Your browser is old and dusty. Try Google Chrome!

Details for ssl7021

ORF ssl7021
Accession NP_942309.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_5 Forward -275 -256 17.109 0.173
NP_441453.1_4 Reverse -105 -113 6.80426 0.121
NP_441453.1_4 Reverse -37 -45 6.80426 0.121
NP_441453.1_4 Forward -114 -106 6.11594 0.121
NP_441453.1_4 Forward -46 -38 6.11594 0.121
NP_442151.1_6 Reverse -105 -119 15.3392 0.0238
NP_442151.1_6 Reverse -37 -51 15.3392 0.0238
NP_442151.1_6 Reverse -317 -331 7.07942 0.211
NP_441818.1_1 Reverse -318 -329 11.8579 0.155
NP_441818.1_9 Forward -144 -125 -6.09707 0.259
NP_440259.1_4 Reverse -262 -276 10.564 0.262
NP_442173.1_1 Forward -113 -105 12.0158 0.0316
NP_442173.1_1 Forward -45 -37 12.0158 0.0316
NP_442173.1_1 Reverse -229 -237 5.0343 0.24
NP_442173.1_1 Reverse -106 -114 4.83764 0.241
NP_442173.1_1 Reverse -38 -46 4.83764 0.241
NP_442752.1_4 Reverse -105 -112 13.8055 0.0199
NP_442752.1_4 Reverse -37 -44 13.8055 0.0199
NP_443027.1_4 Reverse -315 -325 11.0914 0.107
NP_442975.1_10 Forward -387 -373 2.8506 0.269
NP_440784.1_7 Reverse -318 -325 8.59391 0.129
NP_440784.1_7 Reverse -106 -113 6.23397 0.241
NP_440784.1_7 Reverse -38 -45 6.23397 0.241
NP_440784.1_7 Forward -113 -106 6.13563 0.241
NP_440784.1_7 Forward -45 -38 6.13563 0.241
NP_440110.1_6 Forward -243 -224 17.8957 0.139
NP_442974.1_2 Reverse -125 -143 19.292 0.121
NP_441859.1_3 Reverse -36 -55 11.0117 0.114
NP_441859.1_3 Reverse -104 -123 2.45694 0.258
NP_440044.1_8 Reverse -106 -125 -1.96717 0.256
NP_439923.1_10 Forward -177 -158 10.9142 0.291
NP_440893.1_10 Reverse -276 -295 7.96426 0.293
NP_441594.1_6 Forward -111 -92 0.58944 0.282
NP_441594.1_6 Forward -43 -24 0.58944 0.282
NP_442196.1_9 Forward -242 -229 15.3589 0.297
NP_442110.1_7 Reverse -105 -119 4.12949 0.205
NP_442110.1_7 Reverse -37 -51 4.12949 0.205
NP_441925.1_4 Reverse -125 -144 -1.77127 0.158
NP_441925.1_4 Reverse -119 -138 -12.4893 0.254
NP_441925.1_4 Reverse -122 -141 -14.9476 0.263
NP_441083.1_5 Forward -114 -104 8.82982 0.03
NP_441083.1_5 Forward -46 -36 8.82982 0.03
NP_441083.1_5 Reverse -105 -115 8.04317 0.046
NP_441083.1_5 Reverse -37 -47 8.04317 0.046
NP_442115.2_7 Reverse -125 -142 7.41366 0.218
NP_441738.1_2 Forward -112 -105 15.28 0.0102
NP_441738.1_2 Forward -44 -37 15.28 0.0102
NP_440209.1_1 Reverse -105 -113 8.57422 0.0425
NP_440209.1_1 Reverse -37 -45 8.57422 0.0425
NP_440209.1_1 Forward -114 -106 5.52596 0.0821
NP_440209.1_1 Forward -46 -38 5.52596 0.0821
NP_442889.1_8 Reverse -314 -328 4.52221 0.263
NP_441770.1_4 Reverse -213 -232 6.88262 0.101
NP_441327.1_5 Forward -25 -16 13.0777 0.29
NP_442111.1_4 Forward -115 -101 12.586 0.0422
NP_442111.1_4 Forward -47 -33 12.586 0.0422
NP_440906.1_5 Reverse -106 -113 6.23397 0.234
NP_440906.1_5 Reverse -38 -45 6.23397 0.234
NP_440906.1_5 Forward -113 -106 6.13563 0.241
NP_440906.1_5 Forward -45 -38 6.13563 0.241
NP_440747.1_10 Reverse -102 -114 -2.4193 0.0434
NP_440747.1_10 Reverse -34 -46 -2.4193 0.0434
NP_440747.1_10 Forward -117 -105 -12.1541 0.227
NP_440747.1_10 Forward -49 -37 -12.1541 0.227
NP_441130.1_10 Forward -116 -102 6.88276 0.173
NP_441130.1_10 Forward -48 -34 6.88276 0.173
NP_441486.1_1 Reverse -314 -328 -2.36035 0.175
NP_440842.1_5 Reverse -135 -154 12.6741 0.283
NP_441695.1_10 Reverse -275 -294 15.4366 0.267
NP_441014.1_8 Reverse -122 -141 13.1758 0.0932
NP_441014.1_10 Reverse -316 -335 -1.27961 0.259
NP_442848.1_1 Forward -332 -318 -4.4253 0.291
NP_441012.1_4 Forward -112 -99 5.62415 0.291
NP_441012.1_4 Forward -44 -31 5.62415 0.291
NP_443018.1_3 Forward -113 -106 11.7405 0.0655
NP_443018.1_3 Forward -45 -38 11.7405 0.0655
NP_443018.1_3 Reverse -106 -113 5.44732 0.193
NP_443018.1_3 Reverse -38 -45 5.44732 0.193
NP_441634.1_8 Forward -146 -132 -2.75368 0.295
NP_441634.1_8 Reverse -103 -117 -4.22864 0.295
NP_441634.1_8 Reverse -35 -49 -4.22864 0.295
NP_440376.1_1 Reverse -105 -114 5.99792 0.111
NP_440376.1_1 Reverse -37 -46 5.99792 0.111
NP_440376.1_1 Forward -114 -105 -0.196935 0.285
NP_440376.1_1 Forward -46 -37 -0.196935 0.285
NP_441857.1_5 Forward -121 -103 3.95239 0.222
NP_441857.1_5 Forward -53 -35 3.95239 0.222
NP_442687.1_7 Reverse -104 -114 4.50326 0.245
NP_442687.1_7 Reverse -36 -46 4.50326 0.245
NP_442191.1_4 Reverse -96 -110 10.7022 0.288
NP_442191.1_4 Reverse -28 -42 10.7022 0.288
NP_441797.1_1 Reverse -116 -135 14.5524 0.239
NP_440360.1_5 Forward -230 -211 -0.983855 0.297
NP_442658.1_1 Reverse -103 -113 7.35439 0.214
NP_442658.1_1 Reverse -35 -45 7.35439 0.214
NP_442544.1_6 Reverse -98 -117 4.03102 0.0884
NP_442544.1_6 Reverse -30 -49 4.03102 0.0884
NP_441414.1_9 Forward -114 -95 -5.70374 0.178
NP_441414.1_9 Forward -46 -27 -5.70374 0.178
NP_441414.1_9 Reverse -105 -124 -9.44032 0.259
NP_441414.1_9 Reverse -37 -56 -9.53865 0.262
NP_440800.1_2 Reverse -91 -110 17.4284 0.0967
NP_440800.1_2 Reverse -23 -42 17.4284 0.0967
NP_442300.1_10 Forward -138 -119 9.93088 0.293
NP_442321.1_4 Reverse -269 -288 -6.68705 0.284
NP_441958.1_5 Reverse -104 -114 0.865012 0.12
NP_441958.1_5 Reverse -36 -46 0.865012 0.12
NP_441127.1_1 Forward -320 -306 8.94771 0.284
NP_440950.1_1 Forward -385 -366 -0.0988766 0.276
NP_439990.1_5 Forward -331 -318 6.50913 0.234
NP_442376.1_6 Forward -296 -277 2.0644 0.295
NP_442911.1_2 Forward -56 -37 0.294447 0.0682
NP_442911.1_2 Forward -124 -105 -8.45701 0.235
NP_440153.1_8 Reverse -121 -134 -3.12731 0.285
NP_442536.1_8 Forward -193 -174 12.2908 0.253
NP_440993.1_3 Reverse -338 -357 -1.96793 0.292
NP_441099.1_5 Forward -124 -105 9.14423 0.0328
NP_441099.1_5 Forward -56 -37 0.884433 0.0726
NP_442002.1_9 Reverse -104 -111 10.7572 0.185
NP_442002.1_9 Reverse -36 -43 10.7572 0.185
NP_440475.1_1 Forward -55 -36 11.9461 0.23
NP_442431.1_10 Forward -147 -129 5.03403 0.206
NP_442431.1_10 Forward -190 -172 1.10079 0.26
NP_442431.1_10 Forward -144 -126 0.707465 0.267
NP_441000.1_6 Forward -115 -101 -3.147 0.221
NP_441000.1_6 Forward -47 -33 -3.147 0.221
NP_440147.1_4 Reverse -103 -116 8.27909 0.0533
NP_440147.1_4 Reverse -35 -48 8.27909 0.0533
NP_441550.1_8 Forward -116 -106 12.1726 0.0361
NP_441550.1_8 Forward -48 -38 12.1726 0.0361
NP_441550.1_8 Reverse -103 -113 7.55106 0.154
NP_441550.1_8 Reverse -35 -45 7.55106 0.154
NP_441041.1_7 Reverse -102 -114 10.0414 0.103
NP_441041.1_7 Reverse -34 -46 10.0414 0.103
NP_439966.1_7 Forward -116 -106 14.5325 0.0203
NP_439966.1_7 Forward -48 -38 14.5325 0.0203
NP_439966.1_7 Reverse -125 -135 8.53436 0.135
NP_439966.1_7 Reverse -103 -113 8.23937 0.14
NP_439966.1_7 Reverse -35 -45 8.23937 0.14
NP_439966.1_9 Forward -107 -98 4.52295 0.253
NP_439966.1_9 Forward -39 -30 4.52295 0.253
NP_439966.1_9 Reverse -103 -112 0.884706 0.253
NP_439966.1_9 Reverse -35 -44 0.884706 0.253
NP_442941.1_3 Reverse -318 -328 4.99491 0.132
NP_442941.1_3 Forward -113 -103 0.963343 0.16
NP_442941.1_3 Forward -45 -35 0.963343 0.16
NP_440289.1_2 Reverse -102 -115 0.117615 0.175
NP_440289.1_2 Reverse -34 -47 0.117615 0.175
NP_440289.1_2 Forward -263 -250 -0.669033 0.206
NP_440983.1_9 Reverse -260 -279 3.24438 0.285
NP_442500.1_8 Forward -260 -246 10.564 0.272
NP_442049.1_2 Reverse -290 -309 10.6192 0.176
NP_441644.1_6 Forward -114 -104 7.15773 0.133
NP_441644.1_6 Forward -46 -36 7.15773 0.133
NP_441644.1_6 Reverse -105 -115 4.01116 0.253
NP_441644.1_6 Reverse -37 -47 4.01116 0.253
NP_443049.1_6 Reverse -104 -114 11.6409 0.24
NP_443049.1_6 Reverse -36 -46 11.6409 0.24
NP_440867.1_10 Forward -145 -126 3.53937 0.283
NP_442029.1_1 Forward -146 -127 -18.9784 0.277
NP_440253.1_2 Reverse -105 -123 13.7855 0.0208
NP_440253.1_2 Reverse -37 -55 11.5239 0.031
NP_440929.1_8 Forward -114 -105 7.07956 0.0713
NP_440929.1_8 Forward -46 -37 7.07956 0.0713
NP_441751.2_8 Forward -113 -99 -4.03198 0.158
NP_441751.2_8 Forward -45 -31 -4.03198 0.158
NP_442554.1_8 Reverse -106 -116 6.17489 0.125
NP_442554.1_8 Reverse -38 -48 6.17489 0.125
NP_442554.1_8 Forward -113 -103 4.3066 0.189
NP_442554.1_8 Forward -45 -35 4.3066 0.189
NP_440133.1_10 Forward -144 -125 7.86593 0.181
NP_441762.1_7 Reverse -104 -116 4.16888 0.0533
NP_441762.1_7 Reverse -36 -48 4.16888 0.0533
NP_442142.1_4 Forward -117 -104 8.86849 0.106
NP_442142.1_4 Forward -49 -36 8.86849 0.106
NP_442142.1_4 Reverse -132 -145 7.59019 0.135
NP_442142.1_4 Reverse -314 -327 4.34528 0.223
NP_442142.1_4 Reverse -320 -333 2.87033 0.273
NP_442142.1_4 Reverse -102 -115 2.28034 0.295
NP_442142.1_4 Reverse -34 -47 2.28034 0.295
NP_442292.1_1 Reverse -106 -115 -0.0986038 0.239
NP_442292.1_1 Reverse -38 -47 -0.0986038 0.239
NP_442292.1_1 Forward -113 -104 -0.196935 0.239
NP_442292.1_1 Forward -45 -36 -0.196935 0.239
NP_442476.1_6 Forward -113 -99 6.98109 0.116
NP_442476.1_6 Forward -45 -31 6.98109 0.116
NP_442301.1_2 Reverse -120 -139 7.37347 0.257
NP_441371.1_3 Reverse -213 -231 5.42735 0.287
NP_441715.1_4 Forward -113 -103 9.02648 0.105
NP_441715.1_4 Forward -45 -35 9.02648 0.105
NP_440379.1_5 Forward -145 -126 11.3075 0.122
NP_441468.1_1 Forward -135 -128 6.72562 0.126
NP_441468.1_1 Reverse -106 -113 6.13563 0.209
NP_441468.1_1 Reverse -38 -45 6.13563 0.209
NP_441468.1_1 Forward -113 -106 6.0373 0.223
NP_441468.1_1 Forward -45 -38 6.0373 0.223
NP_441468.1_1 Forward -325 -318 4.26735 0.246
NP_441020.2_6 Forward -116 -99 5.74204 0.291
NP_441020.2_6 Forward -48 -31 5.74204 0.291
NP_441015.1_10 Forward -143 -124 -4.32711 0.202
NP_441015.1_10 Forward -272 -253 -10.9153 0.289
NP_441673.1_1 Reverse -105 -114 1.37636 0.114
NP_441673.1_1 Reverse -37 -46 1.37636 0.114
NP_441673.1_1 Forward -114 -105 1.1797 0.163
NP_441673.1_1 Forward -46 -37 1.1797 0.163
NP_441731.1_3 Reverse -97 -116 -4.91709 0.284
NP_441731.1_3 Reverse -29 -48 -4.91709 0.284
NP_441876.1_9 Reverse -255 -265 10.9926 0.28
NP_442490.1_10 Reverse -125 -143 10.9339 0.21
NP_442868.1_6 Forward -116 -106 7.35486 0.0808
NP_442868.1_6 Forward -48 -38 7.35486 0.0808
NP_442868.1_6 Reverse -103 -113 0.57002 0.217
NP_442868.1_6 Reverse -35 -45 0.57002 0.217
NP_442719.1_2 Reverse -251 -269 -10.5029 0.276
NP_441612.1_2 Forward -230 -220 7.19391 0.26
NP_442808.1_1 Forward -115 -105 9.616 0.0481
NP_442808.1_1 Forward -47 -37 9.616 0.0481
NP_442808.1_1 Reverse -134 -144 6.0761 0.131
NP_442820.1_4 Forward -119 -102 11.2486 0.265
NP_442820.1_4 Forward -51 -34 11.2486 0.265
NP_442542.1_2 Reverse -103 -116 6.21414 0.232
NP_442542.1_2 Reverse -35 -48 6.21414 0.232
NP_442050.1_5 Forward -116 -106 12.4676 0.0617
NP_442050.1_5 Forward -48 -38 12.4676 0.0617
NP_442050.1_8 Forward -114 -95 12.5288 0.272
NP_442050.1_8 Forward -46 -27 12.5288 0.272
NP_442342.1_9 Reverse -125 -141 12.8416 0.103
NP_440346.1_6 Forward -278 -268 15.119 0.231
NP_440558.1_2 Forward -324 -305 -5.11376 0.253
NP_441036.1_8 Reverse -104 -114 6.8632 0.213
NP_441036.1_8 Reverse -36 -46 6.8632 0.213
NP_441557.1_5 Reverse -105 -114 1.08137 0.0794
NP_441557.1_5 Reverse -37 -46 1.08137 0.0794
NP_441557.1_5 Forward -114 -105 0.589713 0.134
NP_441557.1_5 Forward -46 -37 0.589713 0.134
NP_442183.1_1 Reverse -105 -119 4.42448 0.261
NP_442183.1_1 Reverse -37 -51 4.42448 0.261
NP_442183.1_9 Forward -133 -123 10.9931 0.235
NP_442135.1_8 Reverse -94 -112 10.8356 0.207
NP_442135.1_8 Reverse -26 -44 10.8356 0.207
NP_442347.1_2 Reverse -170 -179 11.6028 0.056
NP_442347.1_2 Forward -113 -104 8.94785 0.0718
NP_442347.1_2 Forward -45 -36 8.94785 0.0718
NP_441633.1_3 Reverse -103 -116 -4.01229 0.179
NP_441633.1_3 Reverse -35 -48 -4.01229 0.179
NP_440136.1_2 Reverse -106 -113 6.23397 0.171
NP_440136.1_2 Reverse -38 -45 6.23397 0.171
NP_440136.1_2 Forward -113 -106 6.13563 0.193
NP_440136.1_2 Forward -45 -38 6.13563 0.193
NP_442590.1_10 Forward -141 -122 6.58763 0.241
NP_442998.1_10 Forward -112 -105 15.5754 0.0102
NP_442998.1_10 Forward -44 -37 15.5754 0.0102
NP_440299.1_1 Reverse -379 -392 7.98351 0.1
NP_440299.1_3 Forward -306 -287 10.3242 0.244
NP_442334.1_2 Forward -270 -253 -14.0225 0.297
NP_441449.1_10 Forward -120 -102 11.0322 0.295
NP_441449.1_10 Forward -52 -34 11.0322 0.295
NP_442961.1_4 Forward -195 -176 10.8159 0.118
NP_442961.1_4 Forward -122 -103 9.24257 0.118
NP_442961.1_4 Forward -54 -35 9.24257 0.118
NP_441559.1_8 Forward -109 -95 -5.50694 0.264
NP_441559.1_8 Forward -41 -27 -5.50694 0.264
NP_440915.1_6 Reverse -101 -115 1.27789 0.142
NP_440915.1_6 Reverse -33 -47 1.27789 0.142
NP_441179.1_9 Forward -223 -213 15.7125 0.246
NP_440702.1_8 Forward -121 -102 12.0942 0.217
NP_440702.1_8 Forward -53 -34 12.0942 0.217
NP_440306.1_5 Forward -26 -7 1.17943 0.207
NP_442386.1_9 Forward -115 -106 11.9957 0.0754
NP_442386.1_9 Forward -47 -38 11.9957 0.0754
NP_442386.1_9 Reverse -104 -113 5.9975 0.23
NP_442386.1_9 Reverse -36 -45 5.9975 0.23
NP_440570.1_5 Forward -146 -127 -1.27885 0.267
NP_441340.1_5 Reverse -106 -113 13.5105 0.0314
NP_441340.1_5 Reverse -38 -45 13.5105 0.0314
NP_441340.1_5 Forward -113 -106 5.84064 0.208
NP_441340.1_5 Forward -45 -38 5.84064 0.208
NP_440161.1_3 Forward -116 -97 10.2259 0.23
NP_440161.1_3 Forward -48 -29 10.2259 0.23
NP_442714.1_10 Reverse -199 -218 13.3716 0.247
NP_440586.1_8 Forward -113 -106 9.47853 0.146
NP_440586.1_8 Forward -45 -38 9.47853 0.146
NP_440586.1_8 Reverse -318 -325 9.28187 0.164
NP_440586.1_8 Forward -335 -328 7.02027 0.279
NP_440586.1_8 Reverse -106 -113 5.74197 0.283
NP_440586.1_8 Reverse -38 -45 5.74197 0.283
NP_440192.1_4 Reverse -103 -122 13.5695 0.169
NP_440192.1_4 Reverse -35 -54 13.5695 0.169
NP_441262.1_3 Reverse -105 -112 14.7888 0.0223
NP_441262.1_3 Reverse -37 -44 14.7888 0.0223
NP_443051.1_1 Reverse -104 -113 7.47288 0.0571
NP_443051.1_1 Reverse -36 -45 7.47288 0.0571
NP_439996.1_1 Forward -284 -265 7.7676 0.263
NP_439937.1_9 Reverse -104 -121 -8.8116 0.177
NP_439937.1_9 Reverse -36 -53 -8.8116 0.177
NP_440398.1_6 Forward -121 -102 4.32602 0.275
NP_440398.1_6 Forward -53 -34 4.32602 0.275
NP_440439.1_1 Reverse -102 -115 -0.177378 0.209
NP_440439.1_1 Reverse -34 -47 -0.177378 0.209
NP_440372.1_2 Reverse -106 -113 13.8055 0.0214
NP_440372.1_2 Reverse -38 -45 13.8055 0.0214
NP_440372.1_2 Forward -113 -106 6.52896 0.188
NP_440372.1_2 Forward -45 -38 6.52896 0.188
NP_440574.1_3 Reverse -312 -331 -0.39387 0.277
NP_442783.1_10 Forward -118 -108 16.6958 0.149
NP_442783.1_10 Forward -50 -40 16.6958 0.149
NP_440819.1_5 Forward -231 -223 7.98423 0.228
NP_440316.1_10 Reverse -104 -114 11.1898 0.214
NP_440316.1_10 Reverse -36 -46 11.1898 0.214
NP_441803.1_2 Reverse -312 -331 4.03102 0.182
NP_441803.1_2 Reverse -100 -119 3.34271 0.191
NP_441803.1_2 Reverse -32 -51 3.34271 0.191
NP_439977.1_5 Reverse -121 -140 3.93269 0.157
NP_442384.1_10 Forward -114 -101 5.23083 0.134
NP_442384.1_10 Forward -46 -33 5.23083 0.134
NP_442384.1_10 Forward -326 -313 1.78924 0.247
NP_442384.1_10 Reverse -169 -182 1.00259 0.271
NP_442114.1_4 Forward -114 -103 8.4168 0.197
NP_442114.1_4 Forward -46 -35 8.4168 0.197
NP_441877.1_7 Reverse -100 -119 2.9486 0.218
NP_441877.1_7 Reverse -32 -51 2.9486 0.218
NP_442790.1_4 Reverse -96 -115 1.96607 0.0729
NP_442790.1_4 Reverse -28 -47 1.96607 0.0729
NP_442262.1_10 Forward -113 -106 13.2155 0.0213
NP_442262.1_10 Forward -45 -38 13.2155 0.0213
NP_440344.1_10 Forward -121 -104 9.28195 0.00838
NP_440344.1_10 Forward -53 -36 9.28195 0.00838
NP_441060.1_1 Forward -160 -141 13.3499 0.294
NP_441335.1_8 Forward -145 -126 18.0924 0.111
NP_440562.1_10 Forward -216 -198 5.23069 0.298
NP_441965.1_10 Forward -117 -101 8.80999 0.123
NP_441965.1_10 Forward -49 -33 8.80999 0.123
NP_442693.1_6 Reverse -126 -145 1.67108 0.278
NP_440297.1_9 Forward -325 -315 -0.511621 0.289
NP_440350.1_5 Forward -198 -179 -6.68705 0.297
NP_441103.1_9 Reverse -255 -265 15.0287 0.192
NP_440999.1_1 Reverse -124 -143 20.5498 0.0215
NP_440999.1_9 Forward -387 -373 5.21113 0.113
NP_440999.1_9 Reverse -101 -115 -2.55701 0.27
NP_440999.1_9 Reverse -33 -47 -2.55701 0.27
NP_440888.1_2 Forward -114 -100 6.68548 0.223
NP_440888.1_2 Forward -46 -32 6.68548 0.223
NP_442277.1_7 Forward -249 -233 -0.279674 0.221
NP_442033.1_10 Reverse -103 -122 -10.817 0.243
NP_442033.1_10 Reverse -35 -54 -10.817 0.243
NP_442512.1_3 Reverse -231 -250 8.45592 0.291
NP_441543.1_2 Forward -113 -104 8.65285 0.0968
NP_441543.1_2 Forward -45 -36 8.65285 0.0968
NP_441543.1_2 Reverse -318 -327 8.55452 0.0988
NP_442710.1_7 Forward -25 -6 -6.93441 0.294
NP_441469.1_4 Forward -130 -111 12.0942 0.249
NP_441469.1_8 Reverse -316 -325 11.9961 0.136
NP_441469.1_8 Reverse -104 -113 6.39124 0.227
NP_441469.1_8 Reverse -36 -45 6.39124 0.227
NP_443064.1_6 Reverse -205 -215 11.6943 0.124
NP_442578.1_7 Reverse -106 -113 6.0373 0.18
NP_442578.1_7 Reverse -38 -45 6.0373 0.18
NP_441462.1_2 Reverse -105 -115 7.55152 0.0543
NP_441462.1_2 Reverse -37 -47 7.55152 0.0543
NP_441621.1_7 Forward -138 -124 -2.26202 0.188
NP_441621.1_7 Forward -116 -102 -3.34366 0.188
NP_441621.1_7 Forward -48 -34 -3.34366 0.188
NP_443062.1_1 Forward -326 -308 12.8362 0.0725
NP_443062.1_1 Forward -114 -96 8.83844 0.145
NP_443062.1_1 Forward -46 -28 8.83844 0.145
NP_442204.1_1 Reverse -101 -112 1.7303 0.266
NP_442204.1_1 Reverse -33 -44 1.7303 0.266
NP_440516.1_8 Reverse -105 -114 18.9776 0.00442
NP_440516.1_8 Reverse -37 -46 18.9776 0.00442
NP_440516.1_8 Forward -114 -105 5.01461 0.118
NP_440516.1_8 Forward -46 -37 5.01461 0.118
NP_441785.1_1 Reverse -317 -331 11.6718 0.289
NP_442428.1_5 Forward -325 -318 11.4455 0.062
NP_442428.1_5 Reverse -106 -113 6.13563 0.209
NP_442428.1_5 Reverse -38 -45 6.13563 0.209
NP_442428.1_5 Forward -113 -106 6.0373 0.212
NP_442428.1_5 Forward -45 -38 6.0373 0.212
NP_440673.1_3 Forward -112 -105 12.4288 0.0426
NP_440673.1_3 Forward -44 -37 12.4288 0.0426
NP_441052.1_2 Forward -114 -104 1.25834 0.249
NP_441052.1_2 Forward -46 -36 1.25834 0.249
NP_441052.1_2 Reverse -105 -115 0.668351 0.256
NP_441052.1_2 Reverse -37 -47 0.668351 0.256
NP_442219.1_9 Reverse -106 -115 8.65285 0.0681
NP_442219.1_9 Reverse -38 -47 8.65285 0.0681
NP_440436.1_4 Forward -113 -104 8.55409 0.0997
NP_440436.1_4 Forward -45 -36 8.55409 0.0997
NP_441884.1_8 Forward -189 -170 -13.2752 0.278
NP_441719.1_4 Reverse -106 -113 6.82395 0.0855
NP_441719.1_4 Reverse -38 -45 6.82395 0.0855
NP_441719.1_4 Forward -113 -106 6.52896 0.188
NP_441719.1_4 Forward -45 -38 6.52896 0.188
NP_441733.1_10 Forward -117 -104 8.27909 0.14
NP_441733.1_10 Forward -49 -36 8.27909 0.14
NP_441004.1_1 Forward -142 -123 -10.227 0.219
NP_440129.1_10 Reverse -98 -112 4.03116 0.185
NP_440129.1_10 Reverse -30 -44 4.03116 0.185
NP_442206.1_10 Forward -114 -99 8.63302 0.167
NP_442206.1_10 Forward -46 -31 8.63302 0.167
NP_441683.1_7 Forward -103 -84 -10.817 0.284
NP_440593.1_3 Reverse -180 -199 1.47442 0.19
NP_441409.1_6 Forward -120 -101 -14.9469 0.27
NP_441409.1_6 Forward -52 -33 -14.9469 0.27
NP_441477.1_5 Forward -148 -129 5.99764 0.292
NP_441477.1_9 Reverse -125 -144 13.7658 0.291
NP_440431.1_4 Forward -400 -381 -10.0748 0.295
NP_441031.1_8 Reverse -378 -397 9.63589 0.137
NP_442335.1_7 Forward -113 -99 16.2235 0.146
NP_442335.1_7 Forward -45 -31 16.2235 0.146
NP_441570.1_1 Reverse -317 -335 -16.1071 0.238
NP_441078.1_4 Reverse -105 -114 0.196389 0.205
NP_441078.1_4 Reverse -37 -46 0.196389 0.205
NP_441078.1_4 Forward -114 -105 -0.000272808 0.205
NP_441078.1_4 Forward -46 -37 -0.000272808 0.205
NP_442729.1_5 Forward -145 -135 8.63316 0.248
NP_440526.1_3 Reverse -106 -117 1.53316 0.267
NP_440526.1_3 Reverse -38 -49 1.53316 0.267
NP_441432.1_8 Reverse -104 -113 5.50626 0.151
NP_441432.1_8 Reverse -36 -45 5.50626 0.151
NP_441432.1_9 Forward -204 -191 8.30749 0.29
NP_442320.1_8 Forward -120 -106 -2.95034 0.1
NP_442320.1_8 Forward -52 -38 -2.95034 0.1
NP_440497.1_6 Reverse -100 -119 -6.58872 0.264
NP_440497.1_6 Reverse -32 -51 -6.58872 0.264
NP_442797.1_1 Reverse -171 -190 -4.03212 0.286
NP_441131.1_5 Forward -321 -302 1.76941 0.261
NP_442274.1_8 Reverse -265 -283 15.9557 0.227
NP_442751.1_1 Reverse -119 -138 16.3393 0.222
NP_440713.1_4 Forward -188 -169 2.45773 0.262
NP_442489.1_7 Forward -114 -105 0.688044 0.152
NP_442489.1_7 Forward -46 -37 0.688044 0.152
NP_442489.1_7 Reverse -105 -114 0.688044 0.152
NP_442489.1_7 Reverse -37 -46 0.688044 0.152
NP_442079.1_7 Reverse -106 -125 0.294447 0.286
NP_440559.1_1 Reverse -106 -115 6.48957 0.134
NP_440559.1_1 Reverse -38 -47 6.48957 0.134
NP_442346.1_5 Forward -327 -317 8.04317 0.149
NP_440545.1_3 Forward -118 -101 -6.84433 0.289
NP_440545.1_3 Forward -50 -33 -6.84433 0.289
NP_441126.1_6 Forward -265 -251 14.895 0.256
NP_442603.1_7 Reverse -105 -119 12.9786 0.0925
NP_442603.1_7 Reverse -37 -51 12.9786 0.0925
NP_441888.1_7 Reverse -100 -114 3.53951 0.225
NP_441888.1_7 Reverse -32 -46 3.53951 0.225
NP_441833.1_4 Forward -113 -106 6.52896 0.0924
NP_441833.1_4 Forward -45 -38 6.52896 0.0924
NP_441833.1_4 Reverse -106 -113 6.23397 0.163
NP_441833.1_4 Reverse -38 -45 6.23397 0.163
NP_442162.1_9 Forward -113 -106 12.9205 0.0282
NP_442162.1_9 Reverse -106 -113 12.9205 0.0282
NP_442162.1_9 Forward -45 -38 12.9205 0.0282
NP_442162.1_9 Reverse -38 -45 12.9205 0.0282
NP_440671.1_4 Forward -332 -318 9.2427 0.184
NP_442821.1_3 Forward -280 -261 21.4356 0.00922
NP_440772.1_8 Forward -120 -101 9.3409 0.253
NP_440772.1_8 Forward -52 -33 9.3409 0.253
NP_442140.1_3 Forward -113 -103 12.1731 0.0637
NP_442140.1_3 Forward -45 -35 12.1731 0.0637
NP_442140.1_3 Reverse -106 -116 6.07655 0.184
NP_442140.1_3 Reverse -38 -48 6.07655 0.184
NP_442140.1_3 Forward -143 -133 4.0116 0.265
NP_440875.1_9 Forward -112 -102 17.327 0.0126
NP_440875.1_9 Forward -44 -34 17.327 0.0126
NP_441813.1_5 Reverse -103 -113 9.7148 0.0241
NP_441813.1_5 Reverse -35 -45 9.7148 0.0241
NP_441813.1_5 Forward -116 -106 5.5849 0.118
NP_441813.1_5 Forward -48 -38 5.5849 0.118
NP_439901.1_1 Forward -118 -99 4.12936 0.235
NP_439901.1_1 Forward -50 -31 4.12936 0.235
NP_440590.1_4 Reverse -106 -119 12.9006 0.013
NP_440590.1_4 Reverse -38 -51 12.9006 0.013
NP_440567.1_1 Reverse -106 -120 1.27789 0.211
NP_440567.1_1 Reverse -38 -52 1.27789 0.211
NP_442497.1_10 Forward -113 -104 0.589713 0.153
NP_442497.1_10 Forward -45 -36 0.589713 0.153
NP_440821.1_4 Forward -116 -106 5.78156 0.106
NP_440821.1_4 Forward -48 -38 5.78156 0.106
NP_440821.1_4 Reverse -103 -113 0.471689 0.174
NP_440821.1_4 Reverse -35 -45 0.471689 0.174
NP_441239.1_9 Forward -116 -104 8.10212 0.142
NP_441239.1_9 Forward -48 -36 8.10212 0.142
NP_442691.1_2 Reverse -119 -138 6.19431 0.216
NP_442568.1_8 Forward -24 -10 10.1277 0.257
NP_441892.1_1 Forward -335 -318 -3.5994 0.244
NP_440219.1_2 Reverse -191 -209 26.6668 0.00208
NP_440949.1_7 Reverse -97 -116 10.4217 0.233
NP_440949.1_7 Reverse -29 -48 10.4217 0.233
NP_440546.1_4 Reverse -105 -115 12.1791 0.0679
NP_440546.1_4 Reverse -37 -47 12.1791 0.0679
NP_440546.1_4 Forward -114 -104 6.55553 0.291
NP_440546.1_4 Forward -46 -36 6.55553 0.291
NP_440462.1_6 Reverse -103 -113 7.74818 0.0699
NP_440462.1_6 Reverse -35 -45 7.74818 0.0699
NP_440462.1_6 Forward -116 -106 6.37155 0.118
NP_440462.1_6 Forward -48 -38 6.37155 0.118
NP_440868.1_4 Reverse -101 -113 17.0502 0.0124
NP_440868.1_4 Reverse -33 -45 17.0502 0.0124
NP_441474.1_1 Reverse -125 -144 -1.57461 0.262
NP_442402.1_2 Reverse -218 -232 11.012 0.291
NP_442402.1_4 Reverse -213 -232 -7.76943 0.278
NP_442882.1_7 Reverse -98 -112 11.2087 0.261
NP_442882.1_7 Reverse -30 -44 11.2087 0.261
NP_442039.1_4 Reverse -106 -113 11.6422 0.0747
NP_442039.1_4 Reverse -38 -45 11.6422 0.0747
NP_442039.1_10 Reverse -153 -171 16.9313 0.209
NP_442837.1_3 Forward -113 -106 6.0373 0.25
NP_442837.1_3 Reverse -106 -113 6.0373 0.25
NP_442837.1_3 Forward -45 -38 6.0373 0.25
NP_442837.1_3 Reverse -38 -45 6.0373 0.25
NP_442053.1_1 Forward -114 -105 14.4544 0.0114
NP_442053.1_1 Forward -46 -37 14.4544 0.0114
NP_442053.1_1 Reverse -105 -114 7.86621 0.0863
NP_442053.1_1 Reverse -37 -46 7.86621 0.0863
NP_440505.1_3 Reverse -103 -113 14.3364 0.0224
NP_440505.1_3 Reverse -35 -45 14.3364 0.0224
NP_440505.1_3 Reverse -293 -303 4.50326 0.284
NP_440914.1_1 Reverse -105 -115 12.1284 0.0654
NP_440914.1_1 Reverse -37 -47 12.1284 0.0654
NP_441011.1_8 Forward -113 -104 7.07956 0.179
NP_441011.1_8 Forward -45 -36 7.07956 0.179
NP_442533.1_1 Forward -141 -122 -15.2418 0.253
NP_442533.1_6 Forward -114 -105 4.42462 0.179
NP_442533.1_6 Forward -46 -37 4.42462 0.179
NP_442533.1_6 Reverse -317 -326 3.04799 0.228
NP_442541.1_10 Reverse -258 -272 4.71887 0.248
NP_441482.1_7 Reverse -99 -113 -3.147 0.11
NP_441482.1_7 Reverse -31 -45 -3.147 0.11
NP_439944.1_9 Reverse -252 -262 8.4365 0.108
NP_441028.1_6 Reverse -223 -233 7.74772 0.218
NP_441028.1_6 Reverse -255 -265 5.38779 0.255
NP_441028.1_6 Reverse -254 -264 3.71617 0.281
NP_441028.1_6 Reverse -222 -232 3.51951 0.292
NP_440116.1_8 Reverse -106 -125 12.6841 0.0278
NP_440116.1_8 Reverse -38 -57 2.75272 0.0854
NP_441527.1_4 Forward -26 -7 4.05798 0.111
NP_441527.1_4 Forward -29 -10 -3.29489 0.164
NP_441527.1_4 Forward -273 -254 -8.45146 0.244
NP_441527.1_4 Forward -274 -255 -11.4117 0.282
NP_440115.1_6 Reverse -102 -112 7.64985 0.146
NP_440115.1_6 Reverse -34 -44 7.64985 0.146
NP_440007.1_9 Reverse -101 -115 4.12949 0.267
NP_440007.1_9 Reverse -33 -47 4.12949 0.267
NP_440007.1_9 Forward -330 -316 1.37622 0.285
NP_439965.1_7 Reverse -92 -111 10.0276 0.294
NP_439965.1_7 Reverse -24 -43 10.0276 0.294
NP_441106.1_1 Reverse -104 -113 8.45619 0.0548
NP_441106.1_1 Reverse -36 -45 8.45619 0.0548
NP_439903.1_6 Reverse -148 -167 1.47364 0.245
NP_001035870.1_3 Reverse -94 -113 1.0811 0.163
NP_001035870.1_3 Reverse -26 -45 1.0811 0.163
NP_441286.1_1 Reverse -104 -116 1.7106 0.0803
NP_441286.1_1 Reverse -36 -48 1.7106 0.0803
NP_440670.1_8 Reverse -105 -114 8.75118 0.0606
NP_440670.1_8 Reverse -37 -46 8.75118 0.0606
NP_440670.1_8 Forward -114 -105 6.19458 0.124
NP_440670.1_8 Forward -46 -37 6.19458 0.124
NP_440886.1_7 Reverse -104 -114 6.86274 0.113
NP_440886.1_7 Reverse -36 -46 6.86274 0.113
NP_440886.1_7 Forward -115 -105 6.66608 0.115
NP_440886.1_7 Forward -47 -37 6.66608 0.115
NP_442614.1_2 Reverse -105 -119 6.29277 0.291
NP_442614.1_2 Reverse -37 -51 6.29277 0.291
NP_440907.2_8 Forward -113 -103 6.17443 0.178
NP_440907.2_8 Forward -45 -35 6.17443 0.178
NP_441463.1_3 Reverse -307 -326 -5.21209 0.222
NP_441626.1_2 Reverse -106 -113 12.2322 0.0511
NP_441626.1_2 Reverse -38 -45 12.2322 0.0511
NP_441626.1_2 Forward -113 -106 5.93897 0.231
NP_441626.1_2 Forward -45 -38 5.93897 0.231
NP_442794.1_1 Forward -118 -106 2.49725 0.288
NP_442794.1_1 Forward -50 -38 2.49725 0.288
NP_441962.1_4 Forward -119 -100 -0.983855 0.117
NP_441962.1_4 Forward -51 -32 -0.983855 0.117
NP_441431.1_2 Reverse -102 -116 11.9953 0.128
NP_441431.1_2 Reverse -34 -48 11.9953 0.128
NP_440634.1_10 Reverse -142 -161 8.94676 0.221
NP_441993.1_1 Forward -144 -125 0.777198 0.292
NP_442437.1_3 Forward -112 -93 14.7483 0.106
NP_442437.1_3 Forward -44 -25 14.7483 0.106
NP_441510.2_7 Forward -243 -229 9.6354 0.281
NP_440293.1_10 Forward -136 -117 1.57275 0.219
NP_440766.1_4 Forward -118 -104 8.06273 0.0871
NP_440766.1_4 Forward -50 -36 8.06273 0.0871
NP_441237.1_9 Reverse -106 -116 11.7798 0.156
NP_441237.1_9 Reverse -38 -48 11.7798 0.156
NP_440457.1_1 Reverse -101 -113 2.79224 0.205
NP_440457.1_1 Reverse -33 -45 2.79224 0.205
NP_440054.1_4 Reverse -189 -208 13.8641 0.148
NP_442509.1_9 Forward -114 -104 9.71433 0.192
NP_442509.1_9 Forward -46 -36 9.71433 0.192
NP_441765.1_4 Forward -282 -263 11.8975 0.183
NP_440554.1_4 Forward -113 -103 13.5497 0.0245
NP_440554.1_4 Forward -45 -35 13.5497 0.0245
NP_441885.1_5 Reverse -105 -115 9.51814 0.0206
NP_441885.1_5 Reverse -37 -47 9.51814 0.0206
NP_442341.1_7 Reverse -104 -118 7.17775 0.11
NP_442341.1_7 Reverse -36 -50 7.17775 0.11
NP_442341.1_7 Reverse -204 -218 2.16287 0.267
NP_442341.1_9 Reverse -103 -117 9.73373 0.144
NP_442341.1_9 Reverse -35 -49 9.73373 0.144
NP_441173.1_9 Reverse -223 -231 9.75379 0.284
NP_440119.1_2 Forward -134 -116 3.26407 0.299
NP_442395.2_9 Reverse -206 -222 12.2516 0.279
NP_442534.1_7 Reverse -127 -146 15.9291 0.163
NP_440191.1_4 Reverse -224 -234 15.0872 0.254
NP_440423.1_6 Reverse -97 -116 -15.8318 0.229
NP_440423.1_6 Reverse -29 -48 -15.8318 0.229
NP_443000.1_7 Forward -328 -318 3.81494 0.226
NP_443000.1_7 Reverse -103 -113 1.84832 0.228
NP_443000.1_7 Reverse -35 -45 1.84832 0.228
NP_440507.2_3 Forward -145 -126 12.7816 0.145
NP_440275.1_3 Reverse -103 -113 12.8614 0.0299
NP_440275.1_3 Reverse -35 -45 12.8614 0.0299
NP_441359.1_5 Reverse -102 -121 0.687771 0.29
NP_441359.1_5 Reverse -34 -53 0.687771 0.29
NP_439962.1_4 Forward -144 -125 -3.93378 0.262
NP_440175.1_7 Reverse -291 -309 10.6318 0.25
NP_440216.1_1 Forward -114 -100 -4.52363 0.111
NP_440216.1_1 Forward -46 -32 -4.52363 0.111
NP_440216.1_1 Forward -144 -130 -12.5868 0.288
NP_440172.1_1 Reverse -105 -115 6.27322 0.107
NP_440172.1_1 Reverse -37 -47 6.27322 0.107
NP_441226.1_7 Reverse -106 -113 12.7234 0.0312
NP_441226.1_7 Reverse -38 -45 12.7234 0.0312
NP_441226.1_7 Forward -113 -106 11.5435 0.0757
NP_441226.1_7 Forward -45 -38 11.5435 0.0757
NP_441111.1_7 Forward -113 -105 8.86921 0.0589
NP_441111.1_7 Forward -45 -37 8.86921 0.0589
NP_441766.1_2 Forward -114 -105 14.7494 0.00772
NP_441766.1_2 Forward -46 -37 14.7494 0.00772
NP_441766.1_9 Forward -143 -124 -2.16383 0.276
NP_442969.1_4 Forward -107 -88 5.30933 0.274
NP_442969.1_4 Forward -39 -20 5.30933 0.274
NP_442417.1_5 Forward -114 -100 8.06273 0.164
NP_442417.1_5 Forward -46 -32 8.06273 0.164
NP_440416.1_9 Reverse -110 -129 -16.3235 0.212
NP_440072.1_5 Forward -142 -124 -2.73412 0.271
NP_442154.1_1 Forward -144 -126 0.314141 0.103
NP_442046.1_8 Reverse -318 -337 12.1925 0.293
NP_440261.1_5 Forward -113 -100 -3.02898 0.108
NP_440261.1_5 Forward -45 -32 -3.02898 0.108
NP_440261.1_5 Forward -286 -273 -4.79893 0.17
NP_440988.1_10 Forward -116 -102 5.18926 0.243
NP_440988.1_10 Forward -48 -34 5.18926 0.243
NP_440988.1_10 Forward -322 -308 4.89883 0.249
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AAAGCAAAATATATGGCAGTGGTCTCCTAACAAGGGAGGTTTCTGTAACTACGTGAGTGGAGTGTCCCATCAATAGTGATGGCAGTGAGAAGCAAATCCTATTACCAGGGCTGTAAGGTGGCCCCGAAAAAGTGGACAGGGGAGAAAGCTCTAAACTAAAAACTGCAACCGGGGAAAACAATCATGGCTGATTCTCAAATAGCTGTTTTTAGCGCTACTGGTGGGGTTCAGTTTAGACTTGGAGATGATGTTAACTGGCGCTGGTGGGCTGGCGGCGTGTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAGAATCCTTGCGAGTATAAGTCATACAGACGGAGTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAGATGAAGAAATATTGGCA

CDS

GTGTGGGAGGGACTAGTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAGCTACGGCTAGGTATGCACCATCACTGGAAAAATCGTTTCAGTCCCGATCGCCGGGATTAGTAGAAGGAAAGATTGCCGACCGTTCAGGACAATATGCTGGGAGCGATGGTTTCAGTCCCGATCGCCGGGATTAG

Protein

No sequence available