Your browser is old and dusty. Try Google Chrome!

Details for ssl7038

ORF ssl7038
Accession NP_942326.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -49 -35 3.93283 0.158
NP_441061.1_2 Reverse -122 -136 2.5562 0.174
NP_441061.1_2 Forward -55 -41 -2.36035 0.29
NP_440557.1_1 Reverse -122 -141 -0.000545616 0.265
NP_440557.1_1 Reverse -47 -66 -1.08219 0.27
NP_440795.1_7 Forward -129 -122 12.2322 0.0614
NP_441418.1_6 Reverse -121 -140 -19.4701 0.0888
NP_440815.1_5 Forward -67 -48 10.3242 0.223
NP_441480.1_5 Forward -257 -238 16.7157 0.11
NP_440897.1_6 Forward -250 -231 -2.95123 0.227
NP_441453.1_4 Forward -130 -122 6.90259 0.121
NP_441453.1_4 Reverse -121 -129 5.82095 0.126
NP_441453.1_8 Reverse -261 -278 11.1502 0.217
NP_442151.1_6 Reverse -41 -55 5.21113 0.288
NP_442151.1_6 Forward -50 -36 5.01447 0.298
NP_443043.1_10 Reverse -30 -49 6.98095 0.161
NP_440561.1_8 Forward -201 -182 7.47261 0.282
NP_441818.1_1 Forward -49 -38 11.1696 0.199
NP_441818.1_9 Reverse -35 -54 -8.26035 0.276
NP_441818.1_9 Forward -95 -76 -10.227 0.292
NP_440150.1_2 Forward -48 -29 8.35677 0.234
NP_442173.1_1 Reverse -122 -130 6.01761 0.2
NP_443027.1_4 Reverse -119 -129 6.66654 0.274
NP_442975.1_10 Forward -134 -120 1.86729 0.29
NP_440784.1_7 Forward -129 -122 6.23397 0.241
NP_440784.1_7 Reverse -122 -129 6.23397 0.241
NP_442405.1_3 Reverse -254 -266 18.5246 0.252
NP_441054.1_4 Forward -260 -242 -1.06249 0.193
NP_440878.1_9 Forward -260 -241 -2.45882 0.264
NP_442062.1_8 Forward -250 -240 2.83163 0.293
NP_441995.1_4 Reverse -295 -313 10.9331 0.282
NP_442242.1_4 Reverse -122 -129 11.8388 0.0776
NP_440044.1_8 Forward -129 -110 -1.7705 0.251
NP_441492.1_2 Forward -78 -59 10.6192 0.129
NP_440916.1_1 Reverse -93 -107 7.9644 0.284
NP_439918.1_2 Reverse -366 -385 -3.24547 0.251
NP_441208.1_9 Reverse -276 -290 5.60446 0.267
NP_441594.1_6 Forward -139 -120 6.19431 0.193
NP_440132.1_1 Forward -132 -114 10.5406 0.218
NP_441083.1_5 Forward -250 -240 -0.314959 0.265
NP_441558.1_5 Reverse -119 -138 10.4225 0.098
NP_440209.1_1 Forward -130 -122 8.27922 0.0687
NP_441713.1_2 Reverse -241 -260 14.8474 0.291
NP_440178.1_7 Forward -131 -112 -22.5183 0.267
NP_442111.1_4 Reverse -120 -134 16.8142 0.0128
NP_441163.1_1 Forward -245 -228 8.29791 0.232
NP_440343.1_3 Forward -380 -362 9.35981 0.184
NP_440906.1_5 Reverse -122 -129 12.0355 0.0724
NP_440906.1_5 Forward -129 -122 6.0373 0.262
NP_440906.1_9 Reverse -66 -85 12.29 0.296
NP_440747.1_10 Forward -133 -121 -2.51763 0.0509
NP_440747.1_10 Reverse -238 -250 -2.71429 0.0639
NP_440747.1_10 Forward -242 -230 -11.7607 0.142
NP_441130.1_10 Forward -132 -118 8.06273 0.141
NP_442634.1_4 Reverse -39 -53 2.2612 0.141
NP_442634.1_4 Forward -132 -118 -4.03198 0.179
NP_441014.1_8 Reverse -195 -214 -4.32711 0.249
NP_442848.1_4 Reverse -14 -28 5.89945 0.288
NP_441012.1_4 Reverse -123 -136 6.60746 0.278
NP_443018.1_3 Reverse -122 -129 5.84064 0.174
NP_443018.1_3 Forward -129 -122 5.54565 0.187
NP_441316.1_7 Forward -132 -117 -2.57671 0.26
NP_441634.1_8 Forward -132 -118 -3.83532 0.295
NP_441634.1_8 Reverse -62 -76 -4.52363 0.295
NP_440376.1_1 Reverse -121 -130 7.76787 0.0688
NP_440376.1_1 Reverse -230 -239 4.32629 0.163
NP_440376.1_1 Forward -250 -241 3.63797 0.2
NP_440376.1_1 Forward -73 -64 1.86802 0.238
NP_440376.1_1 Forward -130 -121 -0.0986038 0.285
NP_442485.1_3 Forward -141 -122 -5.70374 0.295
NP_441846.1_10 Forward -180 -161 -15.0452 0.243
NP_440609.1_6 Forward -280 -261 15.5357 0.286
NP_441422.1_7 Forward -132 -115 -1.82945 0.194
NP_440667.1_2 Reverse -35 -54 -9.14533 0.297
NP_442658.1_1 Forward -132 -122 7.74772 0.209
NP_442658.1_1 Reverse -119 -129 4.89613 0.292
NP_442782.1_2 Reverse -35 -49 6.88276 0.217
NP_441414.1_9 Forward -250 -231 -7.17871 0.212
NP_441317.1_4 Forward -332 -318 9.84592 0.29
NP_441958.1_5 Reverse -120 -130 1.65166 0.0872
NP_441958.1_5 Forward -131 -121 -6.70647 0.287
NP_441097.1_2 Forward -178 -161 4.07041 0.286
NP_442911.1_2 Reverse -111 -130 -9.53865 0.258
NP_440153.1_8 Reverse -67 -80 -2.93064 0.268
NP_439975.1_2 Forward -168 -150 5.91901 0.256
NP_441099.1_5 Forward -140 -121 -3.54046 0.136
NP_442002.1_9 Reverse -207 -214 9.47889 0.282
NP_441646.1_1 Forward -169 -150 0.687771 0.245
NP_441646.1_1 Forward -137 -118 -0.000545616 0.257
NP_442431.1_10 Reverse -35 -53 2.37909 0.238
NP_440147.1_4 Forward -132 -119 7.88576 0.0598
NP_441295.1_2 Reverse -40 -59 18.4857 0.274
NP_441916.1_7 Reverse -121 -131 7.15819 0.0745
NP_441041.1_4 Reverse -41 -60 1.67108 0.0792
NP_441041.1_4 Reverse -35 -54 -0.787193 0.0974
NP_441041.1_4 Forward -277 -258 -11.7019 0.251
NP_441041.1_7 Reverse -118 -130 7.12607 0.176
NP_441725.1_4 Forward -135 -121 9.83206 0.144
NP_439966.1_7 Reverse -239 -249 8.92768 0.125
NP_439966.1_7 Forward -132 -122 8.3377 0.14
NP_439966.1_7 Forward -376 -366 5.68278 0.214
NP_442941.1_3 Forward -249 -239 7.15819 0.0855
NP_442941.1_3 Reverse -122 -132 1.06167 0.153
NP_442281.1_1 Forward -135 -121 6.78381 0.115
NP_441334.1_7 Reverse -119 -138 -10.7186 0.12
NP_441457.1_7 Reverse -119 -138 4.22769 0.221
NP_441556.1_10 Reverse -235 -249 12.2659 0.195
NP_441644.1_6 Forward -130 -120 7.15773 0.133
NP_440929.1_8 Reverse -121 -130 7.66954 0.0624
NP_440929.1_8 Forward -130 -121 7.57121 0.0706
NP_442933.1_2 Forward -400 -382 7.06839 0.268
NP_440430.1_4 Forward -140 -121 13.47 0.263
NP_441751.2_8 Reverse -122 -136 -2.95034 0.134
NP_441751.2_8 Forward -249 -235 -5.11362 0.194
NP_442554.1_8 Forward -129 -119 6.56821 0.112
NP_442554.1_8 Reverse -122 -132 4.99491 0.163
NP_442554.1_8 Forward -49 -39 2.43831 0.272
NP_441762.1_7 Forward -131 -119 -5.46756 0.212
NP_442142.1_4 Forward -47 -34 7.98351 0.125
NP_442292.1_1 Forward -129 -120 7.27622 0.0732
NP_442292.1_1 Forward -49 -40 3.7363 0.192
NP_442292.1_1 Reverse -122 -131 -0.0986038 0.239
NP_442292.1_1 Forward -249 -240 -0.68859 0.268
NP_442292.1_5 Reverse -117 -136 -0.590531 0.257
NP_443009.1_5 Reverse -240 -251 4.77807 0.23
NP_441715.1_4 Reverse -122 -132 9.41981 0.097
NP_441715.1_4 Forward -249 -239 5.68323 0.189
NP_441198.1_4 Forward -169 -150 23.9922 0.00755
NP_441198.1_8 Reverse -119 -129 10.8298 0.239
NP_440464.1_4 Reverse -21 -39 20.9982 0.11
NP_441468.1_1 Reverse -122 -129 6.43063 0.175
NP_441468.1_1 Forward -129 -122 6.0373 0.223
NP_441015.1_10 Reverse -122 -141 -3.63879 0.19
NP_441673.1_1 Forward -130 -121 1.27803 0.155
NP_441673.1_1 Reverse -121 -130 1.27803 0.155
NP_441673.1_1 Forward -239 -230 -8.06341 0.254
NP_441731.1_7 Forward -257 -238 2.0644 0.297
NP_441826.1_2 Forward -136 -122 -3.93365 0.29
NP_442868.1_6 Reverse -239 -249 13.0581 0.038
NP_442868.1_6 Forward -132 -122 0.668351 0.213
NP_441056.1_1 Reverse -121 -140 2.75272 0.133
NP_441612.1_2 Forward -50 -40 6.80666 0.277
NP_442427.1_8 Forward -259 -240 12.5858 0.152
NP_442808.1_1 Reverse -247 -257 1.74956 0.281
NP_440918.1_8 Forward -68 -50 14.8663 0.273
NP_440145.1_3 Forward -249 -230 -2.75381 0.178
NP_442542.1_2 Reverse -33 -46 5.23083 0.276
NP_442050.1_5 Reverse -239 -249 8.92768 0.206
NP_442050.1_5 Reverse -119 -129 6.86274 0.28
NP_440630.1_3 Reverse -110 -129 5.01433 0.197
NP_441114.1_3 Forward -42 -33 7.66954 0.231
NP_440558.1_2 Forward -47 -28 -1.37718 0.214
NP_441878.1_6 Reverse -229 -239 -6.21482 0.191
NP_441878.1_6 Reverse -120 -130 -7.49312 0.231
NP_441878.1_6 Reverse -34 -44 -7.49312 0.231
NP_441878.1_6 Forward -251 -241 -7.59145 0.245
NP_441557.1_5 Reverse -121 -130 7.66954 0.0443
NP_441557.1_5 Forward -130 -121 0.983037 0.0911
NP_441458.1_10 Forward -220 -201 1.0811 0.298
NP_442183.1_1 Forward -130 -116 17.7975 0.00938
NP_440356.1_2 Forward -254 -235 1.67108 0.263
NP_442347.1_2 Forward -379 -370 3.7363 0.284
NP_441037.1_4 Reverse -119 -129 6.24566 0.274
NP_442508.1_8 Forward -176 -159 9.47861 0.289
NP_441633.1_3 Forward -132 -119 -3.52063 0.177
NP_441633.1_3 Reverse -239 -252 -7.25721 0.3
NP_440136.1_2 Forward -249 -242 11.1505 0.0519
NP_440136.1_2 Reverse -122 -129 6.52896 0.116
NP_440136.1_2 Forward -129 -122 6.13563 0.193
NP_442590.1_10 Reverse -28 -47 7.07928 0.232
NP_442998.1_10 Reverse -123 -130 12.5271 0.0457
NP_441007.1_10 Reverse -116 -129 11.6223 0.0624
NP_441559.1_8 Reverse -236 -250 3.44117 0.143
NP_441559.1_8 Forward -244 -230 0.687908 0.163
NP_441559.1_8 Reverse -183 -197 -2.26202 0.19
NP_441559.1_8 Forward -135 -121 -5.70361 0.27
NP_441559.1_8 Forward -38 -24 -7.08024 0.283
NP_441559.1_8 Forward -125 -111 -7.76856 0.299
NP_440915.1_6 Forward -134 -120 2.35953 0.119
NP_440915.1_6 Reverse -237 -251 1.57289 0.134
NP_442158.1_2 Forward -102 -83 15.326 0.247
NP_442158.1_4 Forward -89 -79 13.0581 0.239
NP_440733.1_2 Reverse -318 -336 11.079 0.293
NP_440134.1_2 Forward -298 -279 9.63589 0.227
NP_442866.1_1 Reverse -41 -60 6.58763 0.121
NP_442866.1_4 Reverse -47 -66 7.47261 0.202
NP_441464.1_1 Forward -243 -224 7.47261 0.261
NP_441464.1_10 Forward -171 -157 17.2075 0.129
NP_440026.1_4 Forward -172 -153 16.7157 0.203
NP_441939.1_3 Reverse -122 -141 21.4356 0.0055
NP_442386.1_9 Reverse -240 -249 7.37413 0.219
NP_442386.1_9 Forward -131 -122 6.39082 0.219
NP_441340.1_5 Reverse -122 -129 13.2155 0.0437
NP_441340.1_5 Forward -129 -122 6.13563 0.175
NP_440194.1_3 Reverse -111 -130 0.58944 0.277
NP_440586.1_8 Reverse -78 -85 7.1186 0.272
NP_441262.1_3 Reverse -121 -128 5.34899 0.181
NP_443051.1_1 Reverse -120 -129 7.76787 0.0541
NP_443051.1_1 Forward -131 -122 0.589713 0.143
NP_439937.1_9 Forward -251 -234 -0.846829 0.122
NP_439937.1_9 Reverse -303 -320 -11.4665 0.256
NP_443039.1_3 Reverse -279 -298 5.11266 0.286
NP_440408.1_7 Forward -294 -275 8.35759 0.281
NP_440439.1_1 Forward -133 -120 -0.865694 0.241
NP_440372.1_2 Reverse -122 -129 6.62729 0.151
NP_440372.1_2 Forward -129 -122 6.52896 0.188
NP_440316.1_10 Reverse -34 -44 8.04317 0.24
NP_440316.1_10 Forward -170 -160 5.38824 0.299
NP_439977.1_5 Forward -56 -37 -2.65548 0.287
NP_442384.1_10 Reverse -121 -134 1.19926 0.267
NP_441877.1_7 Reverse -244 -263 4.52188 0.218
NP_442790.1_4 Reverse -221 -240 -8.65367 0.173
NP_442262.1_10 Reverse -122 -129 10.4622 0.145
NP_442910.1_1 Reverse -234 -253 -2.26216 0.254
NP_441896.1_3 Forward -139 -120 0.491109 0.225
NP_440999.1_9 Forward -134 -120 -1.47537 0.239
NP_440888.1_2 Forward -250 -236 8.45543 0.16
NP_440052.1_5 Forward -141 -122 -5.9004 0.298
NP_442033.1_10 Reverse -228 -247 -10.817 0.243
NP_441543.1_2 Reverse -122 -131 15.4377 0.00784
NP_441543.1_2 Forward -129 -120 4.81794 0.219
NP_442845.1_2 Forward -175 -161 3.93283 0.272
NP_440380.1_1 Reverse -35 -54 -11.6036 0.299
NP_441469.1_8 Forward -131 -122 6.98123 0.227
NP_442337.1_8 Reverse -46 -65 2.26107 0.217
NP_440257.1_5 Reverse -159 -178 13.9616 0.0235
NP_442578.1_7 Reverse -122 -129 11.3472 0.102
NP_440220.1_4 Forward -39 -20 -0.886293 0.262
NP_441462.1_2 Forward -130 -120 1.55333 0.0864
NP_441462.1_5 Forward -179 -160 0.392778 0.296
NP_441621.1_7 Reverse -119 -133 5.40779 0.0829
NP_442204.1_1 Forward -134 -123 1.7303 0.266
NP_442204.1_2 Reverse -157 -176 5.40766 0.299
NP_442204.1_5 Forward -83 -64 6.68596 0.142
NP_440516.1_6 Forward -43 -29 8.3571 0.247
NP_440516.1_8 Forward -130 -121 -0.295266 0.232
NP_440516.1_8 Reverse -241 -250 -0.590259 0.283
NP_442428.1_5 Reverse -122 -129 6.52896 0.109
NP_442428.1_5 Forward -129 -122 6.0373 0.212
NP_442120.1_10 Reverse -35 -54 -5.99873 0.203
NP_440673.1_2 Reverse -111 -130 11.2676 0.181
NP_440673.1_3 Forward -42 -35 8.98723 0.203
NP_441714.1_3 Forward -224 -206 13.6864 0.217
NP_441052.1_2 Forward -250 -240 1.455 0.244
NP_440436.1_4 Reverse -122 -131 8.65242 0.0997
NP_440436.1_4 Forward -43 -34 6.48915 0.157
NP_440436.1_4 Forward -249 -240 4.22755 0.277
NP_441719.1_4 Reverse -122 -129 6.62729 0.151
NP_441719.1_4 Forward -129 -122 6.52896 0.188
NP_441733.1_10 Reverse -118 -131 8.47575 0.14
NP_441004.1_1 Forward -202 -183 -11.8003 0.242
NP_441004.1_5 Forward -200 -186 15.0442 0.22
NP_440296.1_4 Forward -269 -250 19.8257 0.0779
NP_440296.1_6 Forward -101 -83 12.4159 0.295
NP_440296.1_6 Reverse -327 -345 10.8881 0.295
NP_442206.1_10 Forward -130 -115 2.63483 0.201
NP_441851.1_10 Forward -131 -121 5.97822 0.19
NP_441851.1_10 Forward -251 -241 5.19158 0.221
NP_442856.1_7 Reverse -58 -77 -3.44213 0.243
NP_442856.1_7 Reverse -68 -87 -4.03212 0.254
NP_442515.1_1 Forward -240 -226 2.35953 0.137
NP_442515.1_1 Forward -77 -63 -2.65535 0.277
NP_442515.1_1 Reverse -240 -254 -4.91696 0.298
NP_441396.1_5 Forward -175 -166 7.37455 0.279
NP_440593.1_9 Reverse -65 -79 8.65272 0.255
NP_441349.1_10 Reverse -231 -250 -0.885524 0.0967
NP_440432.1_9 Forward -129 -114 -4.93665 0.228
NP_439960.1_6 Reverse -121 -140 9.83255 0.22
NP_442168.1_5 Reverse -117 -136 -3.24547 0.281
NP_440588.1_2 Reverse -232 -251 3.53937 0.0988
NP_440588.1_3 Reverse -334 -353 9.0459 0.291
NP_441570.1_1 Reverse -41 -59 -10.1089 0.16
NP_441078.1_4 Forward -130 -121 8.35786 0.0338
NP_441078.1_4 Reverse -121 -130 7.27622 0.0764
NP_441078.1_4 Reverse -230 -239 -0.786921 0.207
NP_441078.1_4 Forward -239 -230 -1.57357 0.266
NP_441078.1_4 Reverse -241 -250 -1.86856 0.272
NP_442729.1_5 Reverse -34 -44 9.7148 0.235
NP_440526.1_3 Forward -129 -118 1.43483 0.267
NP_441432.1_8 Reverse -240 -249 8.1612 0.0815
NP_441432.1_8 Forward -131 -122 6.98123 0.112
NP_441945.1_10 Reverse -28 -47 6.88262 0.291
NP_442353.1_4 Reverse -68 -87 5.60352 0.183
NP_442353.1_4 Forward -82 -63 4.03023 0.206
NP_442489.1_7 Reverse -121 -130 1.08137 0.109
NP_442489.1_7 Forward -130 -121 0.589713 0.17
NP_442489.1_7 Reverse -230 -239 -1.77023 0.247
NP_442489.1_7 Forward -250 -241 -1.96689 0.28
NP_441659.2_8 Forward -130 -120 8.04317 0.0508
NP_439956.1_7 Reverse -224 -243 2.0644 0.276
NP_442346.1_5 Reverse -34 -44 4.60159 0.281
NP_440545.1_3 Reverse -117 -134 2.00546 0.108
NP_440025.1_3 Reverse -20 -34 13.1279 0.251
NP_440459.1_2 Reverse -260 -277 9.28195 0.23
NP_440459.1_2 Reverse -26 -43 8.29864 0.266
NP_441653.1_2 Forward -141 -122 5.07576 0.248
NP_441888.1_7 Forward -135 -121 3.93283 0.225
NP_441050.1_5 Forward -171 -153 9.95058 0.143
NP_441358.1_4 Forward -361 -342 21.0414 0.0652
NP_441833.1_4 Reverse -122 -129 6.23397 0.163
NP_441833.1_4 Forward -129 -122 6.13563 0.198
NP_442699.1_8 Reverse -125 -144 -12.6852 0.255
NP_442162.1_9 Reverse -122 -129 6.62729 0.142
NP_442162.1_9 Forward -129 -122 6.43063 0.208
NP_441341.1_6 Reverse -269 -288 8.84924 0.253
NP_442140.1_3 Reverse -122 -132 10.6981 0.0902
NP_442723.1_1 Reverse -149 -168 2.45694 0.289
NP_442723.1_1 Reverse -150 -169 1.17865 0.298
NP_441671.1_10 Reverse -234 -253 -0.0988766 0.288
NP_440875.1_9 Reverse -123 -133 8.46937 0.233
NP_441813.1_5 Forward -132 -122 9.61647 0.027
NP_442089.1_6 Reverse -47 -66 4.22769 0.262
NP_440590.1_4 Reverse -122 -135 3.75586 0.0686
NP_440590.1_4 Reverse -199 -212 1.19926 0.13
NP_442497.1_10 Forward -129 -120 5.89959 0.109
NP_442497.1_10 Reverse -122 -131 0.688044 0.141
NP_440821.1_1 Forward -138 -119 18.6815 0.0601
NP_440821.1_4 Reverse -119 -129 0.471689 0.174
NP_440821.1_4 Forward -132 -122 0.373358 0.18
NP_441239.1_9 Reverse -119 -131 8.49544 0.131
NP_440706.1_1 Reverse -117 -136 -5.21209 0.268
NP_441892.1_10 Reverse -230 -249 12.4875 0.262
NP_442193.1_1 Reverse -350 -368 7.88563 0.28
NP_441017.1_6 Reverse -31 -45 11.2087 0.273
NP_440876.1_5 Forward -128 -109 6.4893 0.283
NP_440876.1_5 Forward -42 -23 4.916 0.283
NP_440354.1_5 Forward -124 -105 1.67108 0.272
NP_440354.1_7 Forward -182 -164 5.82068 0.297
NP_442138.1_9 Forward -73 -54 11.2084 0.202
NP_440546.1_4 Reverse -268 -278 8.39772 0.192
NP_440462.1_6 Forward -132 -122 7.45319 0.0788
NP_440868.1_4 Forward -134 -122 0.727295 0.201
NP_442499.1_3 Forward -131 -113 3.46073 0.289
NP_442402.1_4 Reverse -301 -320 -1.8696 0.194
NP_442402.1_4 Forward -389 -370 -2.16459 0.195
NP_442402.1_4 Forward -40 -21 -10.326 0.299
NP_440653.1_10 Reverse -339 -358 5.99764 0.218
NP_442039.1_4 Reverse -122 -129 12.1338 0.063
NP_441053.1_3 Reverse -98 -117 -0.295539 0.278
NP_442696.1_6 Forward -244 -225 -12.2919 0.252
NP_442837.1_3 Reverse -122 -129 6.0373 0.25
NP_442837.1_3 Forward -129 -122 5.93897 0.265
NP_440160.1_2 Reverse -22 -41 -1.96717 0.245
NP_440160.1_5 Reverse -182 -192 14.6309 0.291
NP_440505.1_3 Reverse -239 -249 13.353 0.0331
NP_440505.1_3 Forward -132 -122 6.56821 0.176
NP_440505.1_3 Forward -241 -231 4.60159 0.277
NP_440505.1_7 Reverse -60 -79 -1.67217 0.279
NP_442532.1_7 Forward -130 -116 3.24451 0.205
NP_441011.1_8 Reverse -122 -131 7.27622 0.179
NP_441011.1_8 Forward -129 -120 6.19458 0.196
NP_442533.1_1 Reverse -356 -375 -9.83364 0.229
NP_442533.1_1 Forward -178 -159 -15.7335 0.257
NP_442533.1_6 Reverse -127 -136 1.47469 0.298
NP_442322.1_4 Reverse -157 -174 -8.90993 0.286
NP_441482.1_7 Forward -136 -122 -0.983719 0.0612
NP_439944.1_9 Forward -129 -119 12.7631 0.0838
NP_441697.1_5 Forward -101 -82 -9.78835 0.274
NP_441028.1_6 Reverse -299 -309 3.51951 0.292
NP_440115.1_6 Reverse -238 -248 12.3697 0.0987
NP_440007.1_9 Reverse -37 -51 11.3077 0.163
NP_440007.1_9 Forward -134 -120 1.96621 0.281
NP_440007.1_9 Reverse -31 -45 0.589577 0.294
NP_441347.1_5 Reverse -235 -249 10.422 0.269
NP_441602.1_3 Forward -135 -116 -1.18052 0.226
NP_441972.1_5 Forward -141 -122 -9.73531 0.293
NP_441106.1_1 Forward -131 -122 8.35786 0.0585
NP_441420.1_1 Reverse -240 -259 -5.31042 0.292
NP_441286.1_1 Reverse -240 -252 -5.07423 0.188
NP_440670.1_8 Forward -130 -121 6.48957 0.118
NP_440670.1_8 Reverse -121 -130 5.60459 0.149
NP_440886.1_7 Forward -131 -121 7.94438 0.0805
NP_440886.1_7 Reverse -166 -176 5.28945 0.188
NP_442614.1_2 Forward -76 -62 9.73436 0.242
NP_442382.1_7 Forward -63 -44 7.86593 0.229
NP_442072.1_9 Forward -131 -113 -23.187 0.284
NP_440907.2_8 Forward -129 -119 14.0409 0.0342
NP_442264.1_4 Forward -76 -62 17.2075 0.224
NP_441021.1_1 Forward -43 -24 1.96607 0.083
NP_441021.1_1 Reverse -122 -141 -11.2103 0.258
NP_440962.1_6 Reverse -374 -391 13.5094 0.252
NP_441463.1_3 Forward -54 -35 3.04771 0.107
NP_442893.1_3 Reverse -305 -324 17.8948 0.12
NP_441626.1_2 Reverse -122 -129 14.2971 0.0271
NP_441626.1_2 Forward -129 -122 5.93897 0.231
NP_442794.1_1 Forward -134 -122 7.90546 0.126
NP_441962.1_4 Forward -135 -116 -6.58872 0.18
NP_441962.1_4 Reverse -122 -141 -9.24366 0.215
NP_440387.1_1 Reverse -121 -137 -4.46469 0.187
NP_440387.1_1 Forward -130 -114 -5.34967 0.227
NP_441431.1_2 Reverse -68 -82 5.50552 0.298
NP_442647.1_7 Forward -60 -47 5.32916 0.295
NP_440634.1_6 Forward -240 -226 18.0925 0.13
NP_441993.1_1 Forward -50 -31 4.09075 0.225
NP_440114.1_10 Forward -130 -116 13.4709 0.0561
NP_441206.1_4 Forward -364 -345 8.84924 0.0296
NP_442930.1_1 Reverse -85 -95 9.81266 0.28
NP_441984.1_1 Reverse -29 -47 7.09898 0.283
NP_441984.1_3 Reverse -258 -276 5.82068 0.276
NP_442509.1_9 Reverse -241 -251 12.1726 0.101
NP_440554.1_4 Forward -129 -119 7.05986 0.106
NP_440554.1_4 Reverse -122 -132 6.76487 0.114
NP_441885.1_5 Forward -130 -120 0.963343 0.116
NP_441428.1_8 Forward -138 -119 4.916 0.235
NP_441173.1_9 Forward -29 -21 12.1137 0.21
NP_441173.1_9 Forward -116 -108 11.0321 0.228
NP_443000.1_7 Forward -132 -122 1.74999 0.229
NP_443000.1_7 Reverse -239 -249 0.57002 0.294
NP_440275.1_3 Reverse -119 -129 9.02648 0.0563
NP_440275.1_3 Forward -132 -122 5.5849 0.14
NP_441307.1_4 Reverse -352 -371 6.68596 0.177
NP_441662.1_3 Forward -340 -321 8.52366 0.264
NP_441635.1_1 Forward -100 -81 3.77151 0.279
NP_439962.1_4 Forward -138 -119 -7.27704 0.288
NP_441105.1_3 Forward -141 -122 -3.3438 0.177
NP_440216.1_1 Reverse -121 -135 -11.9968 0.236
NP_440216.1_1 Reverse -230 -244 -12.6851 0.296
NP_440216.1_9 Forward -243 -234 10.9145 0.286
NP_440172.1_1 Reverse -241 -251 4.79825 0.166
NP_442371.1_1 Reverse -107 -117 13.5492 0.206
NP_442015.1_10 Forward -134 -121 1.88757 0.204
NP_441226.1_7 Forward -129 -122 5.54531 0.289
NP_441757.1_3 Reverse -240 -259 -1.18052 0.245
NP_441111.1_7 Reverse -122 -130 8.96754 0.0463
NP_441766.1_2 Reverse -121 -130 6.48957 0.096
NP_442417.1_5 Reverse -127 -141 6.29277 0.227
NP_440261.1_5 Reverse -122 -135 -11.9771 0.268
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACAAAATATAATTACTCAATTCTAATCCCAAGCCCCCTCAGATTAATGCCCGCTTCAAATACATTAAGCAATTTGTATCTTTTGGGATACAATAGGGGGATGATTGAAATCCGGCAAACAGAAACCTATGCCCGTTGGTTTAAGTCTTTGCGGGATTGCCAGGCAAAAGCCCGAATTGATATTCGTATTCGCCGTCTATCCTTGGTTAATGCTGGGGACGTTAAGTCGGTAGGGGGTGGGGTTTCAGAACTTCGGATTAACTACGGCCCCGGCTATCGCATCTATTTCACCCAGCAGGGAGAACAGTTAATTATTTTGTTGGCTGGCGGCGACAAGCAGACCCAATCCAATGACATCACCATTGCCCGTGATTTAGCCAAAGAACTATAAGGTCAATTCA

CDS

ATGGAAACCCTTAAAACTATCCCTTGGGATGCCGCCGATCACCTAGAAAGCCGTGAAGACATGGCCGCTTATCTCGAAGCCGCCCTTGAAGAAGGAGACCCTGCTCTAATCCTCGTAGCGCTGGGAGACATAGCCCGTTCCAAAGGGATGACACTGATTGCAAAGGAAACAGGATTGGGACGGGAAAGCCTCTATAAAGCCCTATCTGCCAATGGAAATCCTGAATTTGTAACGGTTTTGAAAGTCATGGAAGCCCTAGGACTACGCCTCCAAGCCACGACACTCTAA

Protein

No sequence available