Your browser is old and dusty. Try Google Chrome!

Details for ssl7039

ORF ssl7039
Accession NP_942327.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -166 -180 -0.590395 0.234
NP_441343.1_5 Forward -292 -273 10.7175 0.212
NP_441453.1_4 Forward -354 -346 5.32929 0.147
NP_441453.1_7 Reverse -260 -267 12.9205 0.23
NP_441623.1_1 Forward -237 -219 -3.6191 0.262
NP_441818.1_9 Reverse -322 -341 -7.76869 0.273
NP_442169.1_1 Reverse -209 -228 6.58763 0.26
NP_442173.1_1 Forward -353 -345 8.86921 0.0882
NP_442752.1_4 Reverse -345 -352 4.46401 0.269
NP_442975.1_10 Forward -124 -110 2.16228 0.283
NP_441250.1_3 Forward -287 -268 2.0644 0.28
NP_442062.1_8 Reverse -189 -199 8.33817 0.0769
NP_441995.1_6 Forward -317 -298 16.3224 0.259
NP_440304.1_4 Reverse -343 -353 6.27322 0.167
NP_439918.1_2 Reverse -65 -84 -3.24547 0.251
NP_441200.1_4 Reverse -172 -191 12.3892 0.172
NP_441208.1_9 Forward -357 -343 12.1926 0.141
NP_442196.1_10 Reverse -219 -238 9.73422 0.28
NP_441083.1_5 Reverse -345 -355 7.25653 0.0608
NP_441083.1_5 Forward -354 -344 0.57002 0.223
NP_442765.1_4 Reverse -143 -162 14.5524 0.244
NP_440447.1_6 Forward -362 -344 5.91901 0.145
NP_441713.1_1 Forward -360 -341 -5.11376 0.113
NP_440178.1_7 Reverse -159 -178 -22.8133 0.279
NP_440053.1_2 Reverse -327 -346 10.2259 0.291
NP_442111.1_4 Forward -355 -341 6.58777 0.12
NP_440343.1_3 Forward -79 -61 9.35981 0.184
NP_440747.1_10 Forward -357 -345 -3.99259 0.0763
NP_442848.1_5 Forward -123 -105 -3.22577 0.29
NP_440376.1_1 Reverse -345 -354 13.4711 0.016
NP_440376.1_1 Forward -354 -345 0.491382 0.273
NP_442730.1_8 Reverse -169 -188 6.48849 0.228
NP_442687.1_7 Reverse -344 -354 4.50326 0.245
NP_440642.1_10 Forward -124 -110 2.35894 0.277
NP_441682.1_6 Reverse -319 -338 12.1925 0.291
NP_442198.1_7 Reverse -342 -361 11.11 0.214
NP_442782.1_2 Reverse -178 -192 1.47456 0.281
NP_441414.1_9 Forward -391 -372 -6.68705 0.201
NP_440607.1_8 Reverse -205 -224 4.22769 0.209
NP_441317.1_4 Forward -31 -17 9.84592 0.29
NP_441958.1_5 Reverse -344 -354 9.41981 0.0219
NP_441958.1_5 Forward -355 -345 1.25834 0.108
NP_441097.1_2 Reverse -203 -220 4.6604 0.278
NP_443055.1_6 Reverse -298 -316 3.26332 0.199
NP_442853.1_6 Forward -195 -176 21.8214 0.053
NP_441099.1_5 Forward -364 -345 -0.4922 0.0937
NP_441646.1_1 Reverse -153 -172 0.294447 0.252
NP_440147.1_4 Reverse -175 -188 9.2624 0.0423
NP_440147.1_4 Forward -356 -343 2.77255 0.202
NP_441550.1_8 Forward -356 -346 7.35439 0.164
NP_441550.1_8 Reverse -343 -353 6.66608 0.198
NP_441550.1_8 Reverse -175 -185 5.09279 0.267
NP_441916.1_7 Reverse -345 -355 5.68323 0.124
NP_441041.1_4 Forward -186 -167 3.04771 0.0679
NP_441041.1_4 Reverse -345 -364 -11.9969 0.256
NP_441041.1_4 Reverse -201 -220 -12.8819 0.276
NP_441041.1_7 Forward -357 -345 6.05711 0.226
NP_441041.1_7 Forward -310 -298 5.95994 0.231
NP_440016.1_9 Forward -222 -203 10.7175 0.259
NP_442004.1_6 Reverse -356 -370 3.24451 0.244
NP_439966.1_7 Forward -75 -65 5.68278 0.214
NP_441514.1_6 Forward -264 -257 14.2971 0.248
NP_442281.1_1 Forward -191 -177 2.75226 0.257
NP_442281.1_1 Forward -359 -345 1.86729 0.285
NP_441087.1_6 Forward -239 -221 0.608397 0.258
NP_441644.1_1 Reverse -201 -220 12.8808 0.15
NP_441644.1_6 Forward -354 -344 16.1058 0.0048
NP_441644.1_6 Forward -186 -176 3.22451 0.293
NP_442215.1_2 Reverse -343 -359 -5.64466 0.254
NP_442029.1_6 Reverse -172 -191 14.6508 0.108
NP_442029.1_10 Reverse -174 -193 10.0292 0.211
NP_440929.1_8 Forward -354 -345 7.47288 0.0713
NP_440929.1_8 Reverse -165 -174 0.786375 0.299
NP_440929.1_9 Forward -358 -344 12.9793 0.279
NP_442933.1_2 Forward -99 -81 7.06839 0.268
NP_441751.2_8 Forward -353 -339 -2.65535 0.133
NP_442554.1_8 Reverse -346 -356 2.33998 0.274
NP_442142.1_4 Reverse -349 -362 4.14862 0.231
NP_442301.1_2 Forward -240 -221 5.89851 0.263
NP_441715.1_5 Forward -116 -106 18.3674 0.219
NP_441198.1_5 Forward -352 -339 11.9167 0.245
NP_441020.2_6 Reverse -226 -243 8.20031 0.205
NP_441015.1_10 Forward -185 -166 -8.94866 0.278
NP_441015.1_10 Forward -396 -377 -10.7186 0.287
NP_441015.1_10 Reverse -334 -353 -11.5053 0.298
NP_441673.1_1 Forward -354 -345 1.57302 0.0764
NP_441673.1_1 Reverse -345 -354 1.57302 0.0764
NP_442719.1_2 Reverse -279 -297 2.77167 0.162
NP_442808.1_1 Forward -223 -213 2.5362 0.263
NP_440871.1_2 Reverse -132 -151 11.7992 0.289
NP_440145.1_3 Reverse -335 -354 -1.08219 0.146
NP_440630.1_3 Reverse -219 -238 1.76941 0.287
NP_440162.1_2 Forward -145 -126 12.1925 0.249
NP_441878.1_6 Forward -355 -345 1.55333 0.0937
NP_441557.1_2 Reverse -301 -319 16.2438 0.253
NP_441557.1_5 Forward -354 -345 0.688044 0.128
NP_441557.1_5 Reverse -345 -354 0.688044 0.128
NP_440101.1_3 Forward -280 -261 2.16274 0.259
NP_442183.1_1 Reverse -336 -350 4.62115 0.254
NP_442183.1_9 Reverse -185 -195 9.41981 0.296
NP_440440.1_2 Forward -239 -220 13.2733 0.282
NP_441549.1_1 Reverse -256 -275 13.8633 0.281
NP_442347.1_2 Forward -78 -69 3.7363 0.284
NP_442347.1_2 Forward -185 -176 2.85133 0.299
NP_442645.1_2 Forward -373 -354 -22.6167 0.292
NP_442508.1_8 Forward -386 -369 10.8552 0.266
NP_441633.1_3 Forward -124 -111 -5.58558 0.236
NP_441633.1_3 Forward -277 -264 -5.78224 0.236
NP_442590.1_10 Forward -186 -167 10.5209 0.181
NP_442998.1_10 Forward -352 -345 6.13563 0.181
NP_440299.1_1 Reverse -280 -293 3.65697 0.237
NP_440299.1_1 Reverse -173 -186 2.08368 0.299
NP_441799.1_1 Forward -329 -315 6.98048 0.155
NP_440256.1_1 Reverse -174 -193 -6.88371 0.223
NP_440087.1_1 Reverse -336 -355 -2.0655 0.197
NP_441559.1_8 Forward -268 -254 -7.76856 0.299
NP_440915.1_6 Reverse -341 -355 8.55439 0.0533
NP_441296.1_7 Reverse -255 -274 13.9625 0.267
NP_440733.1_2 Reverse -17 -35 11.079 0.293
NP_440717.1_3 Reverse -166 -180 8.94708 0.25
NP_442866.1_1 Reverse -340 -359 -5.31042 0.24
NP_440748.1_5 Reverse -173 -192 -0.0988766 0.253
NP_440748.1_5 Reverse -162 -181 -0.4922 0.26
NP_440748.1_5 Forward -195 -176 -3.54046 0.298
NP_441199.1_6 Forward -358 -339 11.1109 0.0685
NP_442993.1_1 Forward -263 -247 -9.47957 0.186
NP_441340.1_5 Reverse -346 -353 3.97235 0.274
NP_442484.1_2 Reverse -166 -185 4.32602 0.187
NP_440327.1_6 Reverse -177 -196 2.55606 0.294
NP_439976.1_4 Reverse -294 -313 7.4718 0.278
NP_440586.1_1 Reverse -203 -222 -3.83545 0.273
NP_441262.1_3 Reverse -345 -352 5.25066 0.215
NP_443051.1_1 Reverse -344 -353 7.07956 0.0616
NP_443051.1_1 Forward -355 -346 -1.18024 0.297
NP_439937.1_9 Reverse -2 -19 -11.4665 0.256
NP_440408.1_7 Forward -180 -161 8.35759 0.281
NP_440439.1_1 Reverse -342 -355 1.00259 0.164
NP_439943.1_4 Forward -186 -167 8.55425 0.256
NP_440372.1_2 Reverse -346 -353 4.26735 0.221
NP_440171.1_3 Reverse -126 -145 1.96607 0.29
NP_441789.1_7 Forward -244 -225 -3.04956 0.268
NP_442887.1_5 Reverse -163 -182 -3.54046 0.264
NP_442384.1_10 Forward -186 -173 11.9173 0.0319
NP_441980.1_9 Reverse -338 -357 14.2574 0.298
NP_441604.1_4 Forward -362 -343 -7.08038 0.293
NP_441631.1_4 Forward -179 -160 14.7491 0.17
NP_442790.1_4 Reverse -336 -355 -15.5368 0.294
NP_440282.1_10 Forward -381 -362 -6.68705 0.25
NP_440531.1_8 Reverse -219 -238 1.67108 0.298
NP_442693.1_6 Reverse -171 -190 4.42435 0.278
NP_442280.1_10 Reverse -167 -185 17.0451 0.0964
NP_441896.1_3 Reverse -212 -231 6.78429 0.1
NP_441103.1_9 Forward -241 -231 12.7825 0.284
NP_442553.1_4 Reverse -128 -147 11.9958 0.179
NP_440834.1_2 Reverse -250 -269 11.2084 0.275
NP_440888.1_2 Reverse -254 -268 7.57046 0.19
NP_440888.1_2 Forward -354 -340 5.99717 0.254
NP_442807.1_10 Reverse -208 -222 14.4542 0.224
NP_441917.1_2 Forward -183 -165 4.54237 0.288
NP_442845.1_2 Reverse -339 -353 4.62115 0.256
NP_440710.1_1 Reverse -337 -355 -8.92897 0.287
NP_441462.1_2 Reverse -345 -355 16.893 0.00406
NP_441462.1_2 Forward -354 -344 0.963343 0.109
NP_441621.1_7 Reverse -140 -154 -6.49025 0.295
NP_443062.1_1 Forward -186 -168 5.91323 0.215
NP_440939.1_5 Reverse -210 -226 10.5799 0.273
NP_440349.1_3 Forward -215 -196 9.53674 0.299
NP_440519.1_3 Reverse -255 -274 12.5858 0.167
NP_440519.1_8 Reverse -207 -223 4.48343 0.223
NP_442204.1_1 Forward -190 -179 1.04198 0.281
NP_441560.1_10 Forward -362 -343 19.9606 0.0867
NP_440516.1_8 Reverse -345 -354 7.37455 0.0648
NP_440516.1_8 Forward -354 -345 5.40793 0.114
NP_441867.1_2 Forward -317 -298 -17.5035 0.291
NP_440673.1_3 Forward -352 -345 9.67555 0.179
NP_441052.1_2 Forward -371 -361 2.04498 0.22
NP_440436.1_4 Forward -364 -355 4.52254 0.256
NP_440314.1_9 Forward -353 -334 1.76941 0.0872
NP_441719.1_6 Forward -241 -222 7.07848 0.269
NP_441004.1_1 Reverse -216 -235 -13.4719 0.257
NP_441004.1_1 Forward -389 -370 -13.9635 0.263
NP_441004.1_1 Reverse -195 -214 -15.2418 0.273
NP_441004.1_1 Reverse -261 -280 -17.1101 0.289
NP_441004.1_3 Reverse -204 -223 3.24438 0.262
NP_441004.1_4 Reverse -111 -121 7.84651 0.286
NP_441004.1_5 Reverse -263 -277 12.1926 0.24
NP_442813.1_4 Reverse -258 -277 0.58944 0.197
NP_442813.1_4 Forward -145 -126 -5.11376 0.299
NP_442366.1_5 Reverse -174 -184 10.5993 0.251
NP_440296.1_6 Reverse -26 -44 10.8881 0.295
NP_441683.1_7 Forward -308 -289 -11.9969 0.284
NP_441046.1_2 Forward -298 -279 1.76941 0.255
NP_442843.1_1 Forward -315 -296 -4.81876 0.239
NP_440474.1_8 Forward -353 -339 4.71887 0.268
NP_441477.1_10 Reverse -230 -248 3.75572 0.211
NP_440588.1_3 Reverse -33 -52 9.0459 0.291
NP_442006.1_2 Forward -269 -252 -17.7591 0.282
NP_441570.1_1 Forward -371 -353 -2.83245 0.0679
NP_441078.1_4 Reverse -345 -354 0.393051 0.205
NP_441078.1_4 Forward -354 -345 0.393051 0.205
NP_442729.1_5 Forward -181 -171 14.6313 0.214
NP_440707.1_9 Reverse -205 -224 6.09597 0.235
NP_442443.1_1 Reverse -205 -224 -4.22878 0.268
NP_441432.1_8 Reverse -344 -353 4.52295 0.206
NP_441432.1_8 Reverse -176 -185 3.14632 0.259
NP_441432.1_9 Forward -147 -134 12.9614 0.189
NP_441432.1_9 Reverse -281 -294 10.3436 0.252
NP_441732.1_2 Forward -358 -342 -16.9527 0.223
NP_442003.1_4 Forward -185 -166 11.2092 0.278
NP_440760.1_1 Reverse -345 -364 -20.2567 0.222
NP_440199.1_10 Reverse -359 -369 11.5831 0.154
NP_441057.1_4 Reverse -297 -315 -1.25915 0.272
NP_440281.1_8 Forward -323 -304 11.6025 0.196
NP_440713.1_4 Forward -184 -165 4.62101 0.226
NP_442489.1_7 Forward -354 -345 1.08137 0.109
NP_442489.1_7 Reverse -345 -354 0.884706 0.145
NP_440559.1_1 Reverse -346 -355 5.01461 0.161
NP_441659.2_8 Forward -354 -344 8.33817 0.0443
NP_441659.2_8 Reverse -345 -355 6.8632 0.0663
NP_441800.1_10 Reverse -266 -285 3.6377 0.252
NP_442346.1_5 Reverse -361 -371 4.40493 0.29
NP_440545.1_3 Reverse -341 -358 -1.0428 0.162
NP_440545.1_3 Reverse -138 -155 -2.3211 0.183
NP_440545.1_3 Forward -358 -341 -4.77938 0.232
NP_440831.1_3 Reverse -219 -238 6.29006 0.275
NP_441629.1_3 Forward -223 -204 2.16195 0.218
NP_440486.1_6 Forward -175 -156 6.09597 0.283
NP_441126.1_8 Reverse -108 -121 12.409 0.291
NP_442934.1_8 Reverse -331 -350 7.27595 0.266
NP_440459.1_2 Forward -324 -307 8.10198 0.27
NP_440847.1_3 Forward -220 -206 11.602 0.261
NP_440847.1_3 Reverse -372 -386 10.5204 0.291
NP_442603.1_7 Reverse -345 -359 5.89884 0.269
NP_442828.1_7 Reverse -218 -237 -4.6221 0.276
NP_441358.1_4 Forward -60 -41 21.0414 0.0652
NP_441895.1_2 Reverse -125 -144 -17.6018 0.234
NP_441895.1_2 Reverse -172 -191 -26.7466 0.247
NP_441895.1_10 Reverse -215 -234 -27.7299 0.29
NP_442162.1_9 Forward -353 -346 3.4807 0.246
NP_442162.1_9 Reverse -346 -353 3.38237 0.276
NP_440671.1_4 Reverse -201 -215 6.98109 0.23
NP_441227.1_7 Reverse -346 -365 13.5447 0.273
NP_440590.1_4 Reverse -346 -359 -5.38892 0.277
NP_442497.1_10 Reverse -346 -355 0.589713 0.153
NP_440227.1_2 Reverse -89 -105 11.9566 0.271
NP_441239.1_9 Forward -277 -265 4.36554 0.253
NP_441951.1_9 Forward -353 -334 4.62101 0.254
NP_440604.1_6 Reverse -207 -226 -2.0655 0.214
NP_442193.1_1 Reverse -49 -67 7.88563 0.28
NP_442270.1_6 Reverse -203 -221 15.1621 0.279
NP_441698.1_3 Forward -200 -186 17.0102 0.288
NP_442643.1_3 Reverse -172 -191 -6.78538 0.262
NP_442216.1_4 Forward -148 -140 8.08217 0.255
NP_441782.1_5 Forward -399 -380 7.07928 0.287
NP_440401.1_9 Forward -194 -187 12.6251 0.287
NP_441474.1_1 Forward -196 -177 4.03023 0.221
NP_442402.1_4 Forward -88 -69 -2.16459 0.195
NP_442402.1_4 Forward -146 -127 -6.98278 0.268
NP_442402.1_10 Forward -342 -332 14.5325 0.18
NP_440653.1_10 Reverse -38 -57 5.99764 0.218
NP_442679.1_1 Reverse -127 -146 -2.36049 0.24
NP_442053.1_1 Forward -354 -345 7.27622 0.103
NP_440505.1_3 Reverse -343 -353 4.3066 0.3
NP_442533.1_1 Reverse -55 -74 -9.83364 0.229
NP_442533.1_1 Reverse -204 -223 -11.8986 0.236
NP_442533.1_1 Reverse -328 -347 -16.9135 0.277
NP_442533.1_6 Forward -354 -345 11.6028 0.0409
NP_442533.1_6 Reverse -177 -186 3.14632 0.224
NP_441482.1_7 Forward -360 -346 -10.1285 0.209
NP_440116.1_5 Forward -357 -340 6.43035 0.167
NP_440115.1_6 Reverse -342 -352 5.09324 0.271
NP_441972.1_3 Reverse -210 -229 16.5191 0.146
NP_441972.1_5 Forward -274 -255 -2.16383 0.178
NP_441106.1_1 Reverse -344 -353 5.99792 0.111
NP_439903.1_1 Reverse -349 -368 3.04771 0.214
NP_442588.1_1 Reverse -204 -223 6.88262 0.259
NP_442588.1_2 Forward -240 -221 21.3373 0.0542
NP_440670.1_8 Reverse -345 -354 8.55452 0.066
NP_440670.1_8 Forward -354 -345 6.39124 0.121
NP_440886.1_7 Reverse -381 -391 3.61784 0.272
NP_442614.1_2 Reverse -345 -359 7.66941 0.268
NP_442072.1_9 Forward -355 -337 -12.0756 0.0812
NP_442072.1_9 Reverse -141 -159 -15.6155 0.184
NP_441427.1_5 Reverse -298 -317 11.9958 0.275
NP_440028.1_6 Reverse -202 -220 14.2771 0.218
NP_440907.2_8 Forward -353 -343 7.94438 0.117
NP_439967.1_1 Forward -275 -257 11.7205 0.236
NP_440962.1_6 Reverse -73 -90 13.5094 0.252
NP_442893.1_3 Reverse -4 -23 17.8948 0.12
NP_441626.1_2 Reverse -346 -353 9.08556 0.1
NP_442365.1_7 Forward -358 -339 -2.65548 0.202
NP_441962.1_9 Forward -192 -173 12.4875 0.191
NP_440387.1_1 Forward -354 -338 15.0048 0.00592
NP_441431.1_2 Reverse -167 -181 10.3237 0.162
NP_441488.1_8 Reverse -172 -186 10.9137 0.146
NP_441206.1_4 Forward -63 -44 8.84924 0.0296
NP_441510.2_7 Forward -186 -172 11.7987 0.28
NP_440457.1_1 Reverse -341 -353 0.727295 0.25
NP_440554.1_4 Forward -353 -343 3.02829 0.244
NP_441885.1_5 Reverse -345 -355 -0.41329 0.197
NP_441173.1_9 Forward -225 -217 11.0321 0.228
NP_440119.1_1 Forward -219 -203 9.20332 0.14
NP_442395.2_4 Forward -192 -173 5.50519 0.161
NP_440191.1_4 Forward -146 -136 14.6025 0.266
NP_440423.1_6 Forward -315 -296 -15.6352 0.229
NP_440275.1_3 Reverse -343 -353 15.123 0.0182
NP_441307.1_4 Reverse -51 -70 6.68596 0.177
NP_441662.1_3 Forward -39 -20 8.52366 0.264
NP_440679.1_10 Reverse -309 -328 -5.21209 0.161
NP_442373.1_2 Reverse -204 -223 -1.7705 0.198
NP_440216.1_1 Forward -354 -340 -5.40861 0.129
NP_440172.1_1 Forward -354 -344 5.19158 0.149
NP_442015.1_10 Forward -358 -345 8.77074 0.0605
NP_442015.1_10 Forward -267 -254 3.26421 0.184
NP_442015.1_10 Forward -190 -177 -1.16069 0.297
NP_441226.1_7 Forward -353 -346 8.88855 0.165
NP_440198.1_2 Forward -277 -258 14.2289 0.281
NP_441111.1_7 Forward -353 -345 -0.570565 0.233
NP_441111.1_7 Reverse -346 -354 -0.570565 0.233
NP_442379.1_10 Reverse -338 -355 1.02215 0.223
NP_441766.1_2 Forward -354 -345 10.7178 0.0222
NP_440416.1_9 Reverse -170 -189 -4.03212 0.076
NP_440416.1_9 Reverse -259 -278 -10.4236 0.141
NP_443052.1_9 Forward -235 -216 -4.52377 0.258
NP_443052.1_9 Forward -223 -204 -5.11376 0.265
NP_442154.1_1 Reverse -205 -223 4.05072 0.0591
NP_441579.1_8 Forward -191 -172 22.8114 0.0308
NP_440261.1_5 Reverse -346 -359 -12.3704 0.284
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCCCGTTCAGGATATTGCGGGACGGTTGAGGTCATAACCATTCCTGGCCGGTCGCCTCACTCTCCACAAAATCGGACACATCACCGGGATAGGTAAAATCGGCAGGAATAGATGTCAAAAGTGCCTCCAATGACCCAGGGGAAGACCGTTTACGAATCATCAGCCCCTGCTCCGTTTCCACCAAATCCACCACCGTTGATTCATCAAACCCCCAACTGATGGCCAAGGGGTGCGGAATGCGTAACCCGATGCTATTTCCCCACTTTTTGAGCCGGACTTCCATTAGCCCCTCCTGAGTTATACAAAATATAATTACTCAATTCTAATCCCAAGCCCCCTCAGATTAATGCCCGCTTCAAATACATTAAGCAATTTGTATCTTTTGGGATACAATAGGGGG

CDS

ATGATTGAAATCCGGCAAACAGAAACCTATGCCCGTTGGTTTAAGTCTTTGCGGGATTGCCAGGCAAAAGCCCGAATTGATATTCGTATTCGCCGTCTATCCTTGGTTAATGCTGGGGACGTTAAGTCGGTAGGGGGTGGGGTTTCAGAACTTCGGATTAACTACGGCCCCGGCTATCGCATCTATTTCACCCAGCAGGGAGAACAGTTAATTATTTTGTTGGCTGGCGGCGACAAGCAGACCCAATCCAATGACATCACCATTGCCCGTGATTTAGCCAAAGAACTATAA

Protein

No sequence available