Your browser is old and dusty. Try Google Chrome!

Details for ssl7045

ORF ssl7045
Accession NP_942333.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -171 -185 14.6509 0.127
NP_441061.1_2 Reverse -114 -128 -2.36035 0.29
NP_441418.1_6 Forward -388 -369 -20.5517 0.117
NP_441418.1_6 Reverse -162 -181 -20.5517 0.117
NP_441818.1_9 Reverse -165 -184 -9.73531 0.291
NP_442655.1_10 Reverse -159 -178 -10.1286 0.22
NP_443002.1_5 Reverse -114 -132 13.1947 0.212
NP_443027.1_4 Reverse -143 -153 15.8113 0.0437
NP_440908.1_2 Reverse -369 -382 15.9483 0.269
NP_439918.1_2 Forward -128 -109 11.2092 0.126
NP_439918.1_2 Forward -134 -115 -5.11376 0.298
NP_441208.1_9 Forward -62 -48 5.60446 0.267
NP_441925.1_4 Forward -184 -165 -4.91784 0.177
NP_441925.1_4 Forward -180 -161 -15.9309 0.275
NP_441083.1_5 Forward -191 -181 5.48657 0.116
NP_442841.1_5 Forward -235 -216 18.2882 0.209
NP_441434.1_3 Reverse -49 -68 -2.16383 0.262
NP_441738.1_2 Forward -152 -145 6.03696 0.295
NP_441713.1_8 Forward -380 -362 7.4923 0.294
NP_441770.1_1 Forward -184 -165 13.8633 0.277
NP_442570.1_3 Forward -125 -106 -4.22878 0.228
NP_442570.1_3 Forward -131 -112 -7.08038 0.265
NP_441792.1_5 Reverse -114 -130 9.59664 0.234
NP_441716.1_1 Reverse -208 -222 6.58777 0.195
NP_442111.1_4 Reverse -378 -392 3.04785 0.257
NP_441163.1_1 Forward -93 -76 6.23297 0.264
NP_440343.1_3 Forward -184 -166 14.768 0.0883
NP_441130.1_10 Forward -173 -159 5.30946 0.236
NP_442145.1_3 Forward -199 -180 9.63589 0.243
NP_441014.1_8 Forward -184 -165 10.1275 0.118
NP_441014.1_8 Forward -176 -157 -7.76869 0.281
NP_441014.1_10 Forward -55 -36 -2.36125 0.274
NP_442848.1_1 Forward -197 -183 2.16287 0.188
NP_441012.1_4 Forward -303 -290 7.09911 0.272
NP_441634.1_8 Reverse -166 -180 1.76955 0.181
NP_440376.1_1 Reverse -391 -400 -0.393597 0.289
NP_442191.1_4 Reverse -163 -177 14.0957 0.115
NP_441846.1_10 Reverse -161 -180 -4.03212 0.156
NP_440642.1_10 Forward -56 -42 5.1122 0.242
NP_441388.1_10 Reverse -117 -134 15.4289 0.176
NP_441950.1_7 Reverse -156 -175 -8.45701 0.287
NP_442782.1_2 Forward -122 -108 0.392915 0.29
NP_441414.1_9 Reverse -193 -212 -8.16202 0.23
NP_442300.1_1 Forward -125 -106 11.8975 0.174
NP_442937.1_5 Forward -142 -123 7.86593 0.241
NP_440203.1_5 Reverse -116 -126 10.5993 0.218
NP_440995.1_8 Forward -164 -145 3.83436 0.264
NP_441338.2_9 Reverse -50 -69 13.6675 0.146
NP_442911.1_2 Forward -201 -182 -6.29373 0.18
NP_443055.1_6 Forward -185 -167 -0.571569 0.263
NP_441646.1_1 Reverse -175 -194 2.85105 0.211
NP_440147.1_4 Reverse -180 -193 6.4108 0.0939
NP_440147.1_4 Forward -390 -377 -0.570702 0.291
NP_441916.1_10 Forward -199 -180 6.68596 0.202
NP_440569.1_10 Forward -229 -210 2.7211 0.285
NP_440703.1_9 Reverse -120 -133 4.93527 0.293
NP_440289.1_2 Reverse -205 -218 -2.73398 0.262
NP_440289.1_2 Forward -194 -181 -3.91395 0.273
NP_440260.1_8 Forward -138 -120 -3.32411 0.251
NP_442281.1_1 Reverse -109 -123 3.04726 0.246
NP_442281.1_1 Reverse -140 -154 2.5556 0.263
NP_442575.1_8 Reverse -39 -58 16.8141 0.124
NP_440437.1_1 Forward -183 -164 -2.65548 0.22
NP_440437.1_1 Forward -177 -158 -4.52377 0.261
NP_442012.1_1 Reverse -348 -367 3.34271 0.18
NP_442029.1_6 Forward -128 -109 8.84924 0.2
NP_440253.1_2 Reverse -168 -186 -3.42244 0.294
NP_442554.1_9 Forward -141 -122 12.5018 0.279
NP_442142.1_9 Reverse -155 -174 5.01433 0.282
NP_443009.1_5 Forward -364 -353 4.28642 0.254
NP_442301.1_2 Forward -178 -159 6.1935 0.263
NP_442301.1_2 Reverse -112 -131 3.53858 0.293
NP_443034.1_4 Forward -278 -259 20.7473 0.118
NP_441448.1_2 Reverse -115 -134 -1.96793 0.29
NP_440464.1_10 Reverse -246 -256 12.1487 0.253
NP_441015.1_10 Reverse -163 -182 -6.68705 0.253
NP_441015.1_10 Reverse -160 -179 -8.16202 0.272
NP_442253.1_5 Forward -194 -177 -2.41943 0.282
NP_441826.1_1 Reverse -163 -179 19.8231 0.127
NP_441612.1_2 Forward -191 -181 6.80666 0.277
NP_442227.1_2 Forward -175 -156 3.73603 0.215
NP_442361.1_3 Forward -394 -381 10.344 0.272
NP_442808.1_1 Forward -178 -168 5.97777 0.134
NP_442808.1_1 Forward -172 -162 5.38779 0.155
NP_442113.1_10 Forward -181 -162 -1.96717 0.205
NP_442050.1_5 Forward -156 -146 9.22267 0.193
NP_442050.1_8 Reverse -165 -184 13.1123 0.272
NP_441114.1_3 Reverse -115 -124 7.37455 0.239
NP_440558.1_2 Reverse -110 -129 -4.42544 0.245
NP_441878.1_6 Reverse -161 -171 -7.19813 0.21
NP_442650.1_2 Forward -363 -349 2.65453 0.254
NP_441590.1_4 Forward -184 -165 7.37347 0.249
NP_442267.1_4 Forward -119 -100 5.99764 0.185
NP_442777.1_1 Reverse -323 -342 5.60352 0.276
NP_442183.1_1 Forward -154 -140 5.70279 0.206
NP_442183.1_3 Forward -178 -159 15.9282 0.241
NP_442183.1_9 Reverse -165 -175 17.2863 0.206
NP_441638.1_10 Forward -134 -120 16.2242 0.245
NP_442645.1_2 Reverse -174 -193 -21.6334 0.29
NP_442888.1_6 Forward -188 -169 7.57094 0.204
NP_442594.1_8 Reverse -160 -179 10.7175 0.175
NP_442590.1_10 Reverse -165 -184 8.75091 0.204
NP_441007.1_10 Reverse -157 -170 0.314277 0.233
NP_442334.1_1 Forward -166 -147 -4.52377 0.259
NP_442860.1_7 Reverse -9 -27 11.3158 0.283
NP_440915.1_5 Reverse -166 -185 14.6161 0.283
NP_441464.1_10 Forward -131 -117 9.5377 0.262
NP_441464.1_10 Reverse -166 -180 9.04604 0.265
NP_440702.1_2 Forward -378 -359 -6.29373 0.257
NP_442453.1_6 Forward -180 -166 17.4314 0.156
NP_441199.1_6 Forward -175 -156 -0.688862 0.277
NP_442386.1_9 Forward -186 -177 4.7192 0.289
NP_442386.1_9 Forward -172 -163 4.52254 0.297
NP_440327.1_6 Forward -134 -115 10.3242 0.192
NP_441160.1_1 Reverse -43 -62 -10.817 0.273
NP_440586.1_8 Reverse -219 -226 7.1186 0.272
NP_442294.1_3 Reverse -279 -293 12.192 0.29
NP_439943.1_7 Forward -128 -109 4.52268 0.278
NP_441789.1_7 Forward -179 -160 4.03023 0.193
NP_442121.1_4 Forward -396 -377 -1.57384 0.226
NP_441018.1_7 Forward -133 -114 10.9142 0.194
NP_441018.1_7 Forward -374 -355 8.25926 0.253
NP_441018.1_7 Forward -132 -113 6.39097 0.289
NP_441689.1_5 Reverse -143 -153 8.23937 0.142
NP_442910.1_1 Reverse -347 -366 1.67108 0.129
NP_441965.1_10 Forward -157 -141 8.61333 0.123
NP_442187.1_3 Reverse -167 -177 13.943 0.232
NP_442280.1_10 Forward -138 -120 8.47384 0.258
NP_440999.1_9 Forward -181 -167 -0.393733 0.205
NP_440999.1_9 Forward -175 -161 -2.85201 0.279
NP_440888.1_2 Reverse -145 -159 5.99717 0.254
NP_441543.1_2 Reverse -380 -389 4.0313 0.293
NP_442845.1_2 Forward -376 -362 7.27608 0.195
NP_441304.1_10 Forward -234 -225 12.6844 0.294
NP_440220.1_4 Forward -67 -48 -0.00131823 0.257
NP_443062.1_1 Forward -154 -136 7.18082 0.182
NP_443062.1_6 Forward -130 -111 0.294447 0.299
NP_441351.1_8 Reverse -43 -62 1.0811 0.276
NP_441785.1_1 Reverse -182 -196 14.5805 0.161
NP_442080.1_7 Forward -52 -33 0.884433 0.227
NP_441120.1_6 Forward -243 -224 19.0757 0.134
NP_441884.1_9 Reverse -374 -393 -21.4367 0.245
NP_441884.1_9 Reverse -144 -163 -22.42 0.278
NP_440041.1_2 Forward -130 -111 0.491109 0.187
NP_441004.1_1 Reverse -156 -175 -10.6203 0.224
NP_441004.1_1 Forward -206 -187 -14.9469 0.271
NP_441004.1_1 Forward -128 -109 -15.1435 0.273
NP_441004.1_3 Reverse -168 -187 14.3558 0.0778
NP_442873.1_2 Forward -184 -165 11.8967 0.224
NP_442206.1_10 Forward -154 -139 6.46974 0.178
NP_443054.1_2 Reverse -49 -63 0.786239 0.254
NP_443054.1_2 Reverse -159 -173 -0.0987402 0.284
NP_440864.1_9 Forward -380 -361 4.916 0.119
NP_441851.1_10 Forward -364 -354 4.69992 0.254
NP_441982.1_6 Reverse -197 -206 11.244 0.288
NP_442709.1_3 Forward -370 -351 3.53937 0.284
NP_441046.1_2 Forward -232 -213 12.2908 0.182
NP_441349.1_10 Reverse -172 -191 -4.81876 0.183
NP_441349.1_10 Forward -227 -208 -7.76869 0.258
NP_440432.1_9 Forward -170 -155 -3.95334 0.194
NP_440588.1_2 Reverse -257 -276 -5.9004 0.264
NP_441003.1_9 Reverse -110 -129 15.8307 0.207
NP_442243.1_1 Reverse -113 -131 0.706727 0.228
NP_441570.1_1 Forward -128 -110 -1.35749 0.0562
NP_441078.1_4 Forward -191 -182 4.81794 0.126
NP_441078.1_4 Reverse -182 -191 -1.27858 0.246
NP_442729.1_8 Reverse -351 -364 8.27909 0.125
NP_440526.1_3 Forward -170 -159 2.22148 0.267
NP_441432.1_8 Forward -123 -114 2.65466 0.292
NP_441732.1_2 Forward -195 -179 -15.8711 0.163
NP_440578.1_10 Forward -137 -118 14.9458 0.246
NP_441945.1_10 Forward -129 -110 12.2908 0.22
NP_441706.1_10 Forward -312 -293 10.1275 0.235
NP_442079.1_7 Forward -387 -368 3.34271 0.212
NP_442079.1_7 Reverse -146 -165 2.26107 0.232
NP_440559.1_1 Reverse -39 -48 7.17789 0.11
NP_441659.2_8 Forward -395 -385 0.57002 0.262
NP_442913.1_10 Forward -200 -181 -6.29373 0.3
NP_441800.1_7 Forward -176 -158 0.0191479 0.219
NP_440779.1_5 Forward -171 -154 -14.5141 0.246
NP_441629.1_3 Forward -184 -165 9.04509 0.177
NP_440459.1_2 Reverse -36 -53 10.7569 0.192
NP_440010.1_3 Reverse -64 -83 -5.21209 0.25
NP_442311.1_5 Forward -125 -106 3.14605 0.247
NP_440847.1_3 Forward -184 -170 10.6187 0.287
NP_443022.1_3 Forward -374 -355 14.0608 0.258
NP_440946.1_6 Forward -381 -362 1.27776 0.294
NP_442055.1_8 Forward -145 -126 12.1917 0.254
NP_441973.1_1 Forward -140 -125 0.176559 0.236
NP_440772.1_8 Forward -197 -178 7.07928 0.296
NP_442140.1_3 Forward -46 -36 4.50326 0.243
NP_441813.1_7 Reverse -28 -42 9.93039 0.235
NP_440590.1_1 Forward -331 -312 17.2065 0.166
NP_442839.1_10 Reverse -109 -123 12.8809 0.288
NP_440227.1_3 Reverse -178 -197 14.0608 0.254
NP_441951.1_7 Forward -73 -59 15.9379 0.278
NP_440604.1_6 Forward -154 -135 1.17943 0.162
NP_442643.1_8 Forward -54 -36 22.8311 0.0148
NP_440833.1_6 Reverse -220 -234 7.96378 0.277
NP_440546.1_4 Forward -370 -360 6.94336 0.269
NP_440675.1_1 Forward -379 -360 1.0811 0.299
NP_440462.1_6 Reverse -143 -153 4.60159 0.194
NP_441249.1_8 Reverse -162 -181 6.88262 0.233
NP_441474.1_1 Forward -267 -248 2.85027 0.247
NP_442402.1_4 Reverse -185 -204 -6.49113 0.259
NP_441848.1_4 Reverse -11 -27 11.0839 0.232
NP_441084.1_6 Reverse -117 -131 12.9315 0.152
NP_442039.1_4 Forward -153 -146 7.80726 0.24
NP_442625.1_1 Forward -374 -355 4.03102 0.267
NP_440914.1_1 Reverse -114 -124 8.41992 0.191
NP_440914.1_1 Forward -85 -75 6.66328 0.269
NP_442533.1_1 Reverse -165 -184 -12.8819 0.236
NP_442533.1_1 Forward -340 -321 -17.2085 0.281
NP_442322.1_4 Reverse -106 -123 -8.8116 0.286
NP_441028.1_6 Reverse -81 -91 12.6642 0.183
NP_441028.1_6 Forward -57 -47 10.1076 0.21
NP_440116.1_5 Forward -391 -374 1.71047 0.298
NP_440007.1_9 Reverse -110 -124 0.589577 0.294
NP_441602.1_3 Forward -128 -109 -2.16383 0.233
NP_441602.1_3 Forward -369 -350 -4.42544 0.265
NP_441972.1_5 Reverse -134 -153 -5.70374 0.224
NP_441106.1_3 Reverse -290 -309 14.7491 0.157
NP_439903.1_6 Forward -63 -44 0.490334 0.261
NP_440886.1_7 Forward -178 -168 7.15773 0.103
NP_440886.1_7 Forward -172 -162 6.66608 0.115
NP_440460.1_10 Reverse -181 -200 16.7157 0.234
NP_442264.1_5 Forward -123 -109 10.6193 0.292
NP_439967.1_7 Forward -192 -174 12.0155 0.176
NP_442365.1_9 Forward -73 -54 19.174 0.0866
NP_441962.1_4 Reverse -177 -196 -13.8652 0.279
NP_441742.1_9 Forward -250 -231 19.3707 0.271
NP_440387.1_1 Forward -191 -175 -0.138127 0.135
NP_441431.1_2 Reverse -110 -124 6.58715 0.266
NP_441836.1_2 Reverse -165 -184 -0.295539 0.212
NP_441993.1_1 Reverse -162 -181 8.96362 0.136
NP_442805.1_5 Forward -181 -162 -6.58946 0.29
NP_440293.1_3 Forward -130 -111 1.67108 0.207
NP_440293.1_3 Forward -332 -313 -6.68705 0.291
NP_442743.1_4 Reverse -343 -362 -7.37537 0.279
NP_442278.1_4 Forward -234 -215 17.404 0.203
NP_440142.1_3 Forward -117 -98 11.2092 0.282
NP_443037.1_8 Forward -137 -118 10.0292 0.242
NP_442514.1_5 Reverse -101 -120 -3.04956 0.222
NP_440554.1_4 Forward -153 -143 5.09324 0.162
NP_441885.1_5 Reverse -182 -192 0.373358 0.164
NP_441885.1_5 Forward -191 -181 -0.806614 0.228
NP_440628.1_1 Forward -237 -227 14.356 0.279
NP_440478.1_4 Forward -77 -58 13.2741 0.197
NP_442341.1_7 Reverse -181 -195 14.3559 0.0299
NP_440423.1_6 Reverse -200 -219 -15.6352 0.229
NP_440275.1_3 Reverse -368 -378 1.94665 0.277
NP_440175.1_7 Forward -380 -362 15.9994 0.119
NP_442373.1_2 Reverse -159 -178 -5.80207 0.227
NP_440216.1_1 Reverse -168 -182 -12.6851 0.296
NP_442015.1_10 Reverse -350 -363 1.78924 0.204
NP_442329.1_9 Forward -276 -257 16.4199 0.272
NP_441226.1_7 Forward -184 -177 5.34865 0.289
NP_440416.1_9 Forward -395 -376 -18.7818 0.264
NP_443052.1_9 Reverse -360 -379 3.44104 0.162
NP_443052.1_9 Reverse -58 -77 2.65439 0.169
NP_440591.1_9 Reverse -161 -179 9.95058 0.135
NP_442154.1_1 Reverse -160 -178 13.4905 0.0201
NP_442154.1_1 Forward -378 -360 -4.50408 0.125
NP_442154.1_1 Forward -121 -103 -5.78238 0.127
NP_442154.1_1 Reverse -169 -187 -16.8938 0.246
NP_440261.1_5 Reverse -355 -368 -10.8955 0.221
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CGCAGACCCCTCGTCTAACGCTCCGGTTGTAGCTCTGGGGGGTCCCACAGGTAATTACGTGATAAATGGCAGGCTGGGGACTGTATCCTTTTGATATCAAAGGTAACGGTTAAAGAACTAATGCAGGTGCTTACCTACCTCAAGTTCAGGCTCAATGCAGCTGAACAAGAGGAATTGTTGGCTGACTATCTACCTTTTTGCGAAACAGTGGAGATACCCAACCCTCCACCGCCAACTCCCCTATGTAGAGATCCCTTTGATGTGCCCTTTTTGGTCTTGGCATTGGTTGGGCAGGCTGATTACTTAATTACAGGGGACAAAGACCTACTGGAACTGGAGGAGCCTTTTCCCTGTCCGATTGTTGCGTTAGAGCAGTTTTTGTTTAAATGAATGGGTCTGG

CDS

GTGGCTGCTAAACTCTCTTGCGCTGTTGAGGGCAACTTCCGTAAAGAAGCTGGACTAGTTTTAAGAAGTGCAGGGAGAGTAAAGACAATAAGTGCGGACCCTCTACCCCTAACCAAAGGCTTCCCGCAACCCGGAGAATCAGGCGTAGTCGGAAGTGATGATGTGGCTGTACAGACCCAGGGGGGTGTCGACGGCGATTACTGGGGTTTGTTAGAGTCATAG

Protein

No sequence available