Your browser is old and dusty. Try Google Chrome!

Details for ssl5114

ORF ssl5114
Accession NP_942270.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -87 -101 14.8476 0.12
NP_441061.1_2 Forward -95 -81 -1.18038 0.252
NP_440795.1_7 Forward -95 -88 14.6904 0.0123
NP_440795.1_7 Reverse -88 -95 14.6904 0.0123
NP_441418.1_6 Reverse -87 -106 -19.5684 0.0906
NP_442291.1_5 Reverse -86 -102 -1.12144 0.192
NP_441453.1_4 Reverse -87 -95 16.539 0.00633
NP_441453.1_4 Forward -96 -88 16.539 0.00633
NP_441453.1_7 Forward -237 -230 14.1988 0.175
NP_442151.1_6 Forward -96 -82 7.37441 0.2
NP_442151.1_10 Reverse -86 -104 11.9172 0.289
NP_440226.1_1 Forward -96 -77 16.0274 0.022
NP_440226.1_1 Reverse -119 -138 3.34271 0.229
NP_440226.1_1 Reverse -87 -106 2.45773 0.263
NP_441465.1_8 Forward -76 -58 5.82068 0.283
NP_442173.1_1 Forward -95 -87 15.4574 0.00633
NP_442173.1_1 Reverse -88 -96 15.4574 0.00633
NP_442173.1_1 Reverse -78 -86 6.01761 0.2
NP_442752.1_4 Forward -96 -89 13.8055 0.0199
NP_442752.1_4 Reverse -87 -94 13.8055 0.0199
NP_443027.1_4 Reverse -85 -95 13.943 0.0452
NP_443027.1_4 Forward -98 -88 13.2547 0.0521
NP_443027.1_4 Forward -372 -362 9.61647 0.159
NP_442975.1_10 Reverse -83 -97 12.0937 0.0477
NP_440784.1_7 Forward -95 -88 15.9687 0.0123
NP_440784.1_7 Reverse -88 -95 15.9687 0.0123
NP_440061.1_9 Forward -98 -84 13.372 0.0819
NP_440061.1_9 Reverse -383 -397 5.40719 0.286
NP_442062.1_8 Forward -96 -86 19.4496 0.000558
NP_442062.1_8 Reverse -87 -97 10.3048 0.0493
NP_440761.1_4 Reverse -82 -101 -4.13045 0.132
NP_440304.1_4 Forward -98 -88 10.8948 0.051
NP_440304.1_4 Reverse -85 -95 9.91146 0.051
NP_442242.1_4 Forward -95 -88 14.3954 0.0124
NP_442242.1_4 Reverse -88 -95 14.3954 0.0124
NP_440044.1_8 Forward -272 -253 -1.96717 0.256
NP_441781.1_7 Reverse -270 -289 -1.67217 0.278
NP_442207.1_4 Forward -289 -270 9.93088 0.285
NP_440893.1_5 Reverse -272 -291 8.84842 0.281
NP_441208.1_9 Reverse -84 -98 8.25939 0.219
NP_441208.1_9 Forward -99 -85 8.16106 0.219
NP_440370.1_10 Forward -105 -86 13.4708 0.121
NP_440370.1_10 Reverse -78 -97 12.7825 0.137
NP_442110.1_7 Reverse -87 -101 3.44117 0.21
NP_440769.1_3 Forward -153 -134 10.52 0.28
NP_440856.1_4 Forward -103 -84 -1.96717 0.205
NP_440856.1_4 Forward -89 -70 -4.22878 0.251
NP_441083.1_5 Forward -96 -86 11.3864 0.0159
NP_441083.1_5 Reverse -87 -97 11.2881 0.0159
NP_442827.1_8 Reverse -79 -98 14.2566 0.0402
NP_441434.1_7 Forward -94 -80 3.34284 0.249
NP_441738.1_2 Forward -94 -87 15.28 0.0102
NP_441738.1_2 Reverse -89 -96 15.28 0.0102
NP_441738.1_2 Reverse -388 -395 6.52862 0.261
NP_441558.1_5 Forward -98 -79 13.3725 0.0595
NP_440209.1_1 Reverse -87 -95 18.1123 0.00295
NP_440209.1_1 Forward -96 -88 18.1123 0.00295
NP_440447.1_1 Forward -101 -83 7.09898 0.194
NP_441713.1_1 Reverse -81 -100 -5.11376 0.113
NP_441713.1_1 Reverse -44 -63 -15.1435 0.26
NP_441713.1_1 Reverse -113 -132 -16.5201 0.284
NP_440178.1_7 Reverse -270 -289 -11.0136 0.0862
NP_440178.1_7 Forward -97 -78 -11.1119 0.088
NP_440178.1_7 Reverse -86 -105 -20.0601 0.184
NP_442570.1_3 Reverse -69 -88 -4.81876 0.235
NP_441716.1_1 Reverse -87 -101 7.86607 0.156
NP_441716.1_1 Forward -96 -82 5.1128 0.24
NP_442111.1_4 Reverse -86 -100 13.4709 0.0383
NP_442111.1_4 Forward -97 -83 7.17775 0.103
NP_441163.1_1 Reverse -79 -96 11.8378 0.183
NP_440906.1_5 Forward -95 -88 15.8704 0.0124
NP_440906.1_5 Reverse -88 -95 15.8704 0.0124
NP_440747.1_10 Forward -99 -87 17.1486 0.000663
NP_440747.1_10 Reverse -84 -96 -2.02597 0.0196
NP_441130.1_10 Reverse -85 -99 10.0294 0.117
NP_441130.1_10 Forward -98 -84 9.5377 0.124
NP_441486.1_1 Reverse -84 -98 -3.44199 0.178
NP_442634.1_4 Reverse -85 -99 6.58777 0.0489
NP_442634.1_4 Forward -98 -84 5.80112 0.051
NP_440403.1_4 Reverse -78 -97 -1.57384 0.174
NP_440842.1_6 Reverse -71 -90 10.0284 0.295
NP_441014.1_10 Forward -214 -195 9.53674 0.123
NP_442848.1_1 Forward -102 -88 -0.885388 0.263
NP_442848.1_1 Reverse -81 -95 -1.8687 0.263
NP_442848.1_9 Forward -102 -83 -0.885524 0.281
NP_443018.1_3 Forward -95 -88 14.8871 0.0123
NP_443018.1_3 Reverse -88 -95 14.8871 0.0123
NP_441316.1_7 Reverse -85 -100 4.20813 0.135
NP_441634.1_8 Forward -98 -84 15.8309 0.0248
NP_441634.1_8 Forward -275 -261 1.96621 0.175
NP_440376.1_1 Forward -96 -87 19.4693 0.000692
NP_440376.1_1 Reverse -87 -96 19.4693 0.000692
NP_440376.1_1 Reverse -264 -273 5.50626 0.131
NP_441857.1_5 Reverse -80 -98 5.52568 0.2
NP_440580.1_7 Reverse -375 -394 14.4541 0.161
NP_442687.1_7 Reverse -86 -96 15.8113 0.0125
NP_442687.1_7 Forward -97 -87 9.02648 0.0994
NP_442687.1_7 Reverse -72 -82 5.38824 0.206
NP_442191.1_4 Forward -242 -228 11.0901 0.271
NP_441422.1_7 Forward -98 -81 4.26707 0.107
NP_441422.1_7 Reverse -85 -102 -2.41943 0.213
NP_441422.1_7 Reverse -269 -286 -5.56602 0.247
NP_440533.1_9 Forward -96 -77 4.81767 0.216
NP_442658.1_1 Reverse -85 -95 18.7607 0.00222
NP_442658.1_1 Forward -98 -88 14.2375 0.0237
NP_440446.1_6 Reverse -90 -109 11.3075 0.298
NP_442782.1_2 Reverse -87 -101 1.47456 0.281
NP_442782.1_2 Reverse -73 -87 1.27789 0.281
NP_442205.1_9 Reverse -81 -97 5.6634 0.128
NP_442205.1_9 Forward -65 -49 0.746852 0.26
NP_442544.1_2 Forward -368 -354 -0.787057 0.25
NP_441414.1_4 Reverse -300 -319 19.9606 0.0569
NP_441414.1_9 Forward -96 -77 4.12936 0.0552
NP_441487.1_9 Reverse -86 -105 6.19431 0.131
NP_441958.1_5 Forward -97 -87 21.2195 0.000805
NP_441958.1_5 Reverse -86 -96 12.2714 0.00183
NP_441127.1_1 Reverse -235 -249 8.65272 0.288
NP_440203.1_5 Reverse -388 -398 9.22267 0.268
NP_439905.1_1 Forward -95 -82 19.3905 0.0174
NP_440984.1_7 Reverse -82 -96 12.7826 0.122
NP_439990.1_5 Forward -101 -88 10.7374 0.128
NP_442376.1_2 Reverse -82 -101 -12.7836 0.286
NP_442690.1_1 Reverse -323 -342 -16.9135 0.294
NP_442911.1_2 Reverse -77 -96 3.53937 0.0428
NP_442911.1_2 Forward -106 -87 -11.1119 0.299
NP_440153.1_5 Reverse -88 -102 10.7177 0.0916
NP_440153.1_5 Forward -95 -81 4.71948 0.197
NP_441591.1_10 Forward -98 -79 23.8939 0.00625
NP_442119.1_6 Reverse -85 -104 19.764 0.0244
NP_443055.1_3 Forward -105 -86 16.6611 0.0731
NP_443055.1_6 Reverse -256 -274 1.78836 0.224
NP_440993.1_2 Forward -101 -85 13.2349 0.0656
NP_440934.1_2 Reverse -380 -399 0.392778 0.295
NP_441099.1_5 Forward -106 -87 -7.67036 0.179
NP_442002.1_9 Reverse -86 -93 10.7572 0.185
NP_440475.1_1 Reverse -41 -60 17.9764 0.0906
NP_441646.1_1 Reverse -264 -283 3.6377 0.206
NP_441646.1_1 Forward -103 -84 1.27776 0.232
NP_442438.1_10 Reverse -82 -96 4.71948 0.142
NP_441292.1_2 Reverse -76 -95 -6.39206 0.241
NP_441000.1_6 Forward -97 -83 -4.03198 0.225
NP_441000.1_6 Reverse -86 -100 -4.03198 0.225
NP_440147.1_4 Forward -98 -85 18.4072 0.00407
NP_440147.1_4 Reverse -85 -98 10.4424 0.0355
NP_441550.1_8 Forward -98 -88 15.8108 0.0132
NP_441550.1_8 Reverse -85 -95 10.501 0.066
NP_441916.1_7 Reverse -87 -97 18.9579 0.00144
NP_441916.1_7 Forward -96 -86 18.4663 0.00144
NP_441916.1_7 Forward -128 -118 1.74999 0.275
NP_441916.1_10 Forward -281 -262 0.491109 0.281
NP_441041.1_4 Reverse -87 -106 6.58763 0.042
NP_441041.1_7 Forward -99 -87 13.3454 0.0485
NP_441041.1_7 Reverse -84 -96 10.2357 0.1
NP_442396.1_5 Reverse -291 -304 7.49244 0.196
NP_441547.1_2 Reverse -108 -126 6.11567 0.215
NP_440703.1_9 Reverse -385 -398 7.19687 0.266
NP_441725.1_4 Forward -101 -87 22.7134 0.00544
NP_441725.1_5 Forward -95 -85 9.02648 0.0553
NP_441725.1_5 Reverse -88 -98 1.94665 0.115
NP_439966.1_7 Reverse -85 -95 17.4824 0.00636
NP_439966.1_7 Forward -98 -88 14.3359 0.0203
NP_439966.1_9 Reverse -85 -94 10.7178 0.0863
NP_439966.1_9 Forward -397 -388 3.83464 0.253
NP_442941.1_3 Reverse -88 -98 19.2529 0.00262
NP_442941.1_3 Forward -95 -85 2.53664 0.14
NP_440289.1_2 Reverse -84 -97 3.46087 0.078
NP_440289.1_2 Forward -99 -86 -3.52063 0.267
NP_440983.1_9 Forward -105 -86 1.17943 0.292
NP_442281.1_1 Forward -101 -87 17.2068 0.00633
NP_441334.1_7 Reverse -85 -104 -20.1584 0.275
NP_441334.1_7 Forward -98 -79 -20.945 0.284
NP_441079.1_7 Forward -169 -150 -5.1145 0.261
NP_441566.1_3 Reverse -232 -251 15.7324 0.198
NP_440437.1_1 Forward -102 -83 11.9958 0.0366
NP_442012.1_1 Forward -102 -83 4.42435 0.168
NP_441556.1_10 Reverse -82 -96 14.6993 0.161
NP_440498.1_1 Reverse -78 -96 1.69077 0.204
NP_440498.1_1 Forward -21 -3 -3.6191 0.267
NP_442068.1_1 Forward -60 -41 1.76941 0.298
NP_441644.1_6 Reverse -87 -97 19.0557 0.000803
NP_441644.1_6 Forward -96 -86 10.1076 0.0628
NP_441644.1_6 Forward -273 -263 3.61784 0.272
NP_442215.1_2 Forward -95 -79 -1.90808 0.189
NP_442215.1_2 Reverse -262 -278 -3.18639 0.211
NP_442215.1_2 Reverse -85 -101 -3.38305 0.214
NP_442247.1_8 Forward -98 -84 11.996 0.247
NP_440253.1_2 Reverse -87 -105 -3.32411 0.291
NP_440929.1_8 Forward -96 -87 19.2726 0.000701
NP_440929.1_8 Reverse -87 -96 19.2726 0.000701
NP_442933.1_10 Forward -96 -87 17.601 0.00325
NP_442933.1_10 Reverse -87 -96 17.601 0.00325
NP_441751.2_8 Reverse -88 -102 6.48943 0.0354
NP_441751.2_8 Reverse -265 -279 -5.60527 0.223
NP_441751.2_8 Forward -95 -81 -5.60527 0.223
NP_442554.1_8 Reverse -88 -98 17.2863 0.00543
NP_442554.1_8 Forward -95 -85 16.008 0.0065
NP_441762.1_7 Forward -97 -85 12.527 0.0142
NP_441762.1_7 Reverse -86 -98 2.30059 0.0676
NP_442142.1_4 Forward -99 -86 15.4566 0.0264
NP_442142.1_4 Reverse -84 -97 6.60689 0.16
NP_442292.1_1 Reverse -88 -97 17.5026 0.00435
NP_442292.1_1 Forward -95 -86 9.63616 0.0183
NP_442476.1_6 Forward -95 -81 14.1593 0.0401
NP_442381.1_8 Reverse -84 -103 -13.4719 0.273
NP_441523.1_6 Forward -100 -81 3.34271 0.274
NP_443009.1_5 Forward -97 -86 19.626 0.00102
NP_443009.1_5 Reverse -86 -97 7.82632 0.118
NP_441715.1_4 Reverse -88 -98 16.7946 0.0106
NP_441715.1_4 Forward -95 -85 9.32148 0.097
NP_440015.1_9 Forward -96 -78 1.39578 0.237
NP_441613.1_3 Forward -296 -277 16.8003 0.3
NP_440379.1_5 Forward -105 -86 -10.9153 0.285
NP_441468.1_1 Forward -95 -88 15.8704 0.0124
NP_441468.1_1 Reverse -88 -95 15.8704 0.0124
NP_441020.2_6 Reverse -85 -102 17.2468 0.0206
NP_441015.1_10 Forward -285 -266 7.07928 0.1
NP_441015.1_10 Reverse -82 -101 -11.1119 0.291
NP_441673.1_1 Forward -96 -87 20.8459 0.000698
NP_441673.1_1 Reverse -87 -96 20.8459 0.000698
NP_441673.1_1 Forward -273 -264 -7.76842 0.168
NP_441673.1_1 Reverse -264 -273 -8.06341 0.254
NP_441826.1_2 Forward -102 -88 2.75286 0.12
NP_441826.1_2 Forward -225 -211 2.16287 0.134
NP_441826.1_2 Reverse -81 -95 0.786239 0.172
NP_442868.1_6 Forward -98 -88 10.4031 0.038
NP_442868.1_6 Reverse -85 -95 8.53483 0.0555
NP_442719.1_2 Forward -341 -323 -1.16155 0.175
NP_441251.1_8 Reverse -141 -154 10.4704 0.282
NP_441056.1_1 Reverse -87 -106 -5.21209 0.257
NP_441305.1_1 Reverse -138 -157 15.9291 0.241
NP_442808.1_1 Reverse -86 -96 18.4657 0.00201
NP_442808.1_1 Forward -97 -87 8.73102 0.0481
NP_441101.1_10 Forward -100 -81 2.75272 0.173
NP_440145.1_3 Forward -106 -87 29.4987 0.0000724
NP_442718.1_2 Reverse -358 -377 0.786102 0.203
NP_442542.1_2 Reverse -85 -98 10.344 0.126
NP_442050.1_5 Forward -98 -88 15.9091 0.0091
NP_442050.1_5 Reverse -85 -95 8.23937 0.234
NP_442050.1_5 Reverse -384 -394 7.25606 0.265
NP_442342.1_9 Reverse -85 -101 2.41848 0.29
NP_440334.1_2 Forward -63 -50 13.6873 0.298
NP_440558.1_2 Forward -105 -86 9.83255 0.1
NP_442789.1_4 Reverse -85 -104 -8.35868 0.299
NP_441518.1_4 Forward -103 -84 0.490334 0.299
NP_441878.1_6 Forward -97 -87 10.5014 0.0176
NP_441878.1_6 Reverse -86 -96 10.4031 0.0176
NP_441878.1_6 Forward -274 -264 -6.90313 0.198
NP_441036.1_8 Reverse -86 -96 17.7779 0.000554
NP_441036.1_8 Forward -97 -87 15.713 0.00724
NP_441036.1_8 Forward -227 -217 7.84651 0.183
NP_441557.1_5 Forward -96 -87 19.9609 0.000699
NP_441557.1_5 Reverse -87 -96 19.9609 0.000699
NP_442066.2_4 Reverse -87 -106 -8.35868 0.294
NP_442066.2_9 Reverse -83 -96 10.934 0.154
NP_441308.1_8 Forward -307 -297 11.8781 0.22
NP_441308.1_8 Reverse -85 -95 9.22315 0.226
NP_440101.1_3 Reverse -82 -101 9.63589 0.133
NP_442830.1_5 Reverse -269 -283 7.47213 0.215
NP_442183.1_1 Forward -96 -82 10.816 0.0784
NP_442183.1_1 Reverse -87 -101 9.43936 0.098
NP_442166.1_7 Reverse -74 -88 7.37441 0.294
NP_441549.1_9 Reverse -83 -101 -4.70074 0.198
NP_442347.1_2 Forward -95 -86 11.1111 0.056
NP_442347.1_2 Reverse -88 -97 3.34298 0.284
NP_442347.1_7 Reverse -84 -101 13.5102 0.2
NP_442645.1_2 Forward -104 -85 -3.24547 0.0487
NP_441037.1_4 Reverse -85 -95 16.2838 0.0168
NP_441037.1_4 Forward -98 -88 7.22024 0.237
NP_441633.1_3 Forward -98 -85 13.3923 0.018
NP_441633.1_3 Reverse -85 -98 -3.81562 0.177
NP_441633.1_3 Reverse -269 -282 -7.15888 0.294
NP_440136.1_2 Forward -95 -88 15.9687 0.0123
NP_440136.1_2 Reverse -88 -95 15.9687 0.0123
NP_442590.1_10 Reverse -81 -100 10.6192 0.179
NP_442998.1_10 Forward -94 -87 15.5754 0.0102
NP_442998.1_10 Reverse -89 -96 15.5754 0.0102
NP_440299.1_1 Forward -100 -87 11.1301 0.0518
NP_440299.1_1 Reverse -83 -96 7.59019 0.109
NP_441799.1_1 Reverse -83 -97 16.0269 0.0153
NP_441799.1_1 Forward -100 -86 10.3237 0.0756
NP_441799.1_9 Forward -97 -78 0.196116 0.213
NP_440640.1_6 Forward -285 -266 9.0459 0.17
NP_441007.1_10 Reverse -82 -95 4.44418 0.182
NP_441007.1_10 Forward -101 -88 1.00259 0.209
NP_440256.1_1 Forward -99 -80 -3.73712 0.138
NP_440087.1_1 Forward -105 -86 1.47442 0.167
NP_441559.1_8 Forward -101 -87 11.0127 0.0574
NP_441559.1_8 Reverse -92 -106 3.93283 0.136
NP_441559.1_8 Reverse -82 -96 2.45787 0.143
NP_441559.1_8 Reverse -185 -199 -6.78525 0.279
NP_441559.1_8 Forward -91 -77 -6.98191 0.281
NP_440915.1_6 Forward -100 -86 10.6193 0.0301
NP_440915.1_6 Reverse -83 -97 6.88276 0.0779
NP_440717.1_1 Forward -95 -76 9.3409 0.242
NP_442785.1_7 Forward -98 -84 11.3077 0.228
NP_441704.1_8 Forward -224 -205 5.80018 0.277
NP_442866.1_1 Reverse -82 -101 7.66927 0.108
NP_441464.1_1 Forward -100 -81 13.0775 0.236
NP_441464.1_8 Forward -96 -82 9.2427 0.192
NP_440695.1_5 Reverse -87 -106 15.5357 0.109
NP_441494.1_6 Forward -272 -259 5.82081 0.292
NP_442993.1_1 Forward -96 -80 -0.138127 0.0696
NP_442993.1_1 Reverse -264 -280 -8.79125 0.176
NP_442993.1_1 Reverse -296 -312 -13.2161 0.288
NP_442386.1_9 Reverse -86 -95 15.7322 0.0144
NP_442386.1_9 Forward -97 -88 6.39082 0.219
NP_441340.1_5 Forward -95 -88 15.6737 0.0124
NP_441340.1_5 Reverse -88 -95 15.6737 0.0124
NP_442791.1_5 Reverse -69 -88 -9.93197 0.279
NP_440327.1_6 Reverse -277 -296 12.2908 0.168
NP_442240.1_2 Reverse -88 -107 -11.0136 0.137
NP_442240.1_2 Forward -95 -76 -16.6185 0.247
NP_440586.1_8 Forward -95 -88 13.2151 0.026
NP_440586.1_8 Reverse -88 -95 13.2151 0.026
NP_442251.1_6 Forward -95 -88 15.2804 0.0124
NP_442251.1_6 Reverse -88 -95 15.2804 0.0124
NP_441262.1_3 Reverse -87 -94 14.7888 0.0223
NP_441262.1_3 Forward -96 -89 14.7888 0.0223
NP_440027.1_3 Reverse -77 -95 15.653 0.0944
NP_440027.1_3 Forward -106 -88 2.87 0.284
NP_440027.1_8 Reverse -267 -286 8.35677 0.249
NP_443051.1_1 Forward -97 -88 19.5676 0.00335
NP_443051.1_1 Reverse -86 -95 10.4228 0.00754
NP_439937.1_9 Forward -97 -80 -6.35334 0.157
NP_440439.1_1 Reverse -84 -97 18.8005 0.0105
NP_440439.1_1 Forward -99 -86 18.1122 0.0105
NP_440439.1_1 Forward -89 -76 5.82081 0.0848
NP_440372.1_2 Forward -95 -88 16.3621 0.0124
NP_440372.1_2 Reverse -88 -95 16.3621 0.0124
NP_440770.1_3 Reverse -37 -51 17.5025 0.139
NP_440819.1_5 Forward -118 -110 7.98423 0.228
NP_441803.1_2 Forward -101 -82 4.916 0.171
NP_439977.1_5 Reverse -81 -100 1.27776 0.195
NP_440267.1_2 Forward -101 -87 12.487 0.125
NP_440267.1_2 Forward -87 -73 7.27547 0.202
NP_442384.1_10 Reverse -87 -100 18.8988 0.00338
NP_442384.1_10 Forward -96 -83 9.36073 0.054
NP_442114.1_4 Forward -96 -85 12.1534 0.107
NP_441877.1_7 Forward -101 -82 4.12856 0.218
NP_441018.1_7 Reverse -83 -102 8.55425 0.242
NP_442790.1_4 Reverse -78 -97 -8.16202 0.164
NP_442790.1_4 Reverse -262 -281 -15.1435 0.288
NP_442262.1_10 Forward -95 -88 14.1988 0.0123
NP_442262.1_10 Reverse -88 -95 14.1988 0.0123
NP_441689.1_5 Forward -98 -88 8.3377 0.132
NP_440531.1_6 Reverse -79 -98 0.58944 0.19
NP_440189.1_2 Reverse -69 -88 -0.295539 0.287
NP_441965.1_10 Reverse -84 -100 11.4649 0.107
NP_440297.1_9 Forward -95 -85 -0.216628 0.282
NP_440297.1_9 Reverse -88 -98 -0.216628 0.282
NP_441896.1_3 Reverse -78 -97 11.0125 0.0833
NP_440894.1_10 Reverse -266 -285 12.7825 0.122
NP_440894.1_10 Reverse -82 -101 8.84924 0.168
NP_442067.1_4 Reverse -76 -95 12.7825 0.103
NP_440999.1_9 Reverse -83 -97 16.1259 0.0216
NP_440999.1_9 Forward -100 -86 1.17956 0.169
NP_440999.1_9 Reverse -270 -284 -3.34366 0.291
NP_440888.1_2 Forward -96 -82 15.3386 0.0113
NP_440888.1_2 Reverse -264 -278 13.8636 0.0231
NP_440888.1_2 Reverse -87 -101 13.2736 0.0307
NP_442454.1_2 Forward -171 -152 12.2703 0.251
NP_442147.1_6 Forward -88 -74 15.1419 0.273
NP_439969.1_3 Reverse -82 -101 -0.197208 0.271
NP_442033.1_10 Reverse -85 -104 8.94757 0.0493
NP_442033.1_10 Forward -98 -79 4.62101 0.081
NP_441543.1_2 Forward -95 -86 18.486 0.00236
NP_441543.1_2 Reverse -88 -97 15.9293 0.00518
NP_442845.1_2 Forward -311 -297 4.91614 0.249
NP_441834.1_7 Reverse -75 -94 14.4541 0.263
NP_441551.1_5 Reverse -83 -99 21.2973 0.017
NP_441551.1_5 Forward -248 -232 7.03934 0.249
NP_441469.1_8 Reverse -86 -95 16.126 0.00797
NP_441469.1_8 Forward -97 -88 6.5879 0.227
NP_443064.1_6 Reverse -87 -97 10.8217 0.13
NP_442578.1_7 Forward -95 -88 14.5921 0.026
NP_442578.1_7 Reverse -88 -95 14.5921 0.026
NP_441462.1_2 Reverse -87 -97 20.2362 0.000805
NP_441462.1_2 Forward -96 -86 11.5831 0.00406
NP_441621.1_7 Reverse -85 -99 14.0609 0.0266
NP_441621.1_7 Forward -98 -84 -3.34366 0.188
NP_441621.1_10 Forward -235 -216 9.14423 0.231
NP_443062.1_1 Reverse -87 -105 19.0767 0.022
NP_443062.1_1 Forward -40 -22 7.66836 0.17
NP_443062.1_1 Reverse -224 -242 6.01073 0.211
NP_442204.1_1 Forward -100 -89 21.1015 0.0035
NP_442204.1_5 Reverse -77 -96 9.73422 0.0977
NP_442487.1_5 Reverse -76 -95 13.7649 0.167
NP_440516.1_2 Reverse -81 -99 7.78729 0.116
NP_440516.1_2 Forward -102 -84 2.57575 0.169
NP_440516.1_2 Forward -92 -74 2.57575 0.169
NP_440516.1_8 Forward -96 -87 16.9127 0.00442
NP_440516.1_8 Reverse -87 -96 16.9127 0.00442
NP_442428.1_4 Reverse -263 -282 2.45773 0.259
NP_442428.1_5 Forward -95 -88 15.8704 0.0124
NP_442428.1_5 Reverse -88 -95 15.8704 0.0124
NP_440673.1_3 Forward -94 -87 12.4288 0.0426
NP_440673.1_3 Reverse -89 -96 12.4288 0.0426
NP_441052.1_2 Forward -96 -86 10.5014 0.0285
NP_441052.1_2 Reverse -87 -97 10.4031 0.0285
NP_442219.1_9 Forward -95 -86 8.35786 0.0681
NP_442219.1_9 Reverse -88 -97 8.25953 0.0681
NP_440436.1_4 Forward -95 -86 18.1905 0.00233
NP_440436.1_4 Reverse -88 -97 9.24241 0.0871
NP_440436.1_4 Reverse -124 -133 5.21086 0.214
NP_441884.1_8 Forward -87 -68 -3.63879 0.143
NP_441884.1_8 Reverse -86 -105 -10.1286 0.268
NP_441884.1_9 Reverse -84 -103 -24.19 0.284
NP_440314.1_9 Reverse -88 -107 0.687771 0.0952
NP_440314.1_9 Forward -56 -37 -2.75381 0.166
NP_441719.1_4 Forward -95 -88 16.3621 0.0124
NP_441719.1_4 Reverse -88 -95 16.3621 0.0124
NP_441733.1_10 Forward -99 -86 5.82081 0.203
NP_441733.1_10 Forward -398 -385 5.13249 0.228
NP_441004.1_1 Forward -285 -266 -6.98204 0.193
NP_442366.1_3 Reverse -86 -104 -2.43913 0.228
NP_442366.1_5 Reverse -293 -303 9.91099 0.298
NP_442873.1_2 Forward -100 -81 12.29 0.224
NP_441115.1_4 Forward -97 -79 16.8329 0.0242
NP_442206.1_10 Reverse -87 -102 11.288 0.108
NP_442854.1_6 Reverse -87 -106 6.29264 0.238
NP_440328.1_4 Forward -102 -83 5.30933 0.148
NP_443054.1_2 Forward -98 -84 10.226 0.0761
NP_443054.1_2 Forward -275 -261 8.35772 0.122
NP_442430.1_10 Reverse -77 -96 9.14342 0.297
NP_441851.1_10 Reverse -86 -96 16.008 0.00552
NP_441851.1_10 Forward -97 -87 8.53483 0.114
NP_442515.1_1 Forward -97 -83 5.01447 0.107
NP_440165.1_5 Reverse -86 -105 2.16274 0.113
NP_442709.1_3 Reverse -80 -99 2.0644 0.296
NP_441046.1_2 Forward -284 -265 2.0644 0.244
NP_441349.1_10 Forward -283 -264 -4.32711 0.167
NP_441349.1_10 Reverse -77 -96 -9.83364 0.297
NP_441409.1_6 Reverse -81 -100 -6.68705 0.133
NP_440389.1_3 Forward -99 -80 13.4708 0.232
NP_440432.1_9 Reverse -88 -103 3.32315 0.0935
NP_442843.1_1 Reverse -32 -51 -2.85214 0.212
NP_439960.1_10 Forward -103 -85 -3.71743 0.279
NP_440474.1_8 Forward -95 -81 7.17714 0.207
NP_441477.1_10 Reverse -80 -98 4.14905 0.203
NP_440431.1_3 Forward -83 -64 -10.9153 0.28
NP_440431.1_4 Reverse -143 -162 0.811258 0.16
NP_439950.1_1 Reverse -38 -47 16.126 0.145
NP_440195.1_4 Forward -285 -266 9.24257 0.189
NP_442006.1_2 Reverse -228 -245 -17.2674 0.271
NP_441570.1_1 Reverse -87 -105 -0.7675 0.0506
NP_441570.1_1 Forward -96 -78 -13.1572 0.221
NP_440078.1_10 Reverse -87 -106 7.17762 0.218
NP_441078.1_4 Forward -96 -87 19.6659 0.0007
NP_441078.1_4 Reverse -87 -96 19.6659 0.0007
NP_441078.1_4 Forward -273 -264 -1.47524 0.266
NP_442729.1_8 Reverse -83 -96 9.75405 0.125
NP_441663.1_8 Forward -102 -83 0.392778 0.219
NP_442443.1_5 Forward -86 -68 10.6389 0.212
NP_440526.1_3 Reverse -387 -398 4.97473 0.261
NP_440526.1_3 Forward -95 -84 2.41814 0.267
NP_441432.1_8 Forward -97 -88 16.8143 0.00595
NP_441432.1_8 Reverse -86 -95 8.25953 0.0755
NP_441333.1_1 Forward -162 -152 11.7806 0.241
NP_442320.1_8 Reverse -258 -272 -6.49025 0.288
NP_441732.1_2 Forward -100 -84 13.0382 0.00384
NP_441732.1_2 Forward -63 -47 -16.7561 0.195
NP_440497.1_5 Reverse -79 -98 12.5858 0.2
NP_440629.1_6 Forward -102 -83 21.5814 0.00979
NP_440760.1_1 Reverse -87 -106 -11.4069 0.0851
NP_440760.1_1 Forward -96 -77 -11.5053 0.0857
NP_440760.1_7 Forward -166 -147 6.68515 0.192
NP_440913.1_1 Reverse -85 -103 3.55906 0.298
NP_442489.1_7 Forward -96 -87 20.1576 0.000695
NP_442489.1_7 Reverse -87 -96 20.1576 0.000695
NP_442489.1_7 Forward -273 -264 -0.983583 0.178
NP_440559.1_1 Forward -95 -86 8.75118 0.0586
NP_440559.1_1 Reverse -88 -97 8.65285 0.0586
NP_441659.2_8 Reverse -87 -97 20.9245 0.000805
NP_441659.2_8 Forward -96 -86 11.9764 0.0147
NP_441659.2_8 Reverse -264 -274 3.61828 0.154
NP_442913.1_10 Reverse -78 -97 -1.18052 0.167
NP_442913.1_10 Forward -105 -86 -1.47551 0.171
NP_439956.1_7 Reverse -81 -100 13.3725 0.155
NP_442346.1_5 Forward -97 -87 16.303 0.00248
NP_442346.1_5 Reverse -86 -96 9.02648 0.118
NP_440545.1_3 Forward -100 -83 15.7718 0.0128
NP_440545.1_3 Reverse -83 -100 9.28195 0.0402
NP_440545.1_3 Forward -132 -115 -7.04099 0.295
NP_440459.1_2 Forward -282 -265 8.39697 0.264
NP_440459.1_7 Reverse -85 -99 17.3641 0.0994
NP_442603.1_7 Forward -96 -82 9.04542 0.158
NP_442603.1_7 Reverse -87 -101 7.27547 0.211
NP_441585.1_5 Forward -103 -84 3.04693 0.256
NP_441888.1_7 Forward -101 -87 13.3726 0.0743
NP_440449.1_6 Reverse -79 -97 7.38047 0.225
NP_441833.1_4 Forward -95 -88 15.9687 0.0124
NP_441833.1_4 Reverse -88 -95 15.9687 0.0124
NP_441329.1_1 Reverse -330 -349 5.39487 0.265
NP_441895.1_2 Forward -298 -279 -26.8449 0.256
NP_442162.1_9 Forward -95 -88 16.2637 0.0124
NP_442162.1_9 Reverse -88 -95 16.2637 0.0124
NP_442162.1_9 Reverse -78 -85 5.93897 0.214
NP_440671.1_4 Forward -102 -88 9.14437 0.184
NP_442199.1_5 Reverse -343 -362 -7.17871 0.288
NP_442140.1_3 Forward -95 -85 17.4829 0.0159
NP_442140.1_3 Reverse -88 -98 4.69992 0.238
NP_440875.1_9 Reverse -89 -99 16.5483 0.0145
NP_440875.1_9 Forward -94 -84 15.2829 0.0295
NP_440875.1_9 Forward -373 -363 7.30133 0.269
NP_441813.1_5 Forward -98 -88 18.1713 0.00743
NP_441813.1_5 Reverse -85 -95 10.0098 0.0208
NP_440594.1_8 Forward -95 -82 9.95012 0.173
NP_440590.1_4 Forward -95 -82 14.2773 0.011
NP_440590.1_4 Reverse -78 -91 4.14919 0.0632
NP_440590.1_4 Reverse -88 -101 -2.63565 0.247
NP_440567.1_1 Forward -95 -81 3.24451 0.148
NP_442497.1_10 Reverse -88 -97 17.601 0.00813
NP_442497.1_10 Forward -95 -86 10.4228 0.0087
NP_440821.1_4 Reverse -85 -95 18.7612 0.00422
NP_440821.1_4 Forward -98 -88 2.24165 0.131
NP_441239.1_9 Reverse -85 -97 16.0669 0.0175
NP_441239.1_9 Forward -98 -86 15.5753 0.0186
NP_442897.1_7 Reverse -33 -52 14.0608 0.282
NP_442044.1_1 Forward -101 -82 -2.36049 0.176
NP_442044.1_9 Reverse -87 -106 10.2259 0.146
NP_440796.1_2 Forward -301 -282 23.8939 0.023
NP_442193.1_8 Reverse -84 -103 9.83173 0.292
NP_440546.1_4 Reverse -87 -97 13.5365 0.0459
NP_440546.1_4 Forward -96 -86 11.8882 0.0679
NP_440462.1_6 Forward -98 -88 18.7612 0.00454
NP_440462.1_6 Reverse -85 -95 17.9746 0.00578
NP_441184.1_3 Reverse -69 -88 11.4058 0.231
NP_442611.1_1 Reverse -87 -106 -0.197208 0.266
NP_440868.1_4 Reverse -83 -95 21.5735 0.00629
NP_440868.1_4 Forward -100 -88 8.00379 0.0602
NP_440868.1_8 Reverse -83 -102 -5.11376 0.272
NP_442499.1_1 Forward -101 -82 11.7992 0.201
NP_442499.1_3 Reverse -86 -104 3.75572 0.289
NP_441474.1_1 Reverse -269 -288 1.27698 0.247
NP_442402.1_1 Reverse -101 -120 9.53756 0.269
NP_441848.1_4 Forward -123 -107 10.4154 0.253
NP_441848.1_7 Forward -256 -237 0.883656 0.228
NP_441084.1_6 Forward -98 -84 11.768 0.188
NP_440653.1_10 Forward -28 -9 2.55606 0.288
NP_440696.1_3 Reverse -87 -105 -0.865831 0.249
NP_442039.1_4 Forward -95 -88 15.1821 0.0124
NP_442039.1_4 Reverse -88 -95 15.1821 0.0124
NP_441811.1_8 Reverse -81 -95 8.94771 0.227
NP_442696.1_6 Forward -53 -34 -5.01543 0.186
NP_442837.1_3 Forward -95 -88 15.7721 0.0124
NP_442837.1_3 Reverse -88 -95 15.7721 0.0124
NP_442837.1_3 Reverse -225 -232 5.74231 0.275
NP_442053.1_1 Forward -96 -87 18.3876 0.0007
NP_442053.1_1 Reverse -87 -96 18.3876 0.0007
NP_440505.1_3 Forward -98 -88 17.188 0.00332
NP_440505.1_3 Reverse -85 -95 14.1397 0.0235
NP_440505.1_7 Forward -100 -81 0.294447 0.259
NP_442456.1_5 Reverse -136 -154 9.36059 0.26
NP_442456.1_5 Forward -290 -272 5.72234 0.283
NP_442532.1_7 Forward -96 -82 6.58777 0.171
NP_440914.1_1 Reverse -87 -97 16.3248 0.00196
NP_440914.1_1 Forward -96 -86 8.6151 0.186
NP_440914.1_1 Forward -375 -365 6.27291 0.288
NP_441011.1_8 Forward -95 -86 16.9127 0.00602
NP_441011.1_8 Reverse -88 -97 16.6177 0.00602
NP_442533.1_1 Forward -288 -269 -16.1268 0.263
NP_442533.1_6 Forward -96 -87 17.2076 0.00137
NP_442533.1_6 Reverse -87 -96 17.2076 0.00137
NP_442533.1_6 Forward -273 -264 4.32629 0.184
NP_442232.1_3 Reverse -69 -88 -7.17871 0.194
NP_442232.1_3 Reverse -79 -98 -14.5535 0.288
NP_440854.1_7 Forward -164 -150 13.3791 0.296
NP_441482.1_7 Forward -102 -88 23.9923 0.00253
NP_439944.1_9 Forward -95 -85 10.4031 0.0887
NP_439944.1_9 Reverse -88 -98 9.12481 0.1
NP_441028.1_6 Forward -241 -231 4.50281 0.278
NP_440116.1_5 Reverse -84 -101 10.4619 0.139
NP_441527.1_5 Forward -200 -181 12.3088 0.297
NP_440115.1_6 Forward -99 -89 14.0414 0.0615
NP_440115.1_6 Reverse -84 -94 9.61647 0.115
NP_440007.1_9 Forward -100 -86 2.06454 0.281
NP_443045.1_5 Forward -399 -386 14.0439 0.275
NP_441602.1_3 Reverse -82 -101 4.52268 0.153
NP_441106.1_1 Forward -97 -88 18.486 0.0028
NP_441106.1_1 Reverse -86 -95 18.191 0.0028
NP_001035870.1_3 Reverse -277 -296 0.982764 0.163
NP_442306.1_10 Forward -101 -82 -19.0768 0.197
NP_441286.1_1 Forward -97 -85 5.34885 0.0259
NP_441286.1_1 Reverse -86 -98 -3.59927 0.145
NP_441286.1_1 Forward -274 -262 -6.94252 0.288
NP_440670.1_8 Forward -96 -87 18.3876 0.000699
NP_440670.1_8 Reverse -87 -96 18.3876 0.000699
NP_440886.1_7 Reverse -86 -96 17.7774 0.0011
NP_440886.1_7 Forward -97 -87 8.04271 0.0805
NP_440886.1_7 Reverse -270 -280 3.8145 0.265
NP_442614.1_2 Forward -96 -82 7.76774 0.265
NP_442072.1_9 Reverse -86 -104 -14.6322 0.153
NP_442072.1_9 Forward -97 -79 -23.0886 0.277
NP_440513.1_4 Forward -96 -77 8.94757 0.295
NP_440907.2_8 Forward -95 -85 17.4824 0.00685
NP_440907.2_8 Reverse -88 -98 9.616 0.103
NP_440907.2_8 Reverse -387 -397 5.28945 0.209
NP_441021.1_8 Forward -101 -83 4.83737 0.215
NP_441463.1_3 Reverse -254 -273 -5.60541 0.23
NP_441626.1_2 Forward -95 -88 15.7721 0.0124
NP_441626.1_2 Reverse -88 -95 15.7721 0.0124
NP_442365.1_7 Forward -100 -81 -4.72043 0.25
NP_442794.1_1 Forward -100 -88 10.5604 0.0721
NP_442794.1_5 Reverse -84 -98 12.1926 0.275
NP_442615.1_1 Reverse -78 -96 -6.66736 0.256
NP_441962.1_4 Forward -101 -82 -15.1435 0.299
NP_440387.1_1 Reverse -87 -103 14.6115 0.00635
NP_440387.1_1 Forward -96 -80 13.3332 0.00865
NP_440387.1_1 Forward -57 -41 -6.23465 0.273
NP_441431.1_2 Forward -99 -85 13.1753 0.0952
NP_441431.1_2 Reverse -84 -98 11.1104 0.146
NP_441836.1_2 Reverse -81 -100 8.35759 0.101
NP_441993.1_1 Reverse -271 -290 1.55686 0.274
NP_441174.1_2 Forward -99 -85 19.8624 0.00567
NP_440114.1_10 Forward -96 -82 11.0127 0.127
NP_440114.1_10 Forward -86 -72 9.04604 0.186
NP_441425.1_2 Forward -171 -152 13.6054 0.247
NP_441425.1_2 Reverse -151 -170 12.4595 0.255
NP_442437.1_3 Reverse -226 -245 11.3067 0.207
NP_442323.1_7 Forward -40 -21 9.83173 0.156
NP_442323.1_7 Forward -101 -82 2.45694 0.265
NP_440287.1_5 Reverse -296 -315 6.39016 0.292
NP_440766.1_4 Forward -100 -86 7.76774 0.0871
NP_442246.1_5 Forward -128 -109 16.3224 0.142
NP_442867.1_8 Forward -212 -193 5.30933 0.276
NP_440457.1_1 Forward -100 -88 7.70879 0.101
NP_440457.1_1 Reverse -83 -95 0.137309 0.25
NP_440798.1_6 Forward -95 -82 3.65753 0.15
NP_441332.1_6 Reverse -385 -395 10.7754 0.287
NP_440473.1_1 Forward -99 -80 12.7035 0.213
NP_440473.1_9 Reverse -76 -95 2.75272 0.0985
NP_442509.1_9 Forward -96 -86 16.2041 0.00739
NP_442509.1_9 Reverse -87 -97 8.04271 0.192
NP_440554.1_4 Reverse -88 -98 17.9746 0.0131
NP_440554.1_4 Forward -95 -85 13.943 0.0218
NP_441885.1_5 Forward -96 -86 11.4848 0.00668
NP_441885.1_5 Reverse -87 -97 11.3864 0.00668
NP_440478.1_10 Reverse -85 -99 14.5526 0.107
NP_442341.1_7 Forward -97 -83 9.43936 0.0751
NP_442341.1_7 Reverse -86 -100 1.67122 0.282
NP_440119.1_1 Forward -247 -231 2.91013 0.192
NP_443000.1_7 Forward -98 -88 20.3345 0.00223
NP_443000.1_7 Reverse -85 -95 2.04498 0.226
NP_442513.1_6 Reverse -62 -81 7.66846 0.296
NP_441842.1_1 Forward -94 -81 12.7034 0.19
NP_440275.1_3 Reverse -85 -95 17.9746 0.0082
NP_440275.1_3 Forward -98 -88 16.1063 0.0155
NP_440560.1_5 Forward -45 -26 9.23289 0.276
NP_440091.1_1 Reverse -83 -95 10.1671 0.0498
NP_440175.1_7 Reverse -83 -101 9.5583 0.28
NP_440149.1_8 Reverse -204 -223 -4.22878 0.203
NP_442373.1_2 Reverse -81 -100 -7.08038 0.233
NP_440216.1_1 Reverse -87 -101 7.27608 0.00942
NP_440216.1_1 Forward -96 -82 -1.18038 0.0301
NP_440216.1_9 Forward -120 -111 13.2744 0.197
NP_440172.1_1 Reverse -87 -97 17.5813 0.00421
NP_440172.1_1 Forward -96 -86 8.73149 0.0586
NP_440172.1_1 Forward -86 -76 3.91327 0.213
NP_442015.1_10 Forward -100 -87 13.4906 0.0354
NP_442015.1_10 Reverse -83 -96 3.06754 0.185
NP_441226.1_7 Forward -95 -88 14.4934 0.0123
NP_441226.1_7 Reverse -88 -95 14.4934 0.0123
NP_440117.1_7 Reverse -180 -194 18.4858 0.0592
NP_441111.1_7 Forward -95 -87 18.7023 0.00294
NP_441111.1_7 Reverse -88 -96 18.7023 0.00294
NP_441766.1_2 Forward -96 -87 17.5026 0.00297
NP_441766.1_2 Reverse -87 -96 17.5026 0.00297
NP_442417.1_5 Reverse -87 -101 16.2242 0.0423
NP_440416.1_1 Reverse -87 -106 -12.7836 0.272
NP_440416.1_9 Reverse -217 -236 -10.522 0.142
NP_440416.1_9 Forward -103 -84 -14.7502 0.18
NP_440416.1_9 Reverse -263 -282 -15.5368 0.193
NP_443052.1_8 Reverse -254 -273 -11.0136 0.221
NP_441135.1_4 Reverse -80 -99 2.16274 0.284
NP_440261.1_5 Forward -95 -82 14.3756 0.0214
NP_440261.1_5 Reverse -88 -101 -2.73398 0.0924
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TACGGTGGGATTGGGCTTTAATAACCACAATGCCATCTTTAGTAATGCGCTGATCATTAAGGTTTAACAACCGTTCCTTATACACATCGGGTAAAGAGGATGCCCCAATATCGAAGCGGAGGTGAATGGCGGAGGCCACTTTATTCACATTTTGACCTCCTGCTCCCTGGGAGCGAAGAGCGGTCATTTCGATTTCTGTTAGGGCAATACTGAGGCTTTTAGTTATCTGCAACATAATATTTTTATTTTCTCACCTATGACAAAAATGAGGAATCGTTAGCCCTGGAAAAAGTATGGAAACCCAGGCGATCGCCGCCAATCGGTTACCCTAGAAAGCAGAAAGGGAGAGCCACTAAATCTCCCCATCCTATTTGATACGCAAAAGGAATTCTAACTCACC

CDS

ATGGCAACCGTTACTGATACAGACCTAAAGGAATTGAAAGACTTGGTCATTGAGGTCAAGGTGAGCCAGGCAAGAATGGAGGCTCAGTTAGCGGGCATAGATAAACGGCTTGATGTCATTAAAACCAGGGTGGGCGGACTAACTAACTGGATTGTTGGCATCCTGTTTGCCCTGGTTGGTGGATTGCTGGGACTGTTGGGCAAAGCGATTAGAAAAGAAAACGACCCGGTTAATGGCGATCGCCGCCAATCCGTTACCCTGAAAGTAGAAAGGGAGAGCCGCTAA

Protein

No sequence available