Your browser is old and dusty. Try Google Chrome!

Details for ssl8010

ORF ssl8010
Accession NP_942404.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -226 -240 0.786239 0.199
NP_440557.1_1 Forward -350 -331 -2.45882 0.289
NP_441453.1_4 Forward -234 -226 14.8674 0.00947
NP_441453.1_4 Reverse -225 -233 6.80426 0.121
NP_441453.1_4 Forward -44 -36 5.0343 0.209
NP_440226.1_1 Forward -234 -215 16.3224 0.022
NP_441630.1_3 Reverse -217 -236 -0.983855 0.29
NP_442173.1_1 Reverse -226 -234 13.8841 0.0225
NP_442173.1_1 Forward -233 -225 12.0158 0.0316
NP_442173.1_1 Reverse -36 -44 4.93597 0.241
NP_442752.1_4 Reverse -225 -232 13.8055 0.0199
NP_440784.1_7 Reverse -226 -233 6.23397 0.241
NP_440784.1_7 Forward -233 -226 6.13563 0.241
NP_440061.1_9 Reverse -223 -237 5.30886 0.29
NP_442062.1_8 Reverse -225 -235 7.94484 0.0848
NP_441859.1_3 Reverse -34 -53 2.45694 0.258
NP_440044.1_8 Forward -233 -214 -1.7705 0.251
NP_442896.1_7 Forward -306 -287 0.491109 0.253
NP_442367.1_1 Reverse -341 -360 -13.6686 0.286
NP_441083.1_5 Reverse -225 -235 6.96153 0.0717
NP_441083.1_5 Forward -234 -224 0.766681 0.218
NP_442827.1_8 Reverse -217 -236 -2.45958 0.278
NP_441738.1_2 Forward -232 -225 15.28 0.0102
NP_441558.1_5 Forward -236 -217 8.16093 0.159
NP_441558.1_5 Reverse -223 -242 4.12936 0.29
NP_440209.1_1 Reverse -225 -233 8.57422 0.0425
NP_441713.1_1 Forward -240 -221 -8.16202 0.145
NP_440178.1_7 Forward -235 -216 -21.6334 0.232
NP_442570.1_3 Forward -377 -358 -8.752 0.292
NP_442445.1_1 Forward -260 -241 13.1758 0.23
NP_442111.1_4 Forward -235 -221 6.19444 0.134
NP_440906.1_5 Reverse -226 -233 6.23397 0.234
NP_440906.1_5 Forward -233 -226 6.13563 0.241
NP_440747.1_10 Reverse -222 -234 -12.1541 0.227
NP_441130.1_10 Forward -236 -222 5.01447 0.251
NP_442634.1_2 Forward -264 -245 -0.590531 0.293
NP_442634.1_4 Reverse -223 -237 -3.24533 0.161
NP_441014.1_10 Forward -352 -333 -2.95123 0.292
NP_443018.1_3 Forward -233 -226 11.7405 0.0655
NP_443018.1_3 Reverse -226 -233 5.44732 0.193
NP_440376.1_1 Reverse -225 -234 5.89959 0.116
NP_440376.1_1 Forward -242 -233 2.16301 0.233
NP_440376.1_1 Forward -234 -225 -0.0986038 0.285
NP_442687.1_7 Reverse -224 -234 5.78156 0.188
NP_441846.1_10 Forward -361 -342 -15.4385 0.25
NP_441846.1_10 Forward -369 -350 -22.9117 0.271
NP_440642.1_10 Reverse -243 -257 6.0955 0.238
NP_440667.1_2 Reverse -374 -393 -2.55715 0.232
NP_440360.1_10 Reverse -227 -241 2.45787 0.265
NP_442658.1_1 Forward -236 -226 7.15773 0.214
NP_442161.1_7 Reverse -229 -248 19.174 0.0121
NP_442782.1_2 Forward -362 -348 7.57108 0.202
NP_442782.1_2 Reverse -67 -81 0.982901 0.282
NP_441958.1_5 Reverse -224 -234 17.6796 0.00183
NP_441958.1_5 Forward -235 -225 0.963343 0.12
NP_442486.1_8 Reverse -211 -230 19.3698 0.159
NP_442260.1_8 Forward -42 -23 4.916 0.178
NP_439905.1_1 Forward -233 -220 9.36073 0.221
NP_440984.1_7 Reverse -220 -234 7.57108 0.166
NP_442911.1_2 Forward -244 -225 -6.39206 0.182
NP_442911.1_2 Reverse -25 -44 -11.1119 0.299
NP_440153.1_5 Forward -233 -219 13.5693 0.0551
NP_443055.1_6 Reverse -225 -243 10.1465 0.131
NP_440388.1_7 Forward -253 -234 1.0811 0.251
NP_441000.1_6 Forward -235 -221 4.12949 0.0992
NP_440147.1_4 Reverse -223 -236 16.1456 0.0125
NP_440147.1_4 Forward -184 -171 0.510939 0.252
NP_441550.1_8 Reverse -223 -233 14.5325 0.0141
NP_441550.1_8 Forward -236 -226 14.0409 0.0194
NP_441916.1_7 Forward -234 -224 10.0098 0.0283
NP_441916.1_7 Reverse -225 -235 5.09324 0.146
NP_440206.1_4 Reverse -235 -254 -1.96793 0.293
NP_442642.1_4 Forward -307 -288 13.9625 0.166
NP_441725.1_5 Reverse -226 -236 -0.0199663 0.223
NP_441725.1_8 Forward -357 -338 11.6025 0.215
NP_439966.1_7 Reverse -223 -233 4.60114 0.265
NP_439966.1_9 Reverse -33 -42 6.29291 0.253
NP_442941.1_3 Forward -233 -223 9.41981 0.0319
NP_440983.1_5 Reverse -354 -373 -5.31042 0.266
NP_440260.1_8 Forward -85 -67 -0.374176 0.211
NP_442281.1_1 Forward -239 -225 6.68548 0.118
NP_442256.1_2 Forward -236 -218 -1.06249 0.16
NP_001035871.2_7 Forward -245 -235 12.9597 0.237
NP_441644.1_6 Forward -234 -224 16.4008 0.00405
NP_442215.1_2 Reverse -171 -187 -0.728113 0.171
NP_442029.1_6 Forward -297 -278 7.17762 0.225
NP_442247.1_8 Reverse -223 -237 15.3392 0.247
NP_440253.1_2 Forward -345 -327 -2.83245 0.278
NP_440929.1_8 Forward -234 -225 7.17789 0.0713
NP_442933.1_10 Forward -234 -225 8.06287 0.0885
NP_442933.1_10 Reverse -225 -234 7.96454 0.0937
NP_442554.1_8 Forward -233 -223 7.45319 0.092
NP_442554.1_8 Reverse -226 -236 4.99491 0.163
NP_441762.1_7 Forward -235 -223 -6.35254 0.284
NP_442142.1_7 Forward -256 -239 12.3302 0.298
NP_442292.1_1 Forward -233 -224 7.66954 0.0634
NP_440511.1_1 Forward -247 -229 10.6389 0.192
NP_442476.1_6 Reverse -226 -240 1.47456 0.214
NP_443009.1_5 Reverse -224 -235 6.25303 0.169
NP_441715.1_4 Forward -233 -223 6.96153 0.121
NP_440015.1_9 Reverse -225 -243 4.14905 0.163
NP_441468.1_1 Reverse -226 -233 6.13563 0.209
NP_441468.1_1 Forward -233 -226 6.0373 0.223
NP_441673.1_1 Forward -234 -225 1.27803 0.155
NP_441673.1_1 Reverse -225 -234 1.27803 0.155
NP_441826.1_2 Forward -357 -343 -4.81863 0.3
NP_441330.1_1 Reverse -220 -239 -11.5053 0.183
NP_441764.1_8 Reverse -189 -199 11.5978 0.284
NP_442868.1_6 Reverse -223 -233 0.668351 0.213
NP_442808.1_1 Reverse -232 -242 1.06124 0.296
NP_442050.1_5 Forward -236 -226 11.8776 0.0802
NP_442342.1_9 Reverse -231 -247 2.12349 0.29
NP_440558.1_2 Forward -360 -341 4.916 0.147
NP_441878.1_6 Forward -235 -225 0.668351 0.139
NP_441036.1_8 Reverse -224 -234 10.5014 0.167
NP_441557.1_5 Reverse -225 -234 8.94785 0.0289
NP_441557.1_5 Forward -234 -225 0.688044 0.128
NP_442183.1_1 Reverse -225 -239 7.57108 0.138
NP_442183.1_1 Reverse -102 -116 4.32615 0.266
NP_442397.1_9 Reverse -336 -355 3.24438 0.264
NP_442965.1_2 Forward -367 -348 -5.9004 0.255
NP_441037.1_4 Forward -236 -226 5.85583 0.296
NP_442594.1_8 Forward -369 -350 2.16274 0.295
NP_442047.1_2 Forward -201 -187 12.1926 0.288
NP_441633.1_3 Reverse -223 -236 -4.11062 0.181
NP_440136.1_2 Reverse -226 -233 6.23397 0.171
NP_440136.1_2 Forward -233 -226 6.13563 0.193
NP_442998.1_10 Forward -232 -225 15.5754 0.0102
NP_441799.1_1 Forward -238 -224 9.83206 0.0838
NP_441007.1_10 Forward -239 -226 2.08423 0.2
NP_442201.1_10 Reverse -214 -233 -7.76869 0.202
NP_441559.1_8 Reverse -146 -160 -6.88358 0.281
NP_440915.1_6 Forward -238 -224 2.65453 0.113
NP_440717.1_3 Reverse -354 -368 8.06211 0.27
NP_441866.1_6 Reverse -266 -285 7.07848 0.285
NP_442866.1_4 Reverse -337 -356 11.7008 0.153
NP_441464.1_8 Reverse -225 -239 7.37441 0.21
NP_441464.1_10 Reverse -5 -19 7.66941 0.295
NP_441494.1_5 Reverse -83 -97 22.8117 0.0353
NP_442993.1_1 Reverse -225 -241 -1.21977 0.0885
NP_440570.1_5 Forward -378 -359 4.81767 0.207
NP_441340.1_5 Reverse -226 -233 13.5105 0.0314
NP_441340.1_5 Forward -233 -226 5.84064 0.208
NP_442484.1_2 Reverse -235 -254 -1.08219 0.284
NP_442240.1_2 Forward -233 -214 -13.3736 0.167
NP_440586.1_8 Forward -233 -226 9.47853 0.146
NP_440586.1_8 Reverse -226 -233 5.74197 0.283
NP_441262.1_3 Reverse -225 -232 14.7888 0.0223
NP_443051.1_1 Reverse -224 -233 16.6177 0.00754
NP_443051.1_1 Forward -235 -226 -1.08191 0.281
NP_440439.1_1 Reverse -222 -235 20.7671 0.0105
NP_440372.1_2 Reverse -226 -233 13.8055 0.0214
NP_440372.1_2 Forward -233 -226 6.52896 0.188
NP_442384.1_10 Forward -234 -221 7.88576 0.0727
NP_442790.1_4 Forward -243 -224 -8.94866 0.176
NP_442262.1_10 Forward -233 -226 13.2155 0.0213
NP_441689.1_5 Reverse -223 -233 5.78111 0.197
NP_440282.1_10 Forward -355 -336 -2.26216 0.227
NP_442693.1_7 Forward -364 -345 10.6192 0.227
NP_440297.1_9 Reverse -337 -347 7.05986 0.15
NP_442280.1_10 Forward -378 -360 10.9088 0.215
NP_441592.1_4 Reverse -274 -293 -2.36049 0.262
NP_441896.1_3 Forward -243 -224 -1.86883 0.268
NP_440999.1_2 Reverse -180 -199 11.6025 0.211
NP_440888.1_2 Forward -234 -220 11.4053 0.0681
NP_440888.1_2 Forward -351 -337 8.84875 0.145
NP_440888.1_2 Reverse -239 -253 7.86545 0.179
NP_440491.1_1 Forward -258 -239 8.86616 0.226
NP_441543.1_2 Forward -233 -224 6.09625 0.153
NP_441551.1_5 Forward -238 -222 7.82599 0.241
NP_443064.1_6 Reverse -225 -235 9.07643 0.247
NP_442578.1_7 Reverse -226 -233 6.0373 0.18
NP_441462.1_2 Reverse -225 -235 17.3846 0.00406
NP_441462.1_2 Forward -234 -224 0.668351 0.135
NP_441929.1_6 Reverse -314 -333 6.09597 0.294
NP_443062.1_1 Forward -234 -216 5.71821 0.22
NP_442204.1_1 Reverse -221 -232 9.59678 0.0736
NP_440516.1_8 Reverse -225 -234 9.4395 0.0183
NP_440516.1_8 Forward -234 -225 5.11294 0.118
NP_442428.1_5 Reverse -226 -233 6.13563 0.209
NP_442428.1_5 Forward -233 -226 6.0373 0.212
NP_440673.1_3 Forward -232 -225 12.4288 0.0426
NP_440436.1_4 Reverse -226 -235 5.11253 0.222
NP_442907.1_9 Reverse -67 -86 -0.000545616 0.212
NP_441719.1_4 Reverse -226 -233 6.82395 0.0855
NP_441719.1_4 Forward -233 -226 6.52896 0.188
NP_442813.1_4 Forward -190 -171 -5.40875 0.299
NP_441231.1_3 Reverse -354 -373 16.4199 0.172
NP_440328.1_4 Reverse -219 -238 1.27776 0.23
NP_441851.1_10 Reverse -34 -44 4.10993 0.287
NP_442814.1_2 Forward -200 -181 6.88262 0.252
NP_442515.1_1 Forward -45 -31 -0.197071 0.214
NP_442515.1_1 Reverse -224 -238 -2.26202 0.271
NP_440432.1_9 Forward -233 -218 -5.42831 0.248
NP_439960.1_10 Reverse -91 -109 3.46073 0.163
NP_440474.1_8 Forward -43 -29 11.9953 0.0945
NP_441477.1_5 Reverse -344 -363 5.89931 0.292
NP_441570.1_1 Reverse -377 -395 -8.14232 0.104
NP_441078.1_4 Reverse -225 -234 0.0980582 0.205
NP_441078.1_4 Forward -234 -225 0.0980582 0.205
NP_442729.1_8 Forward -238 -225 7.09911 0.166
NP_441528.1_2 Reverse -350 -369 8.55343 0.275
NP_441432.1_8 Reverse -224 -233 14.0611 0.0258
NP_440760.1_1 Reverse -225 -244 -3.04881 0.0339
NP_442489.1_7 Forward -234 -225 0.786375 0.152
NP_442489.1_7 Reverse -225 -234 0.589713 0.17
NP_440559.1_1 Reverse -226 -235 14.651 0.0144
NP_441659.2_8 Forward -234 -224 15.5163 0.006
NP_441659.2_8 Reverse -225 -235 0.176696 0.271
NP_440363.1_8 Forward -242 -223 13.7658 0.288
NP_442346.1_5 Reverse -224 -234 6.66654 0.195
NP_442346.1_5 Forward -235 -225 5.97822 0.219
NP_440250.1_4 Forward -280 -261 6.29183 0.253
NP_441653.1_2 Reverse -214 -233 17.8314 0.0435
NP_440449.1_6 Forward -242 -224 4.6571 0.294
NP_441833.1_4 Forward -233 -226 6.52896 0.0924
NP_441833.1_4 Reverse -226 -233 6.23397 0.163
NP_441895.1_2 Reverse -359 -378 -17.4051 0.224
NP_442162.1_9 Forward -233 -226 12.9205 0.0282
NP_442162.1_9 Reverse -226 -233 12.9205 0.0282
NP_440224.1_1 Reverse -214 -233 1.37609 0.132
NP_442140.1_3 Forward -43 -33 5.28991 0.216
NP_442140.1_3 Reverse -226 -236 5.28991 0.216
NP_442723.1_1 Reverse -229 -248 1.57197 0.295
NP_440875.1_9 Forward -232 -222 13.5309 0.0677
NP_441813.1_5 Reverse -223 -233 8.4365 0.0432
NP_441813.1_5 Forward -236 -226 4.99491 0.142
NP_440567.1_1 Reverse -226 -240 5.70279 0.0984
NP_442497.1_10 Reverse -226 -235 8.25953 0.047
NP_442497.1_10 Forward -233 -224 7.76787 0.0731
NP_440821.1_4 Forward -236 -226 0.963343 0.145
NP_441239.1_9 Forward -236 -224 11.642 0.0572
NP_441874.1_1 Forward -372 -358 19.5675 0.149
NP_440546.1_4 Reverse -225 -235 15.4756 0.0459
NP_440546.1_4 Forward -234 -224 11.6943 0.0748
NP_441230.1_5 Reverse -220 -239 2.3594 0.215
NP_440055.1_5 Reverse -362 -381 16.1172 0.243
NP_440462.1_6 Reverse -223 -233 9.22315 0.049
NP_440462.1_6 Forward -236 -226 6.76487 0.102
NP_440868.1_4 Reverse -221 -233 14.7886 0.0169
NP_441672.1_6 Reverse -77 -96 13.5683 0.175
NP_442402.1_2 Reverse -350 -364 10.3237 0.292
NP_442402.1_10 Reverse -354 -364 14.3359 0.18
NP_442039.1_4 Reverse -226 -233 11.6422 0.0747
NP_441811.1_8 Forward -240 -226 9.04604 0.227
NP_442837.1_3 Forward -233 -226 6.0373 0.25
NP_442837.1_3 Reverse -226 -233 6.0373 0.25
NP_440160.1_3 Reverse -188 -207 10.52 0.209
NP_442053.1_1 Forward -234 -225 7.17789 0.104
NP_440505.1_3 Reverse -223 -233 15.6147 0.0106
NP_440505.1_3 Reverse -65 -75 4.60159 0.277
NP_440914.1_1 Forward -234 -224 13.1043 0.0386
NP_441011.1_8 Reverse -226 -235 12.0944 0.0517
NP_441011.1_8 Forward -233 -224 6.78456 0.184
NP_442533.1_6 Reverse -225 -234 5.40793 0.14
NP_442533.1_6 Forward -234 -225 4.52295 0.179
NP_442232.1_7 Reverse -375 -394 17.109 0.0998
NP_442322.1_4 Reverse -230 -247 -9.99156 0.297
NP_441482.1_7 Reverse -219 -233 -12.3901 0.295
NP_439944.1_9 Reverse -226 -236 6.46988 0.179
NP_439944.1_9 Reverse -36 -46 5.09324 0.277
NP_440115.1_6 Reverse -222 -232 13.0581 0.0818
NP_441106.1_1 Reverse -224 -233 8.75118 0.0469
NP_441420.1_1 Reverse -224 -243 -2.95047 0.288
NP_442306.1_10 Reverse -220 -239 -10.522 0.11
NP_441286.1_1 Reverse -224 -236 -3.89426 0.147
NP_440670.1_8 Reverse -225 -234 8.65285 0.0627
NP_440670.1_8 Forward -234 -225 6.29291 0.124
NP_441647.1_8 Forward -216 -197 12.3883 0.258
NP_441705.1_3 Reverse -286 -305 -6.49039 0.291
NP_442614.1_2 Reverse -225 -239 7.57108 0.271
NP_442072.1_9 Forward -235 -217 -22.7936 0.259
NP_440907.2_8 Forward -233 -223 7.84605 0.117
NP_440907.2_8 Reverse -226 -236 7.0594 0.132
NP_439967.1_8 Reverse -220 -239 18.9765 0.281
NP_441626.1_2 Reverse -226 -233 12.2322 0.0511
NP_441626.1_2 Forward -233 -226 5.93897 0.231
NP_442238.1_7 Forward -214 -195 6.98015 0.257
NP_442615.1_1 Reverse -216 -234 -4.30741 0.183
NP_442615.1_1 Forward -371 -353 -7.06068 0.273
NP_440387.1_1 Reverse -225 -241 -2.89139 0.152
NP_441431.1_2 Reverse -222 -236 10.2254 0.166
NP_441488.1_8 Forward -326 -312 7.3738 0.252
NP_440358.1_8 Forward -273 -254 -1.96717 0.29
NP_440114.1_10 Forward -234 -220 13.3726 0.0587
NP_440114.1_10 Reverse -225 -239 11.996 0.0955
NP_442323.1_7 Reverse -220 -239 1.76863 0.278
NP_440293.1_3 Forward -370 -351 -5.01543 0.269
NP_440457.1_1 Reverse -221 -233 3.57889 0.191
NP_440798.1_6 Forward -233 -220 11.819 0.0564
NP_442514.1_5 Forward -230 -211 -8.6544 0.288
NP_440554.1_4 Forward -233 -223 15.0247 0.02
NP_441885.1_5 Reverse -225 -235 7.84651 0.0419
NP_441885.1_5 Reverse -35 -45 -1.29827 0.259
NP_443000.1_7 Reverse -223 -233 10.5998 0.0345
NP_440275.1_3 Reverse -223 -233 13.5497 0.0268
NP_440275.1_3 Forward -236 -226 1.35667 0.29
NP_442275.1_1 Reverse -349 -368 0.884433 0.284
NP_443010.1_10 Forward -391 -374 1.99772 0.287
NP_439962.1_4 Forward -242 -223 -5.99873 0.28
NP_442127.1_1 Forward -329 -311 8.3765 0.213
NP_440216.1_1 Forward -234 -220 13.9626 0.00532
NP_440172.1_1 Reverse -225 -235 8.82982 0.0586
NP_440172.1_1 Forward -234 -224 4.89658 0.162
NP_441226.1_7 Reverse -226 -233 12.7234 0.0312
NP_441226.1_7 Forward -233 -226 11.5435 0.0757
NP_441111.1_7 Forward -233 -225 8.86921 0.0589
NP_441766.1_2 Reverse -225 -234 8.1612 0.0645
NP_441766.1_2 Forward -234 -225 5.89959 0.103
NP_440591.1_9 Forward -241 -223 6.80398 0.215
NP_440261.1_5 Forward -233 -220 -4.79893 0.17
NP_440261.1_5 Reverse -226 -239 -10.7971 0.21
NP_440261.1_5 Reverse -99 -112 -12.2721 0.277
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CTATGACCAAAAAACGATACCGCCCATTCTTTGGACTTGGGGAGAGCAGGGTCAGTCCCATAGCGGTATTATCTTCGTTGACTATCAGAGTATGCCGCCCCAAGATTTTGGGAGTCTAGTCCAGGCTTTGCTTAAATTATGGAAGGATGAACGGGAAAGGGGTTGGACCGATCGCCTGCTGTATCTCAAGTGTTCCTGATCCAGTTTGCTGTCCCATTAGCATTCTGCGCCCAGCTTTCTGGGAGTTACAGGCTAGTCCTCAGCTAACAACGTTTTTTAGTTAGGTTACTCCGTTCTCTCGCAAGGGTAGGATAGGACGGGATACGCTCTTGCCTGAAACATAGGACAGTGAATGTAGCAATAGCAGCATCCTATCAGTTCACTACAAAAACCCGAATTT

CDS

ATGAACCCAGTTAGCCACAACAACATTGTCAATTTCATCTGGGGCATTGCTGACGATGTGTTGCGTGATGTGTATGTGCGGGGCAAGTACCGTGATGTTATCCTGCCGATGACAGTGATCCGTCGTCTAGATGCAGTTCTGGAGCCGAGTAAGGAAAAGGTACTGACCATGAAGGGTTAA

Protein

No sequence available