Your browser is old and dusty. Try Google Chrome!

Details for ssl7004

ORF ssl7004
Accession NP_942292.1
Symbol
Category Other
Definition probable plasmid stability protein
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -238 -224 -0.492064 0.231
NP_440557.1_1 Forward -155 -136 -0.688862 0.27
NP_441418.1_6 Reverse -230 -249 -9.63698 0.0288
NP_441418.1_6 Reverse -221 -240 -20.3551 0.111
NP_441418.1_6 Reverse -224 -243 -28.5165 0.205
NP_441623.1_1 Forward -386 -368 -5.78238 0.299
NP_442752.1_4 Reverse -230 -237 10.8555 0.0846
NP_442975.1_10 Forward -243 -229 10.9137 0.0516
NP_442975.1_10 Forward -249 -235 1.86729 0.29
NP_441054.1_5 Forward -29 -10 15.7324 0.169
NP_442375.1_5 Forward -236 -222 16.2235 0.289
NP_442110.1_5 Forward -93 -74 17.8957 0.12
NP_442110.1_7 Forward -245 -231 -0.197071 0.276
NP_440014.1_3 Reverse -6 -20 16.5458 0.261
NP_441083.1_5 Forward -239 -229 -0.0199663 0.251
NP_440209.1_1 Reverse -230 -238 5.13263 0.17
NP_440331.1_4 Reverse -378 -397 -7.76869 0.291
NP_441327.1_1 Reverse -307 -326 6.03945 0.25
NP_440906.1_5 Reverse -49 -56 5.64398 0.292
NP_440906.1_9 Reverse -1 -20 17.6982 0.13
NP_441486.1_1 Forward -302 -288 1.76955 0.0999
NP_441486.1_1 Reverse -60 -74 -5.70361 0.254
NP_442634.1_4 Reverse -46 -60 -4.62196 0.211
NP_440842.1_4 Reverse -269 -288 7.69039 0.115
NP_443018.1_3 Reverse -291 -298 11.5438 0.0752
NP_443018.1_3 Reverse -231 -238 4.26735 0.267
NP_443018.1_3 Forward -238 -231 4.07068 0.299
NP_441588.1_4 Forward -237 -227 6.07655 0.214
NP_442191.1_4 Forward -392 -378 10.5083 0.298
NP_442530.1_2 Forward -276 -266 11.5831 0.284
NP_440642.1_10 Forward -300 -286 3.34225 0.275
NP_440360.1_10 Forward -249 -235 11.3077 0.164
NP_442658.1_8 Forward -248 -229 19.5673 0.0647
NP_441553.1_4 Forward -379 -361 16.4266 0.283
NP_442782.1_2 Reverse -230 -244 4.91614 0.25
NP_442937.1_5 Reverse -225 -244 11.3075 0.141
NP_441127.1_1 Reverse -230 -244 14.7492 0.134
NP_442836.1_5 Reverse -236 -255 1.27776 0.287
NP_443001.1_7 Reverse -218 -237 5.60432 0.279
NP_442690.1_1 Forward -285 -266 -0.590531 0.126
NP_441580.1_6 Forward -250 -231 -2.26216 0.217
NP_440153.1_8 Forward -245 -232 -3.52063 0.295
NP_440369.1_5 Forward -181 -162 12.3892 0.209
NP_440200.1_3 Forward -25 -6 5.211 0.298
NP_440200.1_7 Reverse -120 -139 6.32247 0.204
NP_441913.1_1 Reverse -200 -216 15.1752 0.246
NP_440411.1_2 Reverse -16 -35 3.7233 0.263
NP_440377.1_1 Reverse -266 -283 14.8491 0.185
NP_441916.1_10 Reverse -376 -395 3.44104 0.232
NP_441041.1_4 Reverse -230 -249 -1.96717 0.106
NP_442396.1_6 Reverse -276 -290 17.3912 0.254
NP_441547.1_2 Forward -22 -4 13.6872 0.0948
NP_439966.1_7 Reverse -6 -16 7.25606 0.15
NP_439966.1_7 Forward -301 -291 6.86274 0.163
NP_439966.1_7 Forward -241 -231 6.56775 0.177
NP_440202.1_10 Forward -90 -71 11.5042 0.264
NP_441079.1_7 Reverse -266 -285 -1.18128 0.201
NP_441079.1_7 Forward -364 -345 -3.24622 0.233
NP_441079.1_7 Reverse -343 -362 -3.73788 0.238
NP_442847.1_3 Reverse -72 -91 7.07848 0.235
NP_442172.1_1 Forward -364 -345 11.6148 0.251
NP_001035871.2_7 Reverse -381 -391 11.9764 0.274
NP_441644.1_6 Forward -239 -229 4.10949 0.249
NP_443049.1_6 Reverse -289 -299 11.4458 0.257
NP_442029.1_1 Reverse -228 -247 -1.96717 0.163
NP_442029.1_10 Forward -396 -377 9.0459 0.239
NP_442671.1_2 Reverse -107 -126 1.18675 0.242
NP_439922.1_3 Reverse -259 -278 23.0609 0.0123
NP_442554.1_8 Forward -238 -228 4.50326 0.184
NP_442554.1_8 Reverse -291 -301 2.33998 0.274
NP_442554.1_8 Reverse -380 -390 2.24165 0.276
NP_442142.1_4 Forward -242 -229 10.6384 0.0697
NP_442142.1_4 Reverse -376 -389 6.21356 0.17
NP_442292.1_1 Forward -238 -229 5.80125 0.129
NP_440895.1_5 Forward -269 -251 17.4229 0.298
NP_443009.1_2 Forward -237 -218 2.26107 0.216
NP_442301.1_2 Forward -249 -230 4.81688 0.272
NP_440158.1_1 Forward -367 -348 10.265 0.255
NP_440379.1_5 Forward -248 -229 -8.65367 0.253
NP_441468.1_1 Reverse -291 -298 4.07068 0.263
NP_441468.1_1 Reverse -231 -238 3.97235 0.277
NP_441015.1_10 Reverse -231 -250 5.11266 0.116
NP_442811.1_2 Reverse -228 -247 0.294447 0.252
NP_442719.1_2 Reverse -125 -143 -10.9946 0.286
NP_441251.1_7 Forward -319 -306 11.3273 0.27
NP_442559.1_3 Reverse -196 -215 7.7676 0.291
NP_442227.1_2 Forward -246 -227 -3.54046 0.293
NP_442808.1_1 Forward -240 -230 15.0242 0.0285
NP_441906.1_2 Forward -75 -56 0.785326 0.295
NP_441114.1_3 Forward -297 -288 6.29291 0.285
NP_440162.1_1 Forward -280 -261 18.364 0.18
NP_441878.1_6 Reverse -289 -299 -7.98478 0.285
NP_441590.1_4 Forward -243 -224 1.57197 0.3
NP_441458.1_8 Reverse -264 -283 11.3264 0.229
NP_441458.1_8 Forward -380 -361 2.0038 0.295
NP_441458.1_10 Forward -248 -229 1.47442 0.288
NP_441574.1_1 Reverse -218 -237 -0.983855 0.211
NP_441574.1_1 Reverse -230 -249 -7.57203 0.292
NP_442632.1_1 Forward -297 -278 12.585 0.244
NP_442888.1_6 Reverse -369 -388 5.80098 0.228
NP_442594.1_8 Reverse -221 -240 3.24438 0.286
NP_442998.1_10 Forward -237 -230 6.13563 0.181
NP_440299.1_1 Forward -243 -230 7.19687 0.119
NP_441007.1_10 Reverse -225 -238 4.73917 0.182
NP_441270.1_5 Forward -21 -2 13.775 0.211
NP_441179.1_9 Forward -241 -231 10.1076 0.28
NP_440537.1_7 Reverse -185 -204 14.3711 0.119
NP_441464.1_10 Forward -24 -10 8.75105 0.27
NP_440702.1_2 Reverse -234 -253 -6.39206 0.257
NP_440695.1_5 Reverse -230 -249 4.71934 0.192
NP_440677.1_1 Forward -54 -35 9.73422 0.181
NP_442386.1_9 Forward -240 -231 6.58748 0.219
NP_441750.1_1 Reverse -224 -243 -4.81876 0.204
NP_441750.1_7 Reverse -328 -338 14.533 0.254
NP_440586.1_8 Reverse -291 -298 10.9535 0.119
NP_440586.1_8 Reverse -231 -238 7.70858 0.227
NP_440684.1_9 Reverse -224 -238 11.5043 0.173
NP_441262.1_3 Reverse -230 -237 5.25066 0.215
NP_440372.1_3 Reverse -362 -376 14.2399 0.209
NP_440171.1_2 Reverse -55 -69 16.4456 0.258
NP_442887.1_5 Forward -253 -234 -11.5053 0.264
NP_442384.1_10 Forward -45 -32 0.215946 0.297
NP_441018.1_7 Reverse -226 -245 19.5673 0.0338
NP_442790.1_4 Reverse -221 -240 -15.2418 0.289
NP_442262.1_10 Reverse -291 -298 11.7405 0.0841
NP_440344.1_10 Forward -246 -229 -7.92597 0.12
NP_440282.1_3 Forward -250 -231 -4.81876 0.298
NP_440531.1_6 Reverse -55 -74 -1.47551 0.232
NP_442917.1_1 Forward -368 -349 10.3234 0.181
NP_441060.1_1 Reverse -230 -249 16.3693 0.18
NP_441965.1_10 Forward -242 -226 3.30346 0.266
NP_440350.1_5 Forward -126 -107 -7.27704 0.299
NP_442187.1_3 Reverse -229 -239 13.5497 0.245
NP_440999.1_9 Reverse -153 -167 0.196253 0.191
NP_439969.1_1 Forward -394 -375 -6.68705 0.288
NP_441268.1_1 Forward -280 -261 16.5674 0.194
NP_441268.1_1 Reverse -339 -358 11.5064 0.273
NP_441543.1_2 Forward -65 -56 8.94785 0.0968
NP_441543.1_2 Forward -238 -229 4.91628 0.213
NP_442845.1_2 Reverse -224 -238 6.6861 0.205
NP_441918.1_7 Reverse -229 -248 5.211 0.262
NP_442710.1_7 Forward -362 -343 1.0427 0.18
NP_442315.1_1 Reverse -222 -240 6.31233 0.256
NP_442315.1_2 Reverse -225 -237 8.49544 0.293
NP_443064.1_6 Reverse -147 -157 9.85209 0.193
NP_442578.1_7 Reverse -291 -298 5.15232 0.291
NP_442780.1_3 Forward -286 -267 11.8883 0.198
NP_440454.1_1 Forward -130 -111 8.9237 0.27
NP_440516.1_8 Reverse -230 -239 7.96454 0.0463
NP_442428.1_5 Reverse -291 -298 4.46401 0.267
NP_442428.1_5 Reverse -231 -238 4.36568 0.271
NP_440673.1_3 Forward -297 -290 13.2155 0.0426
NP_440673.1_3 Forward -237 -230 11.6422 0.0724
NP_441052.1_2 Forward -239 -229 7.74818 0.0642
NP_442219.1_8 Forward -249 -230 7.49067 0.267
NP_440436.1_4 Forward -238 -229 11.0124 0.0655
NP_440314.1_9 Forward -238 -219 -3.83545 0.192
NP_442414.1_2 Reverse -224 -243 16.0274 0.134
NP_441669.1_2 Forward -281 -267 14.7486 0.28
NP_442577.1_9 Forward -340 -326 14.6503 0.209
NP_441719.1_4 Reverse -291 -298 3.77569 0.285
NP_441004.1_1 Reverse -224 -243 2.94938 0.106
NP_441004.1_3 Reverse -233 -252 2.16274 0.273
NP_441004.1_5 Reverse -226 -240 13.1759 0.223
NP_442139.1_7 Reverse -225 -244 15.3391 0.159
NP_442873.1_3 Forward -240 -221 3.34192 0.29
NP_442873.1_9 Forward -249 -230 3.24359 0.296
NP_442694.1_4 Forward -215 -206 11.7011 0.277
NP_440094.1_9 Reverse -235 -254 -4.03212 0.251
NP_441668.1_4 Reverse -220 -239 2.94938 0.189
NP_441046.1_2 Reverse -219 -238 4.42435 0.228
NP_442689.1_8 Forward -281 -264 -5.1727 0.268
NP_442843.1_1 Reverse -231 -250 -9.44032 0.266
NP_440431.1_4 Reverse -109 -128 -9.69285 0.288
NP_440588.1_2 Forward -397 -378 -0.787193 0.154
NP_440588.1_2 Reverse -27 -46 -1.27885 0.155
NP_440588.1_2 Reverse -227 -246 -5.9004 0.264
NP_441003.1_9 Reverse -21 -40 5.211 0.266
NP_441570.1_1 Reverse -230 -248 -16.9921 0.26
NP_442729.1_5 Reverse -229 -239 17.9746 0.0748
NP_441432.1_8 Reverse -229 -238 4.42462 0.213
NP_441432.1_9 Forward -279 -266 8.50141 0.289
NP_442320.1_9 Reverse -226 -240 19.8624 0.0904
NP_442727.1_10 Reverse -259 -278 2.45773 0.203
NP_442400.1_10 Reverse -370 -383 7.22367 0.292
NP_442489.1_7 Reverse -230 -239 -1.6719 0.235
NP_441706.1_1 Forward -278 -259 -3.3438 0.252
NP_440559.1_1 Forward -238 -229 4.52295 0.26
NP_442346.1_5 Reverse -229 -239 6.07655 0.216
NP_442346.1_5 Reverse -289 -299 4.60159 0.281
NP_442346.1_5 Forward -46 -36 4.50326 0.286
NP_440459.1_2 Reverse -371 -388 8.39697 0.264
NP_440010.1_10 Reverse -218 -237 10.0292 0.209
NP_442732.1_2 Forward -364 -345 15.8971 0.249
NP_441329.1_1 Reverse -338 -357 4.24897 0.296
NP_442140.1_3 Reverse -231 -241 7.64985 0.133
NP_441671.1_6 Forward -79 -60 8.35759 0.179
NP_440227.1_2 Forward -353 -337 7.53169 0.295
NP_441239.1_9 Forward -241 -229 4.36554 0.253
NP_442568.1_8 Reverse -206 -220 8.75105 0.28
NP_442568.1_8 Reverse -106 -120 8.16106 0.292
NP_442643.1_5 Forward -153 -134 0.982764 0.25
NP_440354.1_7 Forward -329 -311 10.3439 0.224
NP_440546.1_4 Reverse -230 -240 10.4338 0.109
NP_440546.1_7 Forward -388 -378 19.5479 0.131
NP_441230.1_6 Forward -240 -221 16.2241 0.153
NP_441249.1_8 Forward -22 -3 0.982764 0.284
NP_441474.1_1 Forward -240 -221 -2.45958 0.277
NP_441848.1_4 Reverse -298 -314 8.41009 0.288
NP_442923.1_4 Reverse -224 -243 -0.787193 0.214
NP_441959.1_8 Forward -272 -259 19.8924 0.123
NP_442532.1_7 Reverse -230 -244 4.32615 0.174
NP_440914.1_1 Reverse -147 -157 6.76087 0.267
NP_441011.1_8 Forward -219 -210 5.3096 0.271
NP_442533.1_1 Reverse -224 -243 -16.0285 0.262
NP_442533.1_1 Forward -20 -1 -17.1101 0.281
NP_441482.1_7 Forward -245 -231 -11.3085 0.254
NP_442269.1_10 Reverse -231 -250 4.03102 0.248
NP_441527.1_4 Reverse -106 -125 -5.77769 0.208
NP_441527.1_4 Forward -364 -345 -8.06949 0.24
NP_441527.1_4 Reverse -101 -120 -8.83343 0.251
NP_441527.1_4 Reverse -304 -323 -11.8892 0.284
NP_441815.1_2 Forward -241 -222 15.4366 0.179
NP_439903.1_6 Forward -242 -223 2.35861 0.227
NP_441286.1_1 Reverse -229 -241 1.21895 0.091
NP_442674.1_10 Reverse -51 -70 11.7008 0.21
NP_440886.1_7 Forward -240 -230 8.23937 0.0805
NP_440886.1_7 Forward -246 -236 6.86274 0.113
NP_440886.1_7 Reverse -1 -11 5.09279 0.201
NP_440404.1_9 Reverse -111 -130 15.4215 0.142
NP_440326.1_9 Forward -283 -264 11.6017 0.274
NP_441463.1_3 Forward -249 -230 -9.63698 0.282
NP_441962.1_4 Forward -244 -225 -12.5869 0.26
NP_442357.1_8 Forward -259 -240 7.7676 0.241
NP_440766.1_5 Reverse -300 -312 6.70087 0.294
NP_441237.1_9 Forward -238 -228 10.2065 0.241
NP_442930.1_1 Forward -273 -263 13.4509 0.239
NP_441133.1_1 Forward -22 -3 13.0775 0.243
NP_442680.1_5 Reverse -289 -308 4.4683 0.227
NP_441332.1_4 Forward -364 -345 5.30933 0.261
NP_442737.1_7 Forward -394 -375 16.5191 0.255
NP_442703.1_4 Forward -45 -26 4.32522 0.283
NP_442638.1_3 Forward -319 -300 11.8883 0.298
NP_440149.1_8 Reverse -230 -249 -3.3438 0.187
NP_441105.1_3 Reverse -25 -44 -7.27704 0.25
NP_440416.1_9 Forward -306 -287 -21.1417 0.291
NP_442116.1_6 Reverse -266 -283 8.07346 0.254
NP_442116.1_6 Forward -361 -344 5.87715 0.289
NP_442154.1_1 Reverse -222 -240 1.78911 0.0795
NP_442154.1_1 Reverse -231 -249 -16.0088 0.229
NP_442154.1_6 Reverse -229 -248 2.16274 0.234
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATACTTTTGCCTGCCCCTGGCGGTTAATTTTCATTCAATAAAATTCATAAAATATTGAATAACTCCCACAACCCTAATTCTATCGTGGAATTTTTTCGACTTTCCATCGCTCAACATAAATTATTGCTAATTATTCTCAGTTGATAAATTCCGACAGCTACCACCATCGCCAAAATCGTCTGTTATGCCTTTTTGCTTAGGAAAATGATGTAGTTAACCTGAAAAGTTAAATGTGAGGGTTACAGGTGATTCTCAAGGGTGTAATTTGTACTAGCTTGATTTTATTTTCTTGTTGGATTCGTTCATACACAAGCAGGGCAGGCAAATGATCAAGCGCTATCAATGCTATCATTTGAGTAATGACCAAGACCAAGAGTTTGTTTTGGGCTGGAGGTAGTGG

CDS

ATGGCTAATTTAATTGTTCGCAATATTGATGAAGCGGTGGTGGTGGCCCTGAAAAAGCGGGCGGGGCAACATGGCATTAGTGCCGAAGCAGAACATCGCAAAATCCTAGAGCAGGCCCTATTACGACTTCCCCGAAAGCCCTTTGCCGAGGTGCTCCGCCAGATTCCCAATGTGGGCAATGACTCAGATTTTGAGCGAATACAGGATGACAGAGCCAGTCAAATATTTGATTGA

Protein

No sequence available