Your browser is old and dusty. Try Google Chrome!

Details for ssl6092

ORF ssl6092
Accession NP_942535.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -59 -73 -0.688726 0.237
NP_441453.1_4 Reverse -40 -48 14.8674 0.00947
NP_441453.1_4 Forward -49 -41 6.80426 0.121
NP_442151.1_6 Forward -61 -47 5.80112 0.262
NP_442151.1_6 Reverse -52 -66 5.70279 0.266
NP_442173.1_1 Forward -48 -40 13.8841 0.0225
NP_442173.1_1 Reverse -41 -49 12.0158 0.0316
NP_442752.1_4 Forward -49 -42 13.8055 0.0199
NP_442752.1_4 Reverse -321 -328 5.34899 0.221
NP_443027.1_4 Reverse -319 -329 9.02648 0.18
NP_443027.1_4 Forward -51 -41 6.66654 0.274
NP_442975.1_10 Forward -158 -144 7.07881 0.147
NP_442975.1_10 Forward -53 -39 2.26061 0.28
NP_440784.1_7 Forward -48 -41 6.23397 0.241
NP_440784.1_7 Reverse -41 -48 6.13563 0.241
NP_440110.1_4 Reverse -29 -48 11.5042 0.104
NP_442074.1_5 Forward -299 -280 14.2574 0.286
NP_442062.1_8 Forward -49 -39 7.64985 0.0911
NP_442972.1_1 Forward -155 -137 6.52077 0.291
NP_440304.1_4 Forward -51 -41 10.2065 0.051
NP_440044.1_8 Reverse -41 -60 -2.65548 0.265
NP_441208.1_9 Reverse -242 -256 6.6861 0.234
NP_440370.1_10 Reverse -31 -50 6.68596 0.284
NP_442742.1_9 Forward -197 -178 -14.2585 0.296
NP_442110.1_7 Reverse -40 -54 3.53951 0.21
NP_441082.1_10 Reverse -343 -356 8.08242 0.289
NP_441083.1_5 Forward -49 -39 7.94484 0.048
NP_441083.1_5 Reverse -40 -50 0.766681 0.218
NP_441738.1_2 Reverse -42 -49 15.28 0.0102
NP_441738.1_2 Forward -328 -321 8.00357 0.235
NP_441738.1_2 Reverse -113 -120 6.52862 0.261
NP_440209.1_1 Forward -49 -41 8.57422 0.0425
NP_440209.1_1 Forward -67 -59 2.08437 0.286
NP_442889.1_8 Forward -52 -38 5.60385 0.222
NP_440447.1_1 Forward -349 -331 2.18243 0.285
NP_441792.1_5 Reverse -306 -322 9.59664 0.234
NP_441716.1_1 Forward -49 -35 3.8345 0.259
NP_442111.1_4 Reverse -39 -53 9.14437 0.0637
NP_440851.1_6 Forward -102 -85 -0.157821 0.29
NP_440906.1_5 Forward -48 -41 6.23397 0.234
NP_440906.1_5 Reverse -41 -48 6.13563 0.241
NP_440747.1_10 Reverse -37 -49 -2.32097 0.0331
NP_441486.1_1 Forward -52 -38 3.24451 0.0638
NP_442634.1_4 Forward -51 -37 -1.47537 0.149
NP_441012.1_4 Forward -90 -77 7.09911 0.272
NP_443018.1_3 Reverse -41 -48 11.7405 0.0655
NP_443018.1_3 Reverse -264 -271 7.11894 0.16
NP_443018.1_3 Forward -48 -41 5.44732 0.193
NP_440376.1_1 Forward -49 -40 5.89959 0.116
NP_440376.1_1 Reverse -40 -49 -0.0986038 0.285
NP_441588.1_4 Reverse -42 -52 6.66654 0.185
NP_442687.1_7 Forward -50 -40 5.78156 0.188
NP_442485.1_3 Reverse -86 -105 -3.93378 0.277
NP_442530.1_2 Forward -231 -221 13.1564 0.263
NP_442530.1_2 Reverse -372 -382 12.4681 0.276
NP_440642.1_10 Forward -94 -80 1.86729 0.287
NP_442782.1_2 Reverse -174 -188 5.40779 0.244
NP_441414.1_9 Forward -49 -30 -6.58872 0.199
NP_441414.1_9 Reverse -274 -293 -7.37537 0.217
NP_441256.1_8 Reverse -172 -191 10.5209 0.182
NP_442937.1_5 Reverse -368 -387 9.63589 0.185
NP_441958.1_5 Forward -50 -40 17.6796 0.00183
NP_440995.1_8 Reverse -30 -49 0.982764 0.264
NP_439990.1_5 Forward -54 -41 7.09911 0.212
NP_441338.2_5 Forward -42 -23 2.45773 0.299
NP_442911.1_2 Reverse -30 -49 -6.29373 0.18
NP_443055.1_3 Reverse -31 -50 11.0271 0.27
NP_443055.1_6 Forward -100 -82 3.45998 0.196
NP_441099.1_5 Reverse -30 -49 -12.2919 0.299
NP_440809.1_9 Forward -58 -40 -7.06068 0.225
NP_442438.1_10 Reverse -35 -49 0.982901 0.21
NP_441752.1_6 Forward -190 -171 2.55606 0.235
NP_441000.1_6 Reverse -334 -348 -5.01529 0.257
NP_440147.1_4 Forward -51 -38 -0.177378 0.276
NP_441550.1_8 Forward -51 -41 11.7793 0.0435
NP_441550.1_8 Reverse -38 -48 6.56775 0.201
NP_441916.1_7 Reverse -40 -50 10.0098 0.0283
NP_441916.1_10 Forward -162 -143 3.93269 0.225
NP_440345.1_3 Forward -196 -182 13.667 0.219
NP_441041.1_4 Reverse -40 -59 2.94938 0.0684
NP_441041.1_4 Forward -283 -264 -13.0786 0.28
NP_441725.1_5 Reverse -41 -51 1.35667 0.137
NP_439966.1_7 Forward -332 -322 7.45273 0.15
NP_439966.1_7 Reverse -38 -48 6.56775 0.177
NP_439966.1_7 Forward -51 -41 5.09279 0.243
NP_442941.1_3 Reverse -41 -51 10.1081 0.024
NP_442941.1_3 Forward -48 -38 7.64985 0.0628
NP_440260.1_8 Forward -101 -83 4.24738 0.154
NP_440177.1_5 Forward -179 -160 11.5042 0.272
NP_441644.1_6 Reverse -40 -50 16.4008 0.00405
NP_442215.1_2 Forward -280 -264 -5.34967 0.249
NP_440929.1_8 Reverse -40 -49 7.17789 0.0713
NP_442933.1_10 Reverse -40 -49 8.06287 0.0885
NP_442933.1_10 Forward -49 -40 7.96454 0.0937
NP_440576.1_2 Reverse -137 -156 5.89931 0.299
NP_441751.2_8 Reverse -41 -55 4.32615 0.0511
NP_441751.2_8 Forward -48 -34 -3.73699 0.154
NP_442554.1_8 Reverse -41 -51 7.15819 0.0975
NP_442554.1_8 Forward -48 -38 3.91327 0.203
NP_442142.1_4 Reverse -55 -68 5.32859 0.194
NP_442142.1_4 Forward -52 -39 2.37867 0.294
NP_442292.1_1 Reverse -41 -50 7.66954 0.0634
NP_442292.1_1 Forward -48 -39 -0.196935 0.239
NP_439989.1_6 Reverse -356 -375 6.98095 0.296
NP_441715.1_4 Reverse -41 -51 4.40493 0.281
NP_440357.1_3 Reverse -282 -301 0.58944 0.28
NP_440183.1_9 Forward -90 -71 -20.3551 0.282
NP_440379.1_5 Reverse -80 -99 -8.752 0.254
NP_440379.1_5 Forward -101 -82 -9.83364 0.267
NP_441468.1_1 Forward -48 -41 6.13563 0.209
NP_441468.1_1 Reverse -41 -48 6.0373 0.223
NP_441618.1_7 Reverse -322 -341 13.7932 0.295
NP_441015.1_10 Forward -60 -41 -10.7186 0.287
NP_441673.1_1 Forward -49 -40 1.27803 0.155
NP_441673.1_1 Reverse -40 -49 1.27803 0.155
NP_441731.1_2 Reverse -276 -295 12.7825 0.179
NP_441826.1_2 Reverse -40 -54 -2.36035 0.271
NP_441826.1_2 Forward -55 -41 -3.04867 0.282
NP_442719.1_2 Forward -98 -80 -10.4046 0.273
NP_442808.1_1 Forward -190 -180 3.91283 0.218
NP_442808.1_1 Forward -365 -355 3.42118 0.24
NP_442542.1_2 Forward -33 -20 8.18076 0.16
NP_442050.1_5 Reverse -38 -48 13.4509 0.0343
NP_442050.1_5 Forward -332 -322 10.501 0.147
NP_442050.1_5 Forward -51 -41 8.3377 0.234
NP_442792.1_5 Reverse -175 -192 9.08529 0.296
NP_441036.1_8 Forward -50 -40 10.5014 0.167
NP_441557.1_5 Forward -49 -40 8.94785 0.0289
NP_441557.1_5 Reverse -40 -49 0.688044 0.128
NP_441445.1_1 Forward -209 -190 4.22769 0.197
NP_441445.1_1 Forward -58 -39 2.16274 0.24
NP_441445.1_1 Reverse -171 -190 -0.0988766 0.286
NP_441308.1_8 Forward -51 -41 11.6814 0.22
NP_441458.1_10 Reverse -161 -180 1.67108 0.285
NP_442183.1_1 Reverse -321 -335 5.60446 0.21
NP_442183.1_1 Forward -344 -330 4.03116 0.282
NP_442135.1_3 Reverse -309 -328 4.32602 0.279
NP_441574.1_1 Forward -73 -54 -6.29373 0.276
NP_441467.1_10 Reverse -222 -236 5.40779 0.281
NP_441633.1_3 Reverse -11 -24 -2.93064 0.177
NP_440136.1_2 Forward -48 -41 6.23397 0.171
NP_440136.1_2 Reverse -41 -48 6.13563 0.193
NP_440136.1_2 Reverse -322 -329 3.97235 0.288
NP_442590.1_10 Forward -283 -264 6.09597 0.25
NP_442998.1_10 Reverse -42 -49 15.5754 0.0102
NP_440299.1_1 Reverse -36 -49 5.52525 0.172
NP_440299.1_1 Reverse -141 -154 3.46031 0.243
NP_441799.1_1 Reverse -36 -50 9.43874 0.0922
NP_441007.1_10 Forward -72 -59 -0.964025 0.296
NP_442333.2_5 Reverse -29 -48 -14.0619 0.271
NP_440256.1_1 Forward -52 -33 -3.54046 0.135
NP_440256.1_1 Reverse -37 -56 -5.60541 0.187
NP_441559.1_8 Forward -369 -355 -6.29359 0.276
NP_440915.1_6 Reverse -36 -50 -1.5737 0.239
NP_440748.1_5 Forward -53 -34 0.491109 0.25
NP_440026.1_4 Forward -52 -33 9.83255 0.244
NP_441939.1_6 Reverse -81 -100 15.4366 0.28
NP_442993.1_1 Reverse -40 -56 -9.87289 0.197
NP_442386.1_5 Forward -171 -152 6.48849 0.211
NP_442386.1_9 Reverse -39 -48 11.0124 0.107
NP_440570.1_5 Reverse -135 -154 -1.7705 0.276
NP_441750.1_1 Reverse -276 -295 0.196116 0.192
NP_441340.1_5 Forward -48 -41 13.5105 0.0314
NP_441340.1_5 Reverse -41 -48 5.84064 0.208
NP_442484.1_2 Reverse -41 -60 1.27776 0.238
NP_440059.1_3 Forward -288 -269 9.24175 0.179
NP_440586.1_1 Reverse -170 -189 -3.83545 0.273
NP_440586.1_8 Reverse -41 -48 9.47853 0.146
NP_440586.1_8 Forward -293 -286 5.93863 0.283
NP_440586.1_8 Forward -48 -41 5.74197 0.283
NP_441262.1_3 Forward -49 -42 14.7888 0.0223
NP_440027.1_3 Reverse -16 -34 5.1316 0.246
NP_440027.1_8 Reverse -37 -56 8.35677 0.249
NP_443051.1_1 Forward -50 -41 16.6177 0.00754
NP_440439.1_1 Forward -52 -39 0.314277 0.194
NP_439943.1_1 Forward -98 -79 -10.7186 0.29
NP_440372.1_2 Forward -48 -41 13.8055 0.0214
NP_440372.1_2 Reverse -41 -48 6.52896 0.188
NP_441572.1_7 Forward -55 -36 -1.27885 0.187
NP_442887.1_5 Reverse -38 -57 -14.2585 0.294
NP_442384.1_10 Reverse -40 -53 4.44418 0.157
NP_442262.1_10 Reverse -41 -48 13.2155 0.0213
NP_442262.1_10 Reverse -264 -271 8.20058 0.25
NP_442262.1_10 Forward -343 -336 7.6106 0.274
NP_441689.1_5 Forward -51 -41 15.3192 0.0403
NP_441689.1_5 Reverse -38 -48 15.3192 0.0403
NP_441689.1_5 Forward -332 -322 5.68278 0.215
NP_440344.1_10 Forward -56 -39 -6.94266 0.115
NP_440297.1_9 Reverse -41 -51 -0.609952 0.292
NP_440350.1_5 Reverse -154 -173 -1.57384 0.206
NP_442280.1_10 Forward -282 -264 6.62323 0.27
NP_440894.1_10 Forward -369 -350 2.16274 0.294
NP_440999.1_2 Reverse -263 -282 8.25926 0.292
NP_440888.1_2 Reverse -40 -54 13.372 0.0297
NP_439969.1_3 Forward -369 -350 0.58944 0.265
NP_441543.1_2 Reverse -41 -50 6.09625 0.153
NP_441543.1_2 Forward -48 -39 4.52295 0.234
NP_442845.1_2 Forward -55 -41 13.0776 0.0999
NP_442845.1_2 Reverse -342 -356 10.816 0.142
NP_442845.1_2 Reverse -268 -282 4.22782 0.264
NP_441551.1_5 Reverse -36 -52 14.6108 0.104
NP_441469.1_4 Forward -48 -29 9.24257 0.282
NP_442337.1_8 Reverse -338 -357 2.65439 0.217
NP_442578.1_7 Forward -48 -41 6.0373 0.18
NP_440220.1_4 Forward -285 -266 7.66846 0.178
NP_440220.1_4 Reverse -250 -269 -2.16459 0.266
NP_441462.1_2 Forward -49 -39 8.82982 0.03
NP_441462.1_2 Reverse -40 -50 0.668351 0.135
NP_443062.1_1 Reverse -40 -58 15.9565 0.0336
NP_443062.1_1 Forward -283 -265 9.81352 0.127
NP_443062.1_6 Forward -208 -189 7.17762 0.173
NP_440519.1_6 Reverse -35 -49 9.43936 0.29
NP_440519.1_8 Reverse -174 -190 4.77842 0.215
NP_442204.1_1 Forward -53 -42 9.89177 0.0736
NP_441351.1_1 Reverse -171 -190 11.7008 0.254
NP_441351.1_8 Reverse -81 -100 2.75272 0.24
NP_442487.1_5 Forward -375 -356 7.57013 0.198
NP_440516.1_8 Forward -49 -40 9.4395 0.0183
NP_440516.1_8 Reverse -40 -49 5.11294 0.118
NP_442428.1_5 Forward -48 -41 6.13563 0.209
NP_442428.1_5 Reverse -41 -48 6.0373 0.212
NP_440603.1_9 Forward -97 -78 1.96607 0.278
NP_440673.1_3 Reverse -42 -49 12.4288 0.0426
NP_441052.1_2 Forward -49 -39 0.57002 0.256
NP_442219.1_9 Forward -48 -39 8.75118 0.0681
NP_440436.1_4 Forward -48 -39 6.39082 0.162
NP_441884.1_8 Forward -50 -31 -12.4886 0.271
NP_442086.1_4 Forward -367 -348 14.2804 0.268
NP_442086.1_6 Reverse -284 -303 8.06259 0.274
NP_442412.1_3 Forward -362 -343 20.7473 0.05
NP_440314.1_9 Forward -115 -96 -9.53865 0.269
NP_441719.1_4 Forward -48 -41 6.82395 0.0855
NP_441719.1_4 Reverse -41 -48 6.52896 0.188
NP_441719.1_4 Reverse -322 -329 3.77569 0.285
NP_441004.1_1 Reverse -83 -102 -14.2585 0.265
NP_441004.1_1 Reverse -350 -369 -15.5368 0.275
NP_442366.1_3 Reverse -39 -57 -3.42244 0.247
NP_442176.1_1 Reverse -83 -102 0.884433 0.294
NP_442206.1_10 Forward -49 -34 4.89645 0.178
NP_440094.1_9 Forward -56 -37 -5.11376 0.287
NP_440864.1_9 Reverse -160 -179 1.76941 0.139
NP_441046.1_2 Reverse -175 -194 1.47442 0.256
NP_440940.1_7 Reverse -30 -48 4.44329 0.254
NP_441349.1_10 Reverse -30 -49 -7.57203 0.254
NP_441409.1_6 Reverse -34 -53 -14.8485 0.269
NP_442843.1_1 Reverse -171 -190 1.47442 0.165
NP_439960.1_10 Reverse -82 -100 -0.865831 0.238
NP_441124.1_5 Forward -222 -212 11.7668 0.245
NP_442168.1_5 Forward -48 -29 -0.885524 0.264
NP_442006.1_2 Reverse -74 -91 -15.6941 0.228
NP_441570.1_1 Forward -49 -31 3.55906 0.0217
NP_441078.1_4 Reverse -40 -49 0.0980582 0.205
NP_441078.1_4 Forward -49 -40 0.0980582 0.205
NP_441528.1_2 Forward -101 -82 13.0766 0.185
NP_440707.1_9 Reverse -171 -190 4.52268 0.255
NP_442443.1_1 Reverse -172 -191 -4.72043 0.276
NP_441432.1_8 Forward -50 -41 14.0611 0.0258
NP_441432.1_9 Forward -207 -194 8.30749 0.29
NP_441732.1_2 Forward -53 -37 -16.8544 0.207
NP_440760.1_1 Forward -154 -135 -16.7168 0.184
NP_440199.1_10 Forward -52 -42 14.238 0.0861
NP_442624.1_3 Forward -26 -12 14.9459 0.286
NP_441057.1_3 Reverse -358 -377 -12.1936 0.255
NP_439935.1_1 Reverse -211 -230 11.6025 0.22
NP_440713.1_4 Reverse -30 -49 14.2574 0.0896
NP_440713.1_4 Forward -59 -40 9.83255 0.136
NP_442489.1_7 Reverse -40 -49 0.786375 0.152
NP_442489.1_7 Forward -49 -40 0.589713 0.17
NP_441830.1_2 Forward -42 -23 -4.03212 0.275
NP_442079.1_7 Forward -48 -29 10.8159 0.107
NP_440559.1_1 Forward -48 -39 14.7494 0.0118
NP_441659.2_8 Reverse -40 -50 15.5163 0.006
NP_442346.1_5 Forward -50 -40 6.66654 0.195
NP_442346.1_5 Reverse -106 -116 6.17489 0.212
NP_442346.1_5 Reverse -39 -49 4.69992 0.276
NP_440459.1_2 Forward -47 -30 11.2486 0.18
NP_442603.1_7 Forward -49 -35 7.47213 0.205
NP_442603.1_7 Forward -357 -343 6.88214 0.226
NP_440946.1_6 Reverse -72 -91 18.6823 0.0717
NP_441502.1_2 Forward -167 -148 18.5994 0.211
NP_441833.1_4 Reverse -41 -48 6.52896 0.0924
NP_441833.1_4 Forward -48 -41 6.23397 0.163
NP_442162.1_9 Forward -48 -41 12.9205 0.0282
NP_442162.1_9 Reverse -41 -48 12.9205 0.0282
NP_440671.1_4 Forward -55 -41 16.6175 0.0276
NP_440671.1_4 Reverse -34 -48 5.01447 0.297
NP_442073.1_6 Reverse -49 -68 -3.24547 0.291
NP_442021.1_3 Reverse -158 -177 -7.67036 0.277
NP_440875.1_9 Reverse -42 -52 7.59334 0.255
NP_441813.1_5 Reverse -38 -48 11.9764 0.0208
NP_441813.1_5 Forward -51 -41 6.17489 0.1
NP_440590.1_4 Reverse -41 -54 -3.61896 0.255
NP_440590.1_9 Reverse -83 -101 9.75391 0.262
NP_442497.1_4 Forward -347 -328 15.9945 0.271
NP_442497.1_10 Reverse -41 -50 7.76787 0.0731
NP_442497.1_10 Forward -48 -39 -1.18024 0.256
NP_440821.1_4 Forward -51 -41 1.35667 0.137
NP_440821.1_4 Reverse -38 -48 -0.314959 0.251
NP_442568.1_8 Forward -166 -152 9.2427 0.259
NP_441892.1_1 Forward -58 -41 -2.41943 0.221
NP_441892.1_1 Reverse -312 -329 -3.40274 0.239
NP_440604.1_6 Forward -49 -30 -4.81876 0.26
NP_441617.1_6 Reverse -138 -157 7.86593 0.121
NP_440546.1_4 Forward -49 -39 12.6639 0.0641
NP_440546.1_4 Reverse -40 -50 11.6943 0.0748
NP_441230.1_8 Reverse -72 -91 21.9273 0.0651
NP_440462.1_6 Reverse -319 -329 13.0581 0.0304
NP_440462.1_6 Forward -51 -41 7.35486 0.0803
NP_440462.1_6 Reverse -38 -48 4.10993 0.216
NP_442340.1_3 Reverse -163 -182 -8.16202 0.244
NP_442592.1_2 Forward -49 -30 3.44104 0.299
NP_442499.1_1 Reverse -59 -78 8.65258 0.203
NP_440638.2_5 Reverse -24 -43 14.3558 0.234
NP_442402.1_10 Forward -97 -87 13.7459 0.199
NP_440696.1_6 Forward -61 -42 6.58763 0.266
NP_442039.1_4 Forward -48 -41 11.6422 0.0747
NP_442039.1_7 Reverse -85 -95 11.7798 0.257
NP_442039.1_7 Forward -270 -260 10.5998 0.257
NP_442039.1_7 Reverse -287 -297 7.45319 0.276
NP_441811.1_8 Forward -28 -14 8.65272 0.233
NP_442837.1_3 Forward -329 -322 8.79057 0.165
NP_442837.1_3 Forward -48 -41 6.0373 0.25
NP_442837.1_3 Reverse -41 -48 6.0373 0.25
NP_440160.1_2 Reverse -304 -323 6.88262 0.187
NP_442053.1_1 Reverse -40 -49 7.17789 0.104
NP_440505.1_3 Forward -51 -41 13.5497 0.0297
NP_440505.1_5 Reverse -182 -196 16.5192 0.237
NP_440914.1_1 Reverse -40 -50 13.1043 0.0386
NP_440914.1_1 Reverse -365 -375 6.95605 0.257
NP_441011.1_8 Reverse -41 -50 6.78456 0.184
NP_441011.1_8 Forward -48 -39 5.99792 0.208
NP_442533.1_1 Reverse -339 -358 -17.4051 0.288
NP_442533.1_6 Forward -49 -40 5.40793 0.14
NP_442533.1_6 Reverse -40 -49 4.52295 0.179
NP_442541.1_10 Forward -92 -78 6.88214 0.247
NP_442232.1_3 Forward -318 -299 -6.78538 0.191
NP_442322.1_4 Forward -191 -174 -2.02679 0.228
NP_441219.1_6 Forward -93 -75 17.9154 0.091
NP_441482.1_7 Forward -55 -41 -10.8168 0.216
NP_439944.1_9 Forward -48 -38 8.04317 0.121
NP_439944.1_9 Reverse -41 -51 7.84651 0.127
NP_442202.1_10 Forward -93 -79 4.22782 0.273
NP_440116.1_8 Forward -48 -29 -5.31042 0.19
NP_441527.1_4 Forward -167 -148 -9.40638 0.258
NP_440007.1_9 Forward -53 -39 10.226 0.163
NP_439965.1_1 Reverse -346 -365 -4.6221 0.195
NP_441106.1_1 Forward -50 -41 8.75118 0.0469
NP_441106.1_1 Reverse -284 -293 2.458 0.283
NP_441815.1_6 Reverse -18 -37 2.35861 0.239
NP_439903.1_6 Reverse -37 -56 4.03023 0.203
NP_442588.1_6 Reverse -171 -190 -2.75381 0.296
NP_441286.1_1 Forward -68 -56 -1.53432 0.145
NP_441286.1_1 Reverse -39 -51 -4.58258 0.165
NP_441286.1_1 Forward -50 -38 -6.74586 0.278
NP_441286.1_7 Forward -368 -349 13.3725 0.192
NP_440670.1_8 Forward -49 -40 8.65285 0.0627
NP_440670.1_8 Reverse -40 -49 6.29291 0.124
NP_440670.1_8 Reverse -365 -374 3.44131 0.267
NP_442614.1_2 Forward -49 -35 15.6342 0.0773
NP_442072.1_9 Reverse -144 -162 -14.7305 0.156
NP_442072.1_9 Reverse -39 -57 -23.3836 0.292
NP_440907.2_8 Reverse -41 -51 7.74772 0.117
NP_442264.1_2 Forward -59 -42 7.70866 0.231
NP_441463.1_3 Reverse -48 -67 -10.6203 0.299
NP_441626.1_2 Forward -48 -41 12.2322 0.0511
NP_441626.1_2 Reverse -41 -48 5.93897 0.231
NP_442794.1_1 Reverse -265 -277 3.87389 0.283
NP_442615.1_1 Forward -58 -40 -4.30741 0.183
NP_441431.1_2 Reverse -26 -40 7.17714 0.247
NP_440814.1_4 Forward -58 -39 -4.81876 0.183
NP_441853.1_5 Forward -173 -154 3.14605 0.279
NP_442323.1_7 Reverse -35 -54 2.26028 0.271
NP_440754.1_3 Reverse -343 -361 10.3439 0.287
NP_441272.1_7 Reverse -180 -190 16.008 0.2
NP_440293.1_3 Reverse -81 -100 9.73422 0.184
NP_440766.1_4 Forward -53 -39 11.111 0.0771
NP_441237.1_6 Reverse -83 -100 3.67709 0.262
NP_440457.1_1 Forward -53 -41 9.38042 0.0927
NP_440798.1_6 Reverse -23 -36 0.314277 0.274
NP_442130.1_8 Forward -32 -13 13.9616 0.125
NP_441489.1_3 Reverse -114 -128 7.26901 0.276
NP_440734.1_9 Forward -294 -275 10.8159 0.271
NP_441440.1_8 Reverse -80 -93 14.9656 0.299
NP_440554.1_4 Reverse -41 -51 13.1564 0.0271
NP_441845.1_6 Forward -61 -43 -0.570838 0.274
NP_441885.1_5 Forward -49 -39 17.3846 0.00578
NP_442341.1_7 Reverse -354 -368 2.45787 0.256
NP_442341.1_9 Forward -51 -37 9.6354 0.147
NP_441173.1_9 Forward -95 -87 14.3753 0.161
NP_441173.1_9 Forward -192 -184 10.2454 0.261
NP_443000.1_7 Forward -51 -41 7.74818 0.0666
NP_443000.1_7 Reverse -38 -48 6.56821 0.123
NP_443059.1_10 Reverse -32 -51 -0.29631 0.275
NP_440275.1_3 Forward -51 -41 6.56821 0.101
NP_440091.1_1 Reverse -36 -48 1.80894 0.197
NP_443060.1_2 Reverse -48 -67 10.9142 0.109
NP_443010.1_8 Forward -51 -32 22.5172 0.0455
NP_443010.1_10 Forward -52 -35 10.115 0.125
NP_440149.1_8 Forward -49 -30 -4.6221 0.211
NP_441105.1_3 Forward -60 -41 -3.73712 0.185
NP_441730.1_2 Reverse -149 -167 6.50899 0.295
NP_440216.1_9 Reverse -265 -274 14.4544 0.175
NP_440216.1_9 Reverse -264 -273 9.73449 0.286
NP_440216.1_9 Reverse -85 -94 5.3096 0.298
NP_440172.1_1 Forward -49 -39 7.55152 0.0761
NP_440172.1_1 Reverse -40 -50 4.89658 0.162
NP_442015.1_10 Reverse -36 -49 -0.37404 0.264
NP_441226.1_7 Forward -48 -41 12.7234 0.0312
NP_441226.1_7 Reverse -41 -48 11.5435 0.0757
NP_441111.1_7 Reverse -41 -49 8.86921 0.0589
NP_442379.1_10 Reverse -33 -50 -3.50107 0.263
NP_441177.1_7 Reverse -15 -34 15.4366 0.198
NP_441766.1_2 Forward -49 -40 8.1612 0.0645
NP_441766.1_2 Reverse -40 -49 5.89959 0.103
NP_440416.1_9 Reverse -45 -64 -15.4385 0.191
NP_440416.1_9 Reverse -81 -100 -18.4868 0.259
NP_440416.1_9 Forward -100 -81 -20.65 0.287
NP_442154.1_1 Forward -42 -24 -18.8604 0.286
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGATTAAAAGCGGCCCGTAATTATGAGCACATCGTCGTTGATACCCCAGCCCGACCAGAGATTGAAGAAATTCGATCCCTTGCTAGGGGGTGTGACCTCATGATCTTGCCAACGTCTCCTGATGCCCTTTCCATGGGAGCATTACAAGCAAACATCCAGACGTTTAAACAGCTAAACATTCCAAACTTTCGGATTTTGATGACTATTGTTCCGCCAAAACCTTCCACAGCAGGAACAGAAGCCAAAGAATATCTCCAAAGCTTAGGATTACCTGTTTTTAAGCGAATGATCACTCGATACGCCGCTTTTCCCAAGGCCGCCTTAGAGGGTTGTGTCGTTCGTGATGTCAAAGGCGATCGGTATGCAGGGGCCGGTTGGAATGATTACAAAACCGTGGGAG

CDS

GTGAAATTTATGGCTAAGGAAAAAAATCGCTTTGCCGGCTTCGAGAATTTTGTTCAGGCAGAATCAACTAGTTCAGAATCAGTCAAAACAAAATCAGAAGCAGCGATCGCCAAAAGTAAAGATCCAAATTTTAAAAAAACCACTCTTTATATCTCCAAAGCCACCCACCTAAAATTACGCACCCATACCCTAAGCACTGAGCAAGATATGTCCGAATTAGTGGAGGAGCTGTTAGTCGCTTACTTCAAACGTCTAGACAGCTAA

Protein

No sequence available