Your browser is old and dusty. Try Google Chrome!

Details for ssl7046

ORF ssl7046
Accession NP_942334.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Forward -108 -89 -20.5517 0.117
NP_442151.1_6 Forward -315 -301 6.29277 0.24
NP_441818.1_1 Reverse -307 -318 11.2679 0.191
NP_442623.1_1 Reverse -374 -393 -9.63698 0.253
NP_443027.1_4 Reverse -304 -314 10.2065 0.138
NP_442975.1_10 Reverse -373 -387 2.8506 0.269
NP_440784.1_7 Reverse -307 -314 8.59391 0.129
NP_440761.1_4 Reverse -316 -335 -20.65 0.289
NP_440044.1_8 Forward -314 -295 7.37428 0.0842
NP_440908.1_2 Reverse -89 -102 15.9483 0.269
NP_441083.1_5 Forward -336 -326 -0.118297 0.256
NP_441558.1_5 Forward -317 -298 4.71934 0.271
NP_442889.1_8 Reverse -303 -317 8.65209 0.114
NP_442398.1_4 Forward -224 -205 7.27514 0.252
NP_441713.1_8 Forward -100 -82 7.4923 0.294
NP_442111.1_4 Reverse -98 -112 3.04785 0.257
NP_441533.1_2 Forward -379 -360 14.7491 0.246
NP_440747.1_10 Forward -339 -327 -2.4193 0.0434
NP_441014.1_10 Reverse -134 -153 0.293673 0.244
NP_441012.1_4 Forward -23 -10 7.09911 0.272
NP_441012.1_4 Reverse -127 -140 5.52582 0.294
NP_441634.1_8 Forward -317 -303 14.0609 0.0318
NP_440376.1_1 Reverse -327 -336 4.0313 0.182
NP_440376.1_1 Forward -176 -167 2.35967 0.224
NP_440376.1_1 Reverse -111 -120 -0.393597 0.289
NP_441588.1_4 Forward -334 -324 5.68323 0.245
NP_442730.1_8 Forward -338 -319 2.45694 0.292
NP_441846.1_10 Reverse -102 -121 -23.1083 0.277
NP_441846.1_10 Forward -143 -124 -23.4033 0.285
NP_441950.1_7 Reverse -102 -121 -8.45701 0.287
NP_442658.1_1 Reverse -133 -143 9.02601 0.169
NP_442937.1_5 Reverse -346 -365 6.4893 0.278
NP_441127.1_1 Forward -309 -295 12.291 0.215
NP_441127.1_7 Forward -352 -333 22.4189 0.0857
NP_439905.1_1 Reverse -126 -139 15.2606 0.098
NP_441580.1_6 Reverse -295 -314 -5.80207 0.235
NP_442536.1_8 Forward -260 -241 11.7992 0.253
NP_440138.1_6 Reverse -322 -341 1.37531 0.284
NP_441294.1_7 Reverse -302 -316 8.86667 0.274
NP_442431.1_10 Forward -146 -128 0.707465 0.267
NP_440147.1_4 Forward -110 -97 -0.570702 0.291
NP_439966.1_7 Reverse -133 -143 8.14104 0.14
NP_440736.1_3 Forward -332 -313 -1.18052 0.282
NP_440260.1_8 Forward -369 -351 -7.06068 0.295
NP_442012.1_1 Reverse -68 -87 3.34271 0.18
NP_441644.1_6 Forward -336 -326 5.97777 0.172
NP_441644.1_6 Reverse -321 -331 5.09279 0.21
NP_442215.1_2 Forward -338 -322 -5.74299 0.256
NP_442177.1_5 Forward -312 -298 12.8809 0.22
NP_440929.1_8 Forward -336 -327 4.0313 0.193
NP_442554.1_8 Reverse -328 -338 3.22496 0.235
NP_442554.1_8 Forward -314 -304 2.04498 0.285
NP_442554.1_8 Reverse -307 -317 2.04498 0.285
NP_442292.1_1 Reverse -307 -316 5.21127 0.152
NP_440919.1_1 Forward -335 -316 -5.80207 0.258
NP_443009.1_5 Forward -84 -73 4.28642 0.254
NP_441715.1_4 Forward -143 -133 5.19158 0.224
NP_440379.1_5 Reverse -359 -378 -10.7186 0.283
NP_441468.1_1 Forward -314 -307 4.26735 0.246
NP_441731.1_7 Forward -266 -247 1.47442 0.298
NP_441826.1_2 Forward -336 -322 1.86788 0.14
NP_441826.1_2 Reverse -321 -335 -3.63866 0.286
NP_442361.1_3 Forward -114 -101 10.344 0.272
NP_440558.1_5 Forward -329 -315 14.0609 0.289
NP_441878.1_6 Forward -337 -327 -7.88644 0.278
NP_442650.1_2 Forward -83 -69 2.65453 0.254
NP_441445.1_1 Forward -345 -326 -0.197208 0.286
NP_442777.1_1 Reverse -43 -62 5.60352 0.276
NP_442347.1_2 Reverse -378 -387 5.21127 0.237
NP_442347.1_2 Forward -266 -257 4.91628 0.249
NP_441633.1_3 Forward -317 -304 0.60927 0.119
NP_441633.1_3 Reverse -372 -385 -7.15888 0.294
NP_440256.1_1 Forward -333 -314 -8.26035 0.256
NP_441559.1_8 Reverse -130 -144 -2.55701 0.192
NP_440702.1_2 Forward -98 -79 -6.29373 0.257
NP_442386.1_9 Forward -337 -328 5.89917 0.233
NP_441750.1_7 Forward -309 -299 13.648 0.258
NP_440586.1_1 Forward -241 -222 -3.83545 0.273
NP_440586.1_8 Reverse -307 -314 9.28187 0.164
NP_439937.1_9 Reverse -372 -389 -11.8598 0.267
NP_440316.1_10 Forward -331 -321 6.66654 0.256
NP_441803.1_2 Reverse -126 -145 3.34271 0.191
NP_442416.1_1 Forward -281 -262 6.34979 0.266
NP_442384.1_10 Reverse -377 -390 6.4108 0.102
NP_442384.1_10 Forward -336 -323 2.77255 0.213
NP_442121.1_4 Forward -116 -97 -1.57384 0.226
NP_441018.1_7 Forward -138 -119 9.3409 0.227
NP_441018.1_7 Forward -94 -75 8.25926 0.253
NP_442910.1_1 Reverse -67 -86 1.67108 0.129
NP_440297.1_9 Forward -353 -343 6.37155 0.193
NP_440999.1_9 Reverse -302 -316 0.88457 0.174
NP_440999.1_9 Reverse -140 -154 0.491246 0.183
NP_440888.1_2 Forward -144 -130 5.70218 0.267
NP_441543.1_2 Reverse -100 -109 4.0313 0.293
NP_442845.1_2 Forward -96 -82 7.27608 0.195
NP_442845.1_2 Forward -336 -322 5.99778 0.219
NP_441178.1_5 Reverse -315 -334 9.14423 0.291
NP_441469.1_8 Reverse -305 -314 11.9961 0.136
NP_441351.1_8 Reverse -304 -323 4.52268 0.225
NP_440516.1_6 Reverse -321 -335 7.17714 0.284
NP_440516.1_8 Reverse -351 -360 -0.491928 0.262
NP_440516.1_8 Forward -330 -321 -0.68859 0.297
NP_442428.1_5 Forward -314 -307 11.4455 0.062
NP_442120.1_10 Forward -302 -283 -10.817 0.261
NP_440673.1_2 Reverse -296 -315 10.3896 0.212
NP_440673.1_3 Forward -358 -351 7.51227 0.252
NP_440673.1_3 Forward -381 -374 6.72562 0.277
NP_440673.1_3 Forward -191 -184 6.3323 0.283
NP_441052.1_2 Forward -228 -218 3.81494 0.173
NP_441884.1_9 Reverse -94 -113 -21.4367 0.245
NP_442813.1_4 Reverse -319 -338 8.45592 0.139
NP_442873.1_9 Forward -136 -117 7.66846 0.236
NP_442694.1_4 Forward -135 -126 10.9145 0.287
NP_440864.1_9 Forward -100 -81 4.916 0.119
NP_441851.1_10 Forward -84 -74 4.69992 0.254
NP_442856.1_7 Forward -143 -124 -4.91709 0.27
NP_442856.1_7 Reverse -168 -187 -6.49039 0.298
NP_440593.1_3 Reverse -357 -376 -4.52377 0.251
NP_442709.1_3 Forward -90 -71 3.53937 0.284
NP_441409.1_1 Forward -309 -290 24.0905 0.00911
NP_441570.1_1 Forward -330 -312 -17.0904 0.264
NP_440078.1_10 Reverse -294 -313 5.89931 0.224
NP_441078.1_4 Forward -336 -327 -1.86856 0.272
NP_442729.1_8 Reverse -71 -84 8.27909 0.125
NP_441432.1_8 Reverse -350 -359 11.9961 0.0519
NP_441432.1_8 Reverse -326 -335 3.44131 0.245
NP_442320.1_8 Reverse -300 -314 -4.13031 0.148
NP_442003.1_4 Forward -192 -173 13.7658 0.234
NP_442815.1_2 Reverse -363 -381 4.24738 0.244
NP_442157.1_9 Reverse -242 -261 17.404 0.209
NP_440199.1_10 Reverse -324 -334 8.82982 0.229
NP_441057.1_4 Forward -238 -220 -2.93078 0.276
NP_440913.1_1 Forward -338 -320 8.86894 0.181
NP_442489.1_7 Forward -336 -327 -1.18024 0.18
NP_441706.1_10 Forward -32 -13 10.1275 0.235
NP_442079.1_7 Forward -107 -88 3.34271 0.212
NP_441659.2_8 Forward -115 -105 0.57002 0.262
NP_442776.1_1 Reverse -363 -382 8.84924 0.186
NP_442346.1_5 Reverse -183 -193 4.60159 0.281
NP_441653.1_2 Reverse -124 -143 5.17239 0.248
NP_441888.1_7 Reverse -130 -144 11.701 0.0781
NP_443022.1_3 Forward -94 -75 14.0608 0.258
NP_440946.1_6 Forward -101 -82 1.27776 0.294
NP_442140.1_3 Forward -314 -304 7.64985 0.133
NP_440875.1_9 Forward -313 -303 11.7788 0.152
NP_440590.1_1 Forward -51 -32 17.2065 0.166
NP_440590.1_4 Forward -143 -130 -5.58558 0.283
NP_441239.1_9 Reverse -319 -331 7.21714 0.169
NP_441892.1_1 Forward -339 -322 -2.22277 0.219
NP_440546.1_4 Forward -90 -80 6.94336 0.269
NP_439974.1_4 Reverse -357 -376 8.94757 0.261
NP_440675.1_1 Forward -99 -80 1.0811 0.299
NP_442340.1_3 Reverse -215 -234 -10.1286 0.282
NP_442611.1_1 Forward -237 -218 2.45773 0.218
NP_440401.1_9 Reverse -381 -388 14.5917 0.287
NP_440653.1_10 Forward -314 -295 3.6377 0.27
NP_442625.1_1 Forward -94 -75 4.03102 0.267
NP_441926.1_3 Forward -383 -367 3.10679 0.241
NP_440160.1_3 Reverse -242 -261 15.1416 0.159
NP_442532.1_7 Forward -315 -301 2.5562 0.235
NP_440914.1_1 Forward -336 -326 11.3477 0.097
NP_440914.1_1 Reverse -321 -331 8.71269 0.186
NP_440914.1_1 Reverse -351 -361 7.05364 0.254
NP_442533.1_1 Forward -60 -41 -17.2085 0.281
NP_442533.1_6 Forward -336 -327 4.0313 0.194
NP_441028.1_6 Reverse -149 -159 10.9926 0.193
NP_440116.1_5 Forward -368 -351 2.10379 0.282
NP_440116.1_5 Forward -111 -94 1.71047 0.298
NP_440608.1_6 Reverse -307 -326 3.73524 0.282
NP_441602.1_3 Forward -89 -70 -4.42544 0.265
NP_441106.1_3 Reverse -10 -29 14.7491 0.157
NP_442614.1_2 Reverse -258 -272 8.45605 0.255
NP_441463.1_3 Forward -370 -351 -9.44032 0.28
NP_442615.1_4 Reverse -330 -344 14.9459 0.226
NP_441993.1_1 Reverse -321 -340 6.81956 0.177
NP_440114.1_10 Forward -330 -316 8.45605 0.202
NP_440287.1_6 Forward -332 -313 1.17943 0.283
NP_440293.1_3 Forward -52 -33 -6.68705 0.291
NP_440293.1_10 Forward -143 -124 -1.7705 0.271
NP_440766.1_4 Reverse -224 -238 6.19444 0.104
NP_440766.1_4 Forward -171 -157 5.21113 0.113
NP_441421.1_1 Reverse -190 -209 23.3039 0.039
NP_442743.1_4 Reverse -63 -82 -7.37537 0.279
NP_441332.1_6 Forward -121 -111 11.1627 0.269
YP_003858595.1_2 Forward -269 -252 13.1161 0.0337
NP_441885.1_5 Reverse -327 -337 -0.118297 0.186
NP_442341.1_7 Reverse -227 -241 2.94952 0.239
NP_442341.1_9 Forward -332 -318 4.8172 0.291
NP_442395.2_4 Forward -366 -347 -0.689632 0.299
NP_440275.1_3 Reverse -88 -98 1.94665 0.277
NP_440091.1_1 Reverse -302 -314 -0.551008 0.278
NP_443060.1_5 Forward -245 -226 5.30853 0.271
NP_440866.1_1 Forward -375 -356 15.8299 0.235
NP_440175.1_7 Forward -100 -82 15.9994 0.119
NP_441105.1_3 Forward -341 -322 -5.70374 0.223
NP_440172.1_1 Reverse -351 -361 2.7333 0.268
NP_442015.1_10 Forward -340 -327 3.75586 0.178
NP_442015.1_10 Reverse -70 -83 1.78924 0.204
NP_440244.1_1 Reverse -359 -378 -10.0303 0.3
NP_440416.1_9 Reverse -320 -339 -11.0136 0.148
NP_440416.1_9 Forward -115 -96 -18.7818 0.264
NP_443052.1_8 Reverse -296 -315 -8.55534 0.175
NP_443052.1_9 Reverse -80 -99 3.44104 0.162
NP_443052.1_9 Reverse -130 -149 0.786102 0.191
NP_442154.1_1 Forward -98 -80 -4.50408 0.125
NP_440261.1_5 Reverse -375 -388 -6.66722 0.201
NP_440261.1_5 Reverse -75 -88 -10.8955 0.221
NP_440988.1_10 Reverse -325 -339 5.77014 0.24
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GACTGATTCTGTTTGGGGTTCATTGCCTGATTCTCGGCTACCTGATTGCCAAGTCACTATACCTGCCGAAGGCCATTGGGTATCTTGTGATGGCAGCTGGAGTCACCTATTTAATTGGTAGCTACACTCGATTTCTGTTCCCCGACTTTGTTGGAGCTGTGTCGCCGATTTACGTGGTGCCCATAGTGTCTGAACTCTCTCTGTGTCTGTGGTTGCTCATTAAAGGCGTCGACCTAGAACGCTGGAGGGAAGTTACAGGGAGTGCCGGCGTTGTGTAGTCCGCAGACCCCTCGTCTAACGCTCCGGTTGTAGCTCTGGGGGGTCCCACAGGTAATTACGTGATAAATGGCAGGCTGGGGACTGTATCCTTTTGATATCAAAGGTAACGGTTAAAGAACTA

CDS

ATGCAGGTGCTTACCTACCTCAAGTTCAGGCTCAATGCAGCTGAACAAGAGGAATTGTTGGCTGACTATCTACCTTTTTGCGAAACAGTGGAGATACCCAACCCTCCACCGCCAACTCCCCTATGTAGAGATCCCTTTGATGTGCCCTTTTTGGTCTTGGCATTGGTTGGGCAGGCTGATTACTTAATTACAGGGGACAAAGACCTACTGGAACTGGAGGAGCCTTTTCCCTGTCCGATTGTTGCGTTAGAGCAGTTTTTGTTTAAATGA

Protein

No sequence available