 Forward -50 -43 6.0373 0.223
NP_439939.1_4 Forward -148 -129 1.67108 0.199
NP_441673.1_1 Reverse -249 -258 1.37636 0.114
NP_441673.1_1 Forward -258 -249 1.1797 0.163
NP_441876.1_9 Forward -294 -284 11.6809 0.275
NP_441826.1_2 Forward -57 -43 7.37441 0.0899
NP_441826.1_2 Reverse -36 -50 0.589577 0.18
NP_442868.1_6 Forward -260 -250 9.61647 0.0429
NP_442050.1_5 Reverse -247 -257 12.1726 0.0699
NP_442050.1_5 Reverse -40 -50 11.4843 0.0959
NP_442342.1_9 Reverse -192 -208 7.72835 0.202
NP_440334.1_1 Reverse -216 -235 13.7982 0.298
NP_440630.1_7 Reverse -194 -213 -7.76869 0.287
NP_440346.1_6 Forward -290 -280 13.5642 0.291
NP_440558.1_2 Reverse -73 -92 -4.52377 0.246
NP_441878.1_6 Forward -204 -194 0.668351 0.139
NP_441100.1_1 Reverse -306 -325 11.7992 0.255
NP_441036.1_8 Reverse -248 -258 6.56821 0.225
NP_441036.1_8 Forward -87 -77 5.38824 0.287
NP_442650.1_2 Forward -124 -110 2.85119 0.24
NP_441557.1_5 Forward -258 -249 8.84951 0.0343
NP_441557.1_5 Reverse -249 -258 0.786375 0.106
NP_441557.1_5 Forward -51 -42 -0.68859 0.229
NP_442066.2_9 Forward -262 -249 6.90245 0.259
NP_442183.1_1 Reverse -42 -56 8.45605 0.115
NP_441116.1_1 Reverse -35 -54 11.7992 0.17
NP_442347.1_2 Forward -123 -114 6.19458 0.182
NP_442347.1_2 Forward -294 -285 5.99792 0.201
NP_442347.1_2 Reverse -250 -259 5.50626 0.229
NP_441633.1_3 Forward -260 -247 -6.17557 0.238
NP_440136.1_2 Reverse -250 -257 6.52896 0.116
NP_440136.1_2 Reverse -43 -50 6.52896 0.116
NP_440136.1_2 Forward -257 -250 6.13563 0.193
NP_440136.1_2 Forward -50 -43 6.13563 0.193
NP_442998.1_5 Reverse -134 -144 11.7798 0.176
NP_442998.1_5 Reverse -301 -311 11.3864 0.187
NP_442998.1_5 Reverse -167 -177 9.32148 0.243
NP_442998.1_10 Reverse -251 -258 12.3305 0.0564
NP_440299.1_1 Reverse -111 -124 3.95196 0.224
NP_441799.1_1 Reverse -38 -52 13.8636 0.0293
NP_441799.1_1 Reverse -245 -259 13.077 0.0362
NP_442526.1_5 Forward -218 -200 15.358 0.275
NP_441559.1_8 Forward -42 -28 -6.98191 0.281
NP_442158.1_4 Forward -140 -130 12.3697 0.253
NP_440717.1_3 Forward -48 -34 9.34041 0.25
NP_441866.1_6 Forward -172 -153 6.48849 0.285
NP_440215.1_6 Forward -268 -249 16.9115 0.228
NP_442386.1_9 Reverse -193 -202 8.35743 0.201
NP_442386.1_9 Forward -52 -43 8.06244 0.209
NP_442386.1_9 Reverse -248 -257 5.50585 0.25
NP_441340.1_5 Reverse -250 -257 5.93897 0.198
NP_441340.1_5 Reverse -43 -50 5.93897 0.198
NP_441340.1_5 Forward -257 -250 5.84064 0.208
NP_441340.1_5 Forward -50 -43 5.84064 0.208
NP_441340.1_9 Reverse -273 -283 15.1001 0.194
NP_441340.1_9 Reverse -133 -143 8.15881 0.256
NP_442240.1_2 Forward -137 -118 -19.0768 0.295
NP_442251.1_6 Reverse -250 -257 13.0188 0.0408
NP_442251.1_6 Reverse -43 -50 13.0188 0.0408
NP_443051.1_1 Forward -259 -250 0.589713 0.143
NP_443051.1_1 Reverse -41 -50 -0.983583 0.269
NP_439937.1_9 Reverse -193 -210 -1.53514 0.124
NP_439937.1_9 Forward -52 -35 -10.3849 0.227
NP_441595.1_2 Reverse -298 -311 9.80195 0.277
NP_440439.1_1 Forward -89 -76 4.14919 0.105
NP_440439.1_1 Reverse -35 -48 1.59258 0.148
NP_439943.1_2 Forward -189 -170 11.2092 0.251
NP_440372.1_2 Reverse -250 -257 6.62729 0.151
NP_440372.1_2 Reverse -43 -50 6.62729 0.151
NP_440372.1_2 Forward -257 -250 6.52896 0.188
NP_440372.1_2 Forward -50 -43 6.52896 0.188
NP_439977.1_5 Reverse -188 -207 -2.16383 0.272
NP_440210.1_10 Forward -173 -154 4.22689 0.296
NP_442262.1_10 Reverse -250 -257 10.6589 0.14
NP_442262.1_10 Reverse -43 -50 10.6589 0.14
NP_442262.1_10 Reverse -195 -202 9.47889 0.187
NP_441689.1_5 Reverse -247 -257 5.58445 0.23
NP_440189.1_2 Reverse -69 -88 8.16093 0.25
NP_440562.1_3 Forward -50 -33 9.47861 0.15
NP_440297.1_9 Reverse -195 -205 -0.0199663 0.282
NP_442378.1_1 Forward -340 -323 16.4601 0.22
NP_440894.1_10 Reverse -182 -201 5.11266 0.238
NP_440999.1_9 Reverse -245 -259 1.37622 0.166
NP_440999.1_9 Forward -55 -41 -0.983719 0.223
NP_440888.1_2 Reverse -249 -263 8.94708 0.142
NP_440888.1_2 Forward -258 -244 8.84875 0.145
NP_442033.1_10 Forward -53 -34 -4.32711 0.179
NP_442033.1_10 Forward -195 -176 -11.9969 0.261
NP_441543.1_2 Reverse -250 -259 7.17789 0.131
NP_441543.1_2 Forward -257 -248 4.22796 0.267
NP_441834.1_7 Reverse -237 -256 14.9458 0.249
NP_441551.1_5 Forward -55 -39 9.20261 0.216
NP_441469.1_8 Forward -52 -43 6.5879 0.227
NP_442315.1_2 Forward -372 -360 8.6921 0.293
NP_442578.1_7 Forward -257 -250 5.15232 0.291
NP_442578.1_7 Forward -50 -43 5.15232 0.291
NP_440148.1_1 Forward -345 -326 2.94938 0.186
NP_441462.1_2 Forward -258 -248 0.766681 0.125
NP_441462.1_2 Forward -51 -41 -0.511621 0.236
NP_441621.1_3 Forward -330 -312 13.8838 0.186
NP_441621.1_7 Reverse -40 -54 -1.67204 0.184
NP_441601.1_2 Forward -264 -245 3.04771 0.219
NP_440544.1_5 Reverse -59 -66 13.8024 0.28
NP_442872.1_1 Reverse -363 -382 -10.227 0.241
NP_440516.1_6 Forward -170 -156 8.94708 0.246
NP_440516.1_8 Forward -258 -249 -0.393597 0.255
NP_440516.1_8 Reverse -42 -51 -0.491928 0.262
NP_442080.1_7 Forward -394 -375 18.4857 0.0136
NP_442428.1_5 Reverse -250 -257 6.3323 0.193
NP_442428.1_5 Reverse -43 -50 6.3323 0.193
NP_442428.1_5 Forward -257 -250 6.13563 0.209
NP_442428.1_5 Forward -50 -43 6.13563 0.209
NP_440818.1_1 Reverse -31 -50 4.22769 0.151
NP_440865.1_9 Reverse -34 -53 -5.99873 0.218
NP_443048.1_9 Reverse -53 -67 17.8929 0.104
NP_441052.1_2 Forward -193 -183 2.24165 0.213
NP_441052.1_2 Reverse -249 -259 2.04498 0.22
NP_441052.1_2 Forward -258 -248 0.766681 0.256
NP_442219.1_9 Forward -257 -248 8.84951 0.0681
NP_442219.1_9 Reverse -250 -259 8.25953 0.0681
NP_440436.1_4 Reverse -250 -259 7.47246 0.129
NP_440436.1_4 Forward -257 -248 6.29249 0.164
NP_440436.1_4 Forward -50 -41 5.0142 0.227
NP_441884.1_2 Reverse -213 -227 19.0145 0.132
NP_441884.1_7 Forward -341 -328 17.0299 0.265
NP_441884.1_9 Forward -261 -242 -11.7019 0.124
NP_441884.1_9 Forward -54 -35 -20.65 0.199
NP_441719.1_2 Forward -141 -127 13.4445 0.286
NP_441719.1_4 Reverse -250 -257 6.62729 0.151
NP_441719.1_4 Reverse -43 -50 6.62729 0.151
NP_441719.1_4 Forward -257 -250 6.52896 0.188
NP_441719.1_4 Forward -50 -43 6.52896 0.188
NP_441733.1_10 Forward -54 -41 16.3422 0.047
NP_441004.1_1 Reverse -22 -41 5.89931 0.103
NP_442813.1_4 Reverse -310 -329 -7.76869 0.299
NP_442366.1_5 Reverse -74 -84 13.6475 0.0698
NP_440296.1_4 Reverse -229 -248 16.8979 0.183
NP_442206.1_10 Forward -124 -109 1.06154 0.238
NP_442854.1_6 Reverse -162 -181 1.67108 0.279
NP_442586.1_5 Forward -361 -342 15.7324 0.227
NP_441851.1_10 Forward -259 -249 7.55152 0.137
NP_442515.1_1 Forward -259 -245 1.96621 0.145
NP_442515.1_1 Reverse -199 -213 -3.147 0.287
NP_441409.1_6 Reverse -243 -262 -8.65367 0.172
NP_441409.1_8 Forward -77 -58 7.40211 0.289
NP_440432.1_9 Reverse -250 -265 4.89645 0.0622
NP_442843.1_1 Reverse -34 -53 -1.57384 0.199
NP_439960.1_10 Reverse -193 -211 -4.60241 0.293
NP_440474.1_8 Reverse -43 -57 4.12889 0.291
NP_441975.1_5 Forward -318 -299 14.5932 0.184
NP_442006.1_3 Reverse -34 -52 -7.06068 0.298
NP_441078.1_4 Reverse -249 -258 0.196389 0.205
NP_441078.1_4 Forward -258 -249 0.196389 0.205
NP_440526.1_3 Reverse -250 -261 0.54986 0.275
NP_441432.1_8 Forward -259 -250 7.17789 0.102
NP_442320.1_8 Forward -264 -250 3.34284 0.0625
NP_441057.1_4 Forward -147 -129 -4.20908 0.299
NP_442400.1_1 Reverse -39 -58 -4.6221 0.266
NP_442489.1_7 Reverse -249 -258 0.688044 0.152
NP_442489.1_7 Forward -258 -249 0.491382 0.178
NP_440559.1_1 Reverse -250 -259 7.66954 0.0999
NP_440559.1_1 Forward -257 -248 7.66954 0.0999
NP_440559.1_1 Forward -50 -41 7.57121 0.106
NP_441659.2_8 Reverse -249 -259 6.17489 0.084
NP_441659.2_8 Reverse -194 -204 1.06167 0.251
NP_440708.1_5 Forward -260 -241 3.14605 0.292
NP_441807.1_5 Reverse -238 -257 15.1424 0.11
NP_440335.1_9 Reverse -264 -282 16.4404 0.184
NP_440779.1_5 Reverse -249 -266 -6.35267 0.177
NP_442346.1_5 Forward -259 -249 6.56821 0.198
NP_442346.1_5 Reverse -248 -258 4.89658 0.269
NP_442603.1_7 Forward -258 -244 14.6503 0.0613
NP_442603.1_7 Forward -51 -37 5.99717 0.264
NP_441888.1_7 Forward -263 -249 1.37622 0.253
NP_441833.1_4 Reverse -250 -257 12.9205 0.0393
NP_441833.1_4 Reverse -43 -50 12.9205 0.0393
NP_441833.1_4 Forward -257 -250 6.13563 0.198
NP_441833.1_4 Forward -50 -43 6.13563 0.198
NP_441895.1_2 Reverse -269 -288 -18.0934 0.234
NP_442162.1_9 Reverse -250 -257 6.52896 0.178
NP_442162.1_9 Reverse -43 -50 6.52896 0.178
NP_442162.1_9 Forward -257 -250 6.43063 0.208
NP_442162.1_9 Forward -50 -43 6.43063 0.208
NP_440224.1_1 Forward -269 -250 2.0644 0.132
NP_440204.1_9 Forward -274 -255 16.5191 0.2
NP_442140.1_3 Reverse -43 -53 9.51814 0.107
NP_442140.1_3 Reverse -195 -205 8.92815 0.117
NP_442140.1_3 Forward -50 -40 4.69992 0.238
NP_442140.1_3 Forward -257 -247 3.42162 0.297
NP_440875.1_9 Reverse -30 -40 9.05339 0.233
NP_441813.1_5 Forward -260 -250 8.33817 0.047
NP_441813.1_5 Forward -53 -43 0.176696 0.215
NP_440594.1_8 Forward -50 -37 11.7201 0.152
NP_440594.1_8 Forward -257 -244 11.5234 0.152
NP_440590.1_4 Reverse -250 -263 -5.09393 0.274
NP_440590.1_4 Forward -257 -244 -6.07724 0.299
NP_440567.1_1 Reverse -43 -57 9.2427 0.0471
NP_440567.1_1 Forward -50 -36 3.8345 0.135
NP_440567.1_1 Forward -257 -243 -0.0987402 0.264
NP_442497.1_4 Reverse -125 -144 10.8379 0.271
NP_442497.1_10 Forward -50 -41 8.1612 0.0625
NP_442497.1_10 Reverse -250 -259 0.688044 0.141
NP_440821.1_4 Forward -53 -43 6.56821 0.0853
NP_440821.1_4 Reverse -40 -50 1.25834 0.139
NP_440821.1_4 Reverse -247 -257 -0.314959 0.251
NP_440821.1_4 Forward -260 -250 -0.41329 0.257
NP_440227.1_2 Forward -314 -298 7.04003 0.295
NP_441239.1_9 Reverse -192 -204 12.4287 0.0477
NP_441239.1_9 Forward -205 -193 7.4138 0.161
NP_441239.1_9 Forward -53 -41 5.34885 0.223
NP_440156.1_4 Forward -145 -135 11.6809 0.176
NP_440833.1_6 Reverse -303 -317 13.5686 0.157
NP_440833.1_6 Reverse -170 -184 7.76712 0.278
NP_440876.1_5 Reverse -251 -270 7.57094 0.283
NP_440876.1_5 Reverse -330 -349 5.01433 0.283
NP_441617.1_6 Forward -144 -125 -5.40875 0.274
NP_440546.1_4 Forward -51 -41 8.20381 0.199
NP_440546.1_4 Forward -258 -248 8.10685 0.203
NP_442349.1_6 Forward -199 -180 5.01433 0.214
NP_440675.1_1 Forward -212 -193 9.0459 0.195
NP_440462.1_6 Forward -53 -43 7.15819 0.089
NP_440868.1_4 Forward -55 -43 1.51394 0.181
NP_440868.1_4 Reverse -245 -257 1.31728 0.186
NP_441497.1_3 Reverse -128 -147 -11.7019 0.294
NP_440341.1_1 Reverse -153 -172 3.73603 0.283
NP_441848.1_7 Reverse -304 -323 4.52188 0.215
NP_441084.1_6 Reverse -146 -160 12.8346 0.152
NP_442923.1_4 Reverse -22 -41 1.27776 0.179
NP_442039.1_4 Reverse -250 -257 11.3472 0.086
NP_442039.1_4 Reverse -43 -50 11.3472 0.086
NP_441811.1_8 Reverse -243 -257 6.19444 0.283
NP_442679.1_1 Reverse -206 -225 -5.99873 0.298
NP_442696.1_2 Forward -259 -241 8.37728 0.295
NP_442837.1_3 Reverse -250 -257 6.52896 0.2
NP_442837.1_3 Reverse -43 -50 6.52896 0.2
NP_442837.1_3 Forward -257 -250 6.0373 0.25
NP_442837.1_3 Forward -50 -43 6.0373 0.25
NP_442053.1_1 Forward -258 -249 5.60459 0.176
NP_440505.1_3 Forward -260 -250 8.63316 0.138
NP_442456.1_5 Reverse -28 -46 7.98396 0.26
NP_442532.1_1 Forward -70 -56 12.7374 0.215
NP_442532.1_4 Reverse -327 -345 7.28623 0.3
NP_441408.2_7 Reverse -146 -165 -4.03212 0.279
NP_440914.1_1 Reverse -249 -259 6.66328 0.269
NP_440914.1_1 Forward -258 -248 6.07773 0.297
NP_441699.1_7 Forward -160 -141 2.55527 0.255
NP_441011.1_8 Forward -50 -41 5.89959 0.214
NP_441011.1_8 Reverse -43 -52 5.80125 0.227
NP_442533.1_6 Forward -258 -249 6.19458 0.115
NP_442533.1_6 Reverse -194 -203 4.22796 0.186
NP_442232.1_3 Reverse -34 -53 -5.60541 0.165
NP_439944.1_9 Forward -257 -247 13.648 0.0526
NP_439944.1_9 Forward -50 -40 11.9764 0.0887
NP_441697.1_5 Reverse -304 -323 -11.3162 0.295
NP_441028.1_6 Forward -294 -284 5.78111 0.243
NP_441028.1_6 Reverse -221 -231 5.48612 0.255
NP_441028.1_6 Forward -46 -36 3.42118 0.296
NP_442202.1_4 Forward -53 -39 16.1318 0.159
NP_441527.1_4 Reverse -156 -175 -1.57604 0.148
NP_441527.1_4 Forward -71 -52 -12.7486 0.293
NP_440115.1_6 Reverse -39 -49 7.25653 0.152
NP_440115.1_6 Reverse -246 -256 6.96153 0.166
NP_441059.1_10 Reverse -159 -172 14.2773 0.2
NP_441286.1_1 Forward -259 -247 2.59558 0.0573
NP_441286.1_1 Reverse -248 -260 -5.95921 0.235
NP_440670.1_8 Forward -258 -249 5.70292 0.14
NP_440670.1_8 Reverse -77 -86 3.83464 0.219
NP_440886.1_7 Forward -52 -42 6.56775 0.118
NP_440268.1_8 Reverse -296 -315 12.5858 0.247
NP_440083.1_9 Reverse -130 -149 16.2853 0.278
NP_442614.1_2 Forward -196 -182 8.55439 0.255
NP_442614.1_2 Reverse -161 -175 8.06273 0.255
NP_442614.1_2 Forward -258 -244 5.70279 0.298
NP_442072.1_9 Reverse -41 -59 -13.2555 0.106
NP_442401.1_2 Reverse -364 -383 17.2065 0.0964
NP_442401.1_2 Forward -52 -33 10.815 0.171
NP_440907.2_8 Forward -50 -40 7.35439 0.121
NP_440664.1_4 Reverse -236 -255 6.39097 0.218
NP_442264.1_2 Forward -213 -196 10.3636 0.188
NP_442842.1_10 Forward -175 -156 10.1732 0.206
NP_441626.1_2 Reverse -250 -257 6.0373 0.212
NP_441626.1_2 Reverse -43 -50 6.0373 0.212
NP_441626.1_2 Forward -257 -250 5.93897 0.231
NP_441626.1_2 Forward -50 -43 5.93897 0.231
NP_441962.1_4 Reverse -37 -56 -11.4069 0.241
NP_441962.1_5 Forward -48 -29 9.43923 0.198
NP_441431.1_2 Forward -54 -40 10.422 0.159
NP_441836.1_2 Reverse -243 -262 -3.54046 0.239
NP_440634.1_4 Reverse -379 -398 7.57094 0.257
NP_441425.1_4 Reverse -132 -146 14.5526 0.282
NP_441817.1_10 Reverse -40 -59 14.5524 0.199
NP_440311.1_2 Reverse -143 -162 10.1275 0.299
NP_440287.1_6 Reverse -40 -59 6.39097 0.166
NP_440766.1_4 Reverse -38 -52 0.982901 0.259
NP_439988.1_3 Forward -207 -193 3.44117 0.299
NP_442930.1_1 Forward -145 -135 11.4843 0.258
NP_442930.1_1 Reverse -304 -314 11.3859 0.259
NP_440457.1_1 Forward -207 -195 2.20226 0.216
NP_440457.1_1 Reverse -38 -50 0.530633 0.25
NP_440798.1_6 Forward -50 -37 2.87088 0.159
NP_440798.1_6 Forward -85 -72 0.707601 0.251
NP_442509.1_9 Reverse -77 -87 6.27276 0.279
NP_440554.1_4 Reverse -250 -260 5.68323 0.135
NP_440554.1_4 Reverse -43 -53 4.10993 0.201
NP_442862.1_3 Reverse -230 -247 9.77361 0.219
NP_441885.1_5 Forward -258 -248 10.1081 0.0145
NP_441885.1_5 Reverse -249 -259 1.455 0.11
NP_442341.1_7 Forward -259 -245 4.52282 0.188
NP_441173.1_9 Forward -11 -3 11.7204 0.226
NP_443000.1_7 Forward -260 -250 10.3048 0.0345
NP_440507.2_8 Forward -187 -168 8.84924 0.123
NP_441842.1_1 Forward -256 -243 14.08 0.119
NP_440275.1_3 Forward -260 -250 5.28991 0.158
NP_440275.1_3 Reverse -40 -50 1.25834 0.291
NP_440091.1_1 Forward -55 -43 5.54551 0.114
NP_440091.1_1 Reverse -38 -50 2.79224 0.184
NP_440091.1_1 Reverse -245 -257 0.825626 0.227
NP_440091.1_1 Forward -262 -250 -0.74767 0.286
NP_442275.1_1 Reverse -236 -255 0.884433 0.284
NP_442275.1_3 Forward -350 -331 12.3892 0.274
NP_442451.1_2 Reverse -320 -339 -11.6036 0.297
NP_441207.1_7 Reverse -136 -150 8.38408 0.288
NP_440258.1_8 Forward -147 -128 11.405 0.299
NP_440216.1_1 Reverse -249 -263 -11.5051 0.192
NP_440216.1_1 Forward -51 -37 -11.8001 0.219
NP_440216.1_9 Reverse -130 -139 12.3894 0.241
NP_440216.1_9 Reverse -131 -140 6.19458 0.289
NP_440216.1_9 Forward -35 -26 5.50626 0.292
NP_440172.1_1 Forward -258 -248 15.418 0.00945
NP_440172.1_1 Forward -51 -41 6.8632 0.0991
NP_441852.1_4 Reverse -18 -37 10.8159 0.143
NP_441226.1_7 Reverse -78 -85 6.82361 0.246
NP_441226.1_7 Forward -118 -111 6.52862 0.253
NP_441111.1_7 Reverse -250 -258 8.96754 0.0463
NP_441766.1_2 Forward -51 -42 14.8477 0.00766
NP_441766.1_2 Forward -258 -249 14.0611 0.0111
NP_443052.1_9 Reverse -192 -211 8.65258 0.115
NP_442116.1_6 Reverse -294 -311 6.64108 0.273
NP_442116.1_6 Reverse -295 -312 5.49518 0.296
NP_440261.1_5 Forward -50 -37 -3.22564 0.12
NP_440261.1_5 Forward -257 -244 -5.29059 0.19
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGACAACCCTGGTTAACTGCTGAGTTGATTATTGGGGATGCTATTAAGTAGGGTCTAAAATGTAGCGATATTTACCAATGAAGATAGGAAATTTTGTCCAGATAAATTGACCCCAATAATTTTTACTAGGGGTTTCTAAACTGGCGATCTCTACCAAGTCTTGACCAATATGGAGGTTAACTTTTTGATGTTTCTGGTGCCATGGGCGGACATCCACAAGGAAAGTTCTTCACCTTGCCCTTTATCCATAGTCTGAAAATTTTTCCATTGGCTTCAGTAGATCCCAACGGTGGACTGAGGGCTCATTTCTGGACTCGGATCGGCTACCCTAAAAGAAGAAAAGGAGAGCCGCGATCTCTCCCCGTCCATTGCATAAACCGACTAGGAACTTTAACCCACC

CDS

GTGACAACTGTTACCGATGCAGACCTAAAGGAATTAAAAGACCTCATCACCACTGGATTCACCAAGTTAGAGGTCAATCAAGCCCGCATTGAGGAAAAGCTGAATGGAATAGATAAGCGTCTAGAGTTAGTCGAAACACGAATCAACACTCAAACTAATTGGTTTGTTGGAGCCTTTGCCGCTTTGGTGGGCGGATTATTGGCCTTGCTCGGAAAATTTATTCTGTTCCCCAACGCTTAA

Protein

No sequence available