Your browser is old and dusty. Try Google Chrome!

Details for ssl5108

ORF ssl5108
Accession NP_942264.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -50 -43 14.6904 0.0123
NP_440795.1_7 Reverse -43 -50 14.6904 0.0123
NP_441418.1_6 Reverse -42 -61 -30.7781 0.296
NP_442291.1_5 Forward -52 -36 -0.138127 0.179
NP_440897.1_9 Reverse -152 -170 13.7847 0.215
NP_441453.1_4 Reverse -42 -50 16.539 0.00633
NP_441453.1_4 Forward -51 -43 16.539 0.00633
NP_442877.1_6 Forward -218 -199 15.6341 0.226
NP_442151.1_1 Forward -114 -95 8.25926 0.27
NP_442151.1_6 Forward -51 -37 8.75105 0.164
NP_441818.1_1 Reverse -251 -262 9.00628 0.267
NP_441818.1_9 Reverse -210 -229 -8.35868 0.277
NP_440226.1_1 Reverse -42 -61 15.5357 0.0245
NP_441342.1_2 Reverse -38 -52 10.226 0.209
NP_442173.1_1 Forward -50 -42 15.4574 0.00633
NP_442173.1_1 Reverse -43 -51 15.4574 0.00633
NP_442752.1_4 Forward -51 -44 13.8055 0.0199
NP_442752.1_4 Reverse -42 -49 13.8055 0.0199
NP_443027.1_4 Forward -53 -43 5.87989 0.294
NP_442975.1_10 Forward -55 -41 3.04726 0.263
NP_442975.1_10 Reverse -38 -52 1.47397 0.297
NP_440784.1_7 Forward -50 -43 15.9687 0.0123
NP_440784.1_7 Reverse -43 -50 15.9687 0.0123
NP_440061.1_9 Forward -53 -39 8.65209 0.167
NP_440878.1_9 Reverse -199 -218 3.24438 0.174
NP_442062.1_8 Reverse -42 -52 19.4496 0.000558
NP_442062.1_8 Forward -51 -41 17.3846 0.00193
NP_440304.1_4 Forward -53 -43 1.84832 0.299
NP_440304.1_4 Reverse -40 -50 1.84832 0.299
NP_442242.1_4 Forward -50 -43 14.3954 0.0124
NP_442242.1_4 Reverse -43 -50 14.3954 0.0124
NP_440044.1_8 Forward -50 -31 -2.36049 0.262
NP_441492.1_1 Forward -119 -100 8.25926 0.276
NP_441208.1_1 Reverse -125 -144 -1.47551 0.25
NP_441208.1_9 Forward -145 -131 8.94771 0.219
NP_442742.1_9 Forward -141 -122 -12.7836 0.269
NP_442276.1_2 Reverse -197 -216 9.14423 0.285
NP_442110.1_7 Reverse -209 -223 5.50613 0.169
NP_442110.1_7 Reverse -296 -310 0.0979218 0.267
NP_442110.1_7 Reverse -250 -264 -0.295402 0.281
NP_441925.1_5 Forward -170 -156 19.3708 0.0437
NP_441083.1_5 Forward -51 -41 20.3345 0.00053
NP_441083.1_5 Reverse -42 -52 11.3864 0.0159
NP_441083.1_5 Forward -218 -208 -1.10161 0.295
NP_442827.1_8 Reverse -201 -220 -1.77127 0.256
NP_441434.1_3 Reverse -130 -149 7.66927 0.194
NP_441434.1_7 Forward -306 -292 2.75286 0.27
NP_441738.1_2 Forward -49 -42 15.28 0.0102
NP_441738.1_2 Reverse -44 -51 15.28 0.0102
NP_440209.1_1 Reverse -42 -50 18.1123 0.00295
NP_440209.1_1 Forward -51 -43 18.1123 0.00295
NP_442889.1_8 Forward -54 -40 12.9786 0.0599
NP_441713.1_1 Forward -57 -38 -16.0285 0.275
NP_441770.1_1 Forward -134 -115 12.585 0.277
NP_440178.1_7 Reverse -208 -227 -2.95047 0.0423
NP_442570.1_3 Reverse -218 -237 -0.295539 0.208
NP_442570.1_3 Reverse -193 -212 -1.67217 0.212
NP_441716.1_1 Reverse -42 -56 4.32615 0.256
NP_441598.1_3 Forward -211 -192 14.7157 0.161
NP_442111.1_4 Reverse -41 -55 17.8958 0.00908
NP_441624.1_7 Forward -134 -120 11.111 0.213
NP_441163.1_1 Forward -59 -42 9.37954 0.226
NP_440906.1_5 Forward -50 -43 15.8704 0.0124
NP_440906.1_5 Reverse -43 -50 15.8704 0.0124
NP_440747.1_10 Forward -54 -42 15.1819 0.00196
NP_440747.1_10 Reverse -39 -51 14.887 0.00223
NP_441130.1_10 Forward -310 -296 5.89945 0.211
NP_441486.1_1 Forward -54 -40 14.1593 0.00654
NP_441486.1_1 Reverse -39 -53 13.8643 0.00743
NP_441880.2_10 Reverse -291 -309 7.98396 0.284
NP_442634.1_2 Reverse -200 -219 2.55606 0.285
NP_441197.1_8 Reverse -296 -315 18.289 0.0748
NP_440403.1_10 Reverse -299 -318 12.6841 0.147
NP_440842.1_10 Reverse -123 -137 3.93283 0.254
NP_440842.1_10 Forward -213 -199 3.34284 0.257
NP_440842.1_10 Forward -137 -123 2.5562 0.274
NP_440057.1_1 Forward -211 -192 8.35759 0.276
NP_442848.1_6 Forward -203 -184 16.5191 0.236
NP_441012.1_4 Forward -208 -195 8.86907 0.272
NP_443018.1_3 Forward -50 -43 14.8871 0.0123
NP_443018.1_3 Reverse -43 -50 14.8871 0.0123
NP_443018.1_3 Reverse -94 -101 8.49558 0.141
NP_441634.1_8 Reverse -40 -54 -3.04867 0.295
NP_440376.1_1 Forward -51 -42 19.4693 0.000692
NP_440376.1_1 Reverse -42 -51 19.4693 0.000692
NP_440376.1_1 Forward -237 -228 3.7363 0.195
NP_440376.1_1 Reverse -209 -218 3.63797 0.2
NP_440376.1_1 Forward -142 -133 1.86802 0.238
NP_441588.1_4 Forward -49 -39 15.9097 0.0369
NP_441588.1_4 Reverse -44 -54 7.35486 0.178
NP_442687.1_7 Forward -52 -42 15.8113 0.0125
NP_442687.1_7 Reverse -208 -218 12.4681 0.0721
NP_442687.1_7 Reverse -41 -51 8.92815 0.0994
NP_442687.1_7 Reverse -132 -142 4.69992 0.238
NP_441797.1_7 Reverse -198 -216 9.95058 0.292
NP_441013.1_2 Forward -211 -193 1.00246 0.254
NP_442658.1_1 Forward -53 -43 15.9091 0.00966
NP_442658.1_1 Reverse -40 -50 6.76441 0.214
NP_442198.1_3 Reverse -197 -216 8.94757 0.249
NP_442205.1_9 Forward -74 -58 5.07341 0.142
NP_441414.1_9 Reverse -42 -61 -0.000545616 0.0856
NP_441414.1_9 Forward -51 -32 -0.787193 0.0943
NP_440720.1_1 Reverse -198 -217 6.98095 0.195
NP_442937.1_5 Reverse -37 -56 16.0274 0.0479
NP_442937.1_5 Reverse -8 -27 10.5209 0.158
NP_441958.1_5 Forward -52 -42 12.2714 0.00183
NP_441958.1_5 Reverse -41 -51 12.2714 0.00183
NP_441958.1_5 Reverse -208 -218 -1.10161 0.23
NP_441127.1_1 Reverse -124 -138 8.94771 0.284
NP_442836.1_10 Reverse -125 -135 15.3197 0.212
NP_440984.1_7 Reverse -37 -51 7.57108 0.166
NP_440984.1_7 Reverse -292 -306 7.07942 0.187
NP_440984.1_7 Reverse -205 -219 5.80112 0.24
NP_442911.1_2 Forward -61 -42 6.78429 0.0277
NP_440153.1_5 Reverse -210 -224 3.34284 0.215
NP_440153.1_8 Reverse -209 -222 -2.53732 0.244
NP_442064.1_4 Reverse -191 -210 9.53674 0.204
NP_443055.1_6 Reverse -34 -52 4.83661 0.181
NP_440993.1_2 Forward -223 -207 3.79511 0.256
NP_439975.1_2 Forward -374 -356 4.83737 0.285
NP_442995.1_5 Reverse -37 -56 11.2092 0.211
NP_442002.1_9 Reverse -132 -139 12.2322 0.185
NP_442002.1_9 Forward -52 -45 10.7572 0.185
NP_441712.1_3 Forward -206 -193 12.704 0.288
NP_441294.1_7 Forward -55 -41 13.6661 0.0583
NP_441424.1_7 Forward -212 -193 14.2574 0.158
NP_441646.1_1 Reverse -202 -221 4.52268 0.191
NP_442438.1_10 Forward -56 -42 5.80112 0.128
NP_442438.1_10 Forward -313 -299 0.589577 0.221
NP_442431.1_10 Forward -221 -203 1.29745 0.256
NP_441752.1_2 Forward -333 -314 11.7008 0.246
NP_441752.1_6 Reverse -297 -316 0.196116 0.26
NP_441000.1_6 Reverse -41 -55 -3.44199 0.221
NP_441000.1_6 Forward -52 -38 -5.21195 0.266
NP_440147.1_4 Forward -53 -40 12.704 0.0326
NP_440147.1_4 Reverse -40 -53 10.1474 0.0355
NP_440147.1_4 Reverse -207 -220 -0.767364 0.299
NP_441550.1_8 Reverse -40 -50 14.6309 0.0132
NP_441550.1_8 Forward -53 -43 8.3377 0.124
NP_441550.1_8 Reverse -207 -217 5.87944 0.224
NP_441916.1_7 Reverse -42 -52 18.4663 0.00144
NP_441916.1_7 Forward -51 -41 10.3048 0.0261
NP_441916.1_7 Forward -237 -227 3.51995 0.213
NP_441041.1_7 Forward -54 -42 15.6777 0.0222
NP_442396.1_5 Reverse -38 -51 12.2123 0.0913
NP_442396.1_5 Forward -55 -42 8.37742 0.157
NP_440703.1_9 Forward -204 -191 4.64028 0.295
NP_441725.1_5 Forward -50 -40 2.04498 0.115
NP_441725.1_5 Reverse -43 -53 2.04498 0.115
NP_439966.1_7 Forward -53 -43 9.91099 0.0968
NP_439966.1_7 Forward -135 -125 7.35439 0.15
NP_439966.1_7 Reverse -40 -50 7.25606 0.15
NP_439966.1_9 Forward -53 -44 0.884706 0.253
NP_442941.1_3 Forward -50 -40 11.0914 0.0116
NP_442941.1_3 Reverse -43 -53 2.63497 0.14
NP_440289.1_2 Forward -54 -41 3.06754 0.0811
NP_440289.1_2 Forward -311 -298 -2.04567 0.251
NP_440260.1_8 Forward -144 -126 -3.6191 0.253
NP_442281.1_1 Reverse -37 -51 9.93039 0.0648
NP_442281.1_1 Forward -56 -42 4.42388 0.195
NP_442281.1_1 Forward -209 -195 3.24392 0.238
NP_442256.1_2 Reverse -248 -266 -7.84733 0.215
NP_001035871.2_7 Forward -164 -154 15.0247 0.171
NP_001035871.2_7 Forward -372 -362 14.9263 0.171
NP_440437.1_1 Forward -57 -38 -2.26216 0.215
NP_442049.1_2 Forward -172 -153 8.65258 0.216
NP_440498.1_1 Forward -124 -106 -3.32411 0.261
NP_441644.1_6 Forward -51 -41 17.3841 0.00127
NP_441644.1_6 Forward -218 -208 11.091 0.0552
NP_441644.1_6 Reverse -42 -52 10.1076 0.0628
NP_441644.1_6 Forward -265 -255 4.30615 0.242
NP_442215.1_2 Reverse -40 -56 5.56507 0.0785
NP_442215.1_2 Forward -53 -37 -1.51476 0.186
NP_442215.1_10 Reverse -349 -368 15.4366 0.0573
NP_442029.1_6 Reverse -37 -56 11.8975 0.155
NP_440253.1_2 Forward -51 -33 5.42735 0.0933
NP_440929.1_8 Forward -51 -42 19.2726 0.000701
NP_440929.1_8 Reverse -42 -51 19.2726 0.000701
NP_442933.1_10 Forward -51 -42 17.601 0.00325
NP_442933.1_10 Reverse -42 -51 17.601 0.00325
NP_441751.2_8 Reverse -43 -57 -1.18038 0.129
NP_442554.1_8 Forward -50 -40 15.3197 0.00882
NP_442554.1_8 Reverse -43 -53 13.2547 0.0187
NP_442554.1_8 Reverse -210 -220 6.17489 0.125
NP_442554.1_8 Forward -307 -297 2.7333 0.259
NP_441762.1_7 Reverse -41 -53 10.1671 0.0142
NP_441762.1_7 Forward -52 -40 9.57708 0.0142
NP_441762.1_7 Reverse -298 -310 -5.46756 0.212
NP_442142.1_4 Forward -54 -41 13.8833 0.0324
NP_442142.1_4 Reverse -39 -52 5.52525 0.188
NP_442292.1_1 Forward -50 -41 18.486 0.00229
NP_442292.1_1 Reverse -43 -52 9.63616 0.0183
NP_441024.1_6 Forward -166 -147 7.30471 0.292
NP_442476.1_6 Forward -50 -36 1.57289 0.211
NP_442476.1_6 Reverse -43 -57 0.0979218 0.274
NP_442381.1_8 Forward -54 -35 -6.09707 0.152
NP_443009.1_5 Reverse -41 -52 18.3477 0.00265
NP_441715.1_4 Reverse -251 -261 10.3048 0.097
NP_441715.1_4 Reverse -43 -53 9.41981 0.097
NP_441715.1_4 Forward -50 -40 7.94484 0.107
NP_440379.1_5 Forward -317 -298 -7.17871 0.24
NP_440464.1_10 Forward -50 -40 13.0082 0.169
NP_440464.1_10 Forward -234 -224 12.9127 0.176
NP_441468.1_1 Forward -50 -43 15.8704 0.0124
NP_441468.1_1 Reverse -43 -50 15.8704 0.0124
NP_441468.1_1 Forward -307 -300 7.41394 0.121
NP_441569.1_7 Reverse -382 -396 16.1252 0.296
NP_441020.2_6 Forward -310 -293 9.08529 0.18
NP_441020.2_6 Reverse -40 -57 5.54538 0.298
NP_441020.2_7 Forward -133 -114 18.0915 0.146
NP_441020.2_7 Forward -229 -210 11.8967 0.22
NP_441673.1_1 Forward -51 -42 20.8459 0.000698
NP_441673.1_1 Reverse -42 -51 20.8459 0.000698
NP_441339.1_1 Reverse -126 -145 17.0844 0.165
NP_440265.1_7 Reverse -216 -230 14.6503 0.282
NP_441826.1_2 Forward -57 -43 1.37622 0.154
NP_441826.1_5 Reverse -204 -223 19.9606 0.0501
NP_441330.1_1 Reverse -37 -56 -13.6686 0.198
NP_442490.1_9 Reverse -197 -216 7.17762 0.139
NP_442868.1_6 Reverse -40 -50 9.81313 0.038
NP_442868.1_6 Forward -53 -43 0.865012 0.205
NP_442719.1_2 Forward -141 -123 -1.6532 0.175
NP_441612.1_2 Forward -51 -41 8.54929 0.21
NP_442227.1_2 Reverse -61 -80 1.67108 0.243
NP_442808.1_1 Forward -52 -42 18.4657 0.00201
NP_442808.1_1 Reverse -41 -51 8.63269 0.0481
NP_442808.1_1 Forward -273 -263 0.962914 0.299
NP_440918.1_2 Reverse -193 -212 11.5042 0.259
NP_440031.1_10 Reverse -74 -93 10.0292 0.167
NP_440145.1_3 Reverse -32 -51 6.4893 0.0511
NP_440145.1_3 Forward -61 -42 -1.08219 0.146
NP_442050.1_2 Forward -230 -211 7.76679 0.252
NP_442050.1_5 Reverse -40 -50 7.64939 0.243
NP_441518.1_9 Reverse -198 -216 20.2753 0.0982
NP_441878.1_6 Forward -52 -42 10.4031 0.0176
NP_441878.1_6 Reverse -41 -51 10.4031 0.0176
NP_441878.1_6 Reverse -208 -218 -0.0199663 0.163
NP_441878.1_6 Forward -219 -209 -7.19813 0.21
NP_441036.1_8 Forward -52 -42 17.7779 0.000554
NP_441036.1_8 Reverse -41 -51 8.33817 0.174
NP_442503.1_9 Reverse -176 -195 8.65258 0.22
NP_441557.1_5 Forward -51 -42 19.9609 0.000699
NP_441557.1_5 Reverse -42 -51 19.9609 0.000699
NP_441445.1_1 Forward -60 -41 17.994 0.0287
NP_441433.1_8 Reverse -120 -139 -3.93378 0.285
NP_440101.1_3 Reverse -281 -300 1.17943 0.282
NP_441458.1_10 Forward -60 -41 6.19431 0.202
NP_442830.1_5 Forward -135 -121 4.22722 0.239
NP_442183.1_1 Forward -51 -37 8.25939 0.119
NP_442347.1_2 Forward -50 -41 12.4878 0.056
NP_442347.1_2 Reverse -43 -52 11.1111 0.056
NP_442645.1_2 Reverse -34 -53 -12.3902 0.144
NP_442645.1_2 Forward -59 -40 -13.4719 0.154
NP_441037.1_4 Forward -53 -43 14.7245 0.028
NP_441037.1_4 Reverse -40 -50 7.9999 0.237
NP_442594.1_8 Forward -371 -352 10.8159 0.175
NP_441633.1_3 Reverse -40 -53 8.57408 0.0377
NP_441633.1_3 Forward -53 -40 3.46087 0.0699
NP_440136.1_2 Forward -50 -43 15.9687 0.0123
NP_440136.1_2 Reverse -43 -50 15.9687 0.0123
NP_442590.1_10 Reverse -189 -208 7.27595 0.23
NP_442998.1_5 Reverse -131 -141 7.94484 0.278
NP_442998.1_10 Forward -49 -42 15.5754 0.0102
NP_442998.1_10 Reverse -44 -51 15.5754 0.0102
NP_440299.1_1 Forward -55 -42 16.4399 0.0101
NP_440299.1_1 Reverse -38 -51 13.0967 0.0319
NP_440299.1_1 Reverse -205 -218 4.73861 0.201
NP_441799.1_1 Reverse -38 -52 16.1252 0.0153
NP_441799.1_1 Forward -55 -41 15.4369 0.0182
NP_441799.1_9 Forward -230 -211 -4.22878 0.256
NP_441007.1_10 Forward -223 -210 -0.37404 0.277
NP_442334.1_10 Reverse -203 -222 -16.6185 0.248
NP_440256.1_1 Reverse -39 -58 -9.14533 0.275
NP_441559.1_8 Forward -56 -42 9.63603 0.0625
NP_440915.1_3 Forward -223 -204 11.4058 0.29
NP_440915.1_6 Reverse -205 -219 4.62115 0.0953
NP_440915.1_6 Forward -55 -41 2.85119 0.111
NP_442069.1_1 Forward -236 -217 17.4032 0.266
NP_441464.1_8 Forward -51 -37 3.93283 0.283
NP_441464.1_10 Reverse -122 -136 10.0294 0.262
NP_442453.1_4 Forward -302 -283 18.3873 0.078
NP_441199.1_6 Forward -222 -203 7.86593 0.115
NP_441199.1_6 Forward -119 -100 -1.57384 0.295
NP_442957.1_8 Reverse -193 -212 7.86593 0.287
NP_442386.1_9 Forward -52 -43 15.7322 0.0144
NP_442386.1_9 Reverse -41 -50 13.8639 0.0289
NP_440570.1_5 Reverse -153 -172 -1.47551 0.273
NP_440570.1_5 Forward -228 -209 -2.0655 0.277
NP_441750.1_4 Reverse -209 -228 0.58944 0.297
NP_441340.1_5 Forward -50 -43 15.6737 0.0124
NP_441340.1_5 Reverse -43 -50 15.6737 0.0124
NP_442186.1_9 Forward -227 -208 13.9625 0.193
NP_442240.1_2 Reverse -186 -205 -19.3717 0.295
NP_440586.1_8 Forward -50 -43 13.2151 0.026
NP_440586.1_8 Reverse -43 -50 13.2151 0.026
NP_442251.1_6 Forward -50 -43 15.2804 0.0124
NP_442251.1_6 Reverse -43 -50 15.2804 0.0124
NP_440192.1_4 Forward -146 -127 8.9125 0.289
NP_440684.1_9 Reverse -36 -50 11.7993 0.168
NP_441262.1_3 Reverse -42 -49 14.7888 0.0223
NP_441262.1_3 Forward -51 -44 14.7888 0.0223
NP_440027.1_3 Forward -61 -43 9.35981 0.184
NP_440027.1_3 Forward -228 -210 7.09821 0.214
NP_440027.1_3 Forward -210 -192 1.98502 0.295
NP_443051.1_1 Reverse -41 -50 10.4228 0.00754
NP_443051.1_1 Forward -52 -43 10.4228 0.00754
NP_439937.1_9 Reverse -41 -58 -7.04165 0.157
NP_440439.1_1 Forward -54 -41 1.39592 0.156
NP_440439.1_1 Forward -221 -208 0.314277 0.194
NP_440439.1_1 Forward -313 -300 -1.45568 0.269
NP_440439.1_3 Reverse -232 -250 14.0805 0.259
NP_440372.1_2 Forward -50 -43 16.3621 0.0124
NP_440372.1_2 Reverse -43 -50 16.3621 0.0124
NP_441803.1_2 Forward -310 -291 0.786102 0.244
NP_441803.1_2 Reverse -294 -313 -1.08219 0.294
NP_442384.1_10 Reverse -42 -55 14.7689 0.0132
NP_442384.1_10 Forward -51 -38 8.77074 0.0608
NP_441018.1_7 Reverse -191 -210 13.5691 0.132
NP_441018.1_7 Forward -384 -365 8.84924 0.239
NP_442790.1_4 Reverse -200 -219 -9.44032 0.184
NP_442790.1_4 Reverse -33 -52 -15.9302 0.3
NP_442262.1_10 Forward -50 -43 14.1988 0.0123
NP_442262.1_10 Reverse -43 -50 14.1988 0.0123
NP_442262.1_10 Reverse -94 -101 8.59391 0.22
NP_441689.1_5 Reverse -40 -50 5.78111 0.197
NP_440344.1_10 Forward -58 -41 1.21881 0.0311
NP_440344.1_10 Reverse -35 -52 -11.0726 0.2
NP_440531.1_6 Forward -59 -40 -1.7705 0.239
NP_440531.1_8 Forward -313 -294 1.96607 0.298
NP_441060.1_4 Forward -400 -382 5.23069 0.242
NP_442910.1_1 Forward -58 -39 -7.27704 0.254
NP_440189.1_10 Reverse -31 -50 5.11266 0.279
NP_440562.1_10 Reverse -33 -51 6.70565 0.284
NP_441965.1_10 Reverse -39 -55 4.28677 0.247
NP_441640.1_8 Reverse -251 -270 -5.9004 0.292
NP_442065.1_7 Forward -60 -42 9.0656 0.184
NP_440297.1_9 Forward -50 -40 -0.118297 0.282
NP_440297.1_9 Reverse -43 -53 -0.118297 0.282
NP_440297.1_9 Forward -264 -254 -0.609952 0.292
NP_441592.1_4 Forward -51 -32 7.27595 0.124
NP_442078.1_3 Reverse -153 -172 4.71854 0.189
NP_440999.1_9 Forward -55 -41 3.53951 0.128
NP_440888.1_2 Forward -51 -37 8.06211 0.172
NP_440888.1_2 Reverse -42 -56 7.3738 0.198
NP_440888.1_2 Reverse -209 -223 6.68548 0.223
NP_440179.1_6 Reverse -43 -62 5.99764 0.22
NP_442948.1_2 Forward -52 -33 2.75272 0.3
NP_442033.1_10 Reverse -207 -226 -11.3086 0.251
NP_441543.1_2 Reverse -43 -52 18.486 0.00236
NP_441543.1_2 Forward -50 -41 16.9127 0.00359
NP_442845.1_2 Reverse -36 -50 10.521 0.148
NP_440208.1_1 Reverse -205 -224 -1.47551 0.135
NP_441319.1_8 Reverse -203 -221 6.31233 0.27
NP_441469.1_8 Forward -52 -43 16.126 0.00797
NP_441469.1_8 Reverse -41 -50 6.48957 0.227
NP_443064.1_6 Forward -51 -41 12.5669 0.0796
NP_442337.1_8 Reverse -190 -209 5.50599 0.21
NP_442578.1_7 Forward -50 -43 14.5921 0.026
NP_442578.1_7 Reverse -43 -50 14.5921 0.026
NP_441462.1_2 Forward -51 -41 11.5831 0.00406
NP_441462.1_2 Reverse -42 -52 11.5831 0.00406
NP_441462.1_2 Reverse -209 -219 7.15819 0.0583
NP_441621.1_7 Reverse -207 -221 -0.197071 0.157
NP_441621.1_7 Reverse -297 -311 -3.04867 0.188
NP_441621.1_7 Reverse -40 -54 -3.34366 0.188
NP_443062.1_1 Reverse -42 -60 8.44842 0.153
NP_441601.1_4 Forward -230 -211 -5.11376 0.293
NP_441601.1_7 Forward -236 -217 10.1275 0.23
NP_442204.1_1 Forward -269 -258 -0.0396598 0.285
NP_441560.1_3 Forward -224 -206 6.31233 0.28
NP_441560.1_8 Forward -310 -291 13.4605 0.209
NP_441560.1_10 Forward -59 -40 9.14423 0.235
NP_440516.1_2 Forward -57 -39 4.6407 0.138
NP_440516.1_8 Forward -51 -42 16.9127 0.00442
NP_440516.1_8 Reverse -42 -51 16.9127 0.00442
NP_441033.1_8 Reverse -108 -127 18.6823 0.155
NP_441033.1_8 Forward -129 -110 17.994 0.176
NP_442428.1_5 Forward -50 -43 15.8704 0.0124
NP_442428.1_5 Reverse -43 -50 15.8704 0.0124
NP_440783.1_5 Reverse -210 -229 1.47442 0.19
NP_440673.1_3 Forward -49 -42 12.4288 0.0426
NP_440673.1_3 Reverse -44 -51 12.4288 0.0426
NP_440673.1_7 Forward -270 -251 0.0977854 0.276
NP_441052.1_2 Forward -51 -41 19.9412 0.00106
NP_441052.1_2 Reverse -42 -52 10.5014 0.0285
NP_442219.1_9 Forward -50 -41 17.7976 0.00718
NP_442219.1_9 Reverse -43 -52 8.35786 0.0681
NP_440436.1_4 Reverse -43 -52 18.1905 0.00233
NP_440436.1_4 Forward -50 -41 17.2072 0.00233
NP_441884.1_8 Reverse -41 -60 -7.4737 0.251
NP_440222.1_8 Forward -118 -99 15.135 0.22
NP_440314.1_9 Forward -50 -31 -0.688862 0.113
NP_440314.1_9 Forward -141 -122 -9.44032 0.268
NP_442577.1_9 Reverse -148 -162 18.4851 0.146
NP_441719.1_4 Forward -50 -43 16.3621 0.0124
NP_441719.1_4 Reverse -43 -50 16.3621 0.0124
NP_441733.1_10 Reverse -39 -52 7.09911 0.156
NP_441004.1_1 Reverse -127 -146 -16.6185 0.286
NP_441004.1_2 Reverse -122 -141 5.70265 0.191
NP_442813.1_4 Reverse -169 -188 -7.17871 0.299
NP_442366.1_3 Forward -52 -34 3.85406 0.104
NP_442366.1_5 Reverse -39 -49 15.4175 0.0374
NP_442366.1_5 Forward -54 -44 11.9759 0.148
NP_442176.1_1 Forward -368 -349 19.6656 0.0386
NP_442873.1_5 Forward -232 -213 8.16011 0.265
NP_441115.1_4 Reverse -249 -267 7.3932 0.286
NP_441115.1_4 Reverse -41 -59 7.19654 0.295
NP_442694.1_4 Reverse -125 -134 11.7011 0.277
NP_443054.1_2 Reverse -40 -54 1.76955 0.245
NP_440864.1_9 Reverse -191 -210 -6.49039 0.258
NP_441851.1_10 Forward -52 -42 16.008 0.00552
NP_441851.1_10 Reverse -41 -51 15.8113 0.00552
NP_442011.1_1 Reverse -41 -60 -1.47551 0.268
NP_441668.1_4 Reverse -4 -23 -1.7705 0.28
NP_442515.1_1 Forward -52 -38 3.34284 0.12
NP_440593.1_3 Forward -223 -204 4.62101 0.133
NP_440593.1_3 Forward -217 -198 -5.99873 0.268
NP_441982.1_1 Reverse -2 -21 4.81767 0.2
NP_441046.1_2 Forward -391 -372 -1.86883 0.292
NP_441349.1_10 Reverse -32 -51 8.06259 0.0283
NP_441349.1_10 Forward -61 -42 0.491109 0.0886
NP_440432.1_9 Forward -50 -35 -1.79006 0.167
NP_439960.1_10 Forward -84 -66 -3.71743 0.279
NP_440726.1_2 Forward -203 -184 0.982764 0.285
NP_442450.1_5 Forward -237 -227 11.1898 0.115
NP_442450.1_5 Reverse -40 -50 7.55152 0.13
NP_442450.1_5 Forward -53 -43 7.55152 0.13
NP_440588.1_2 Reverse -33 -52 7.27595 0.0502
NP_442006.1_2 Forward -128 -111 -7.13932 0.169
NP_442243.1_1 Forward -224 -206 3.36165 0.204
NP_441570.1_1 Reverse -42 -60 -14.6322 0.226
NP_441078.1_4 Forward -51 -42 19.6659 0.0007
NP_441078.1_4 Reverse -42 -51 19.6659 0.0007
NP_441078.1_4 Forward -218 -209 -1.86856 0.272
NP_441663.1_8 Forward -88 -69 1.57275 0.212
NP_440707.1_9 Reverse -86 -105 2.94938 0.268
NP_442443.1_1 Forward -214 -195 3.53937 0.169
NP_441091.1_5 Forward -228 -209 1.76941 0.29
NP_440526.1_3 Reverse -134 -145 5.17139 0.253
NP_440526.1_3 Forward -50 -39 1.04151 0.267
NP_441432.1_8 Reverse -41 -50 16.8143 0.00595
NP_441432.1_8 Forward -52 -43 8.25953 0.0755
NP_442320.1_8 Reverse -36 -50 13.1759 0.0144
NP_441732.1_2 Forward -55 -39 -7.70961 0.0885
NP_440313.1_6 Forward -299 -280 16.3224 0.262
NP_442003.1_9 Reverse -195 -214 2.65439 0.293
NP_442003.1_9 Reverse -118 -137 2.65439 0.293
NP_440578.1_10 Reverse -187 -206 11.6025 0.246
NP_441072.1_2 Forward -62 -43 8.84924 0.231
NP_442489.1_7 Forward -51 -42 20.1576 0.000695
NP_442489.1_7 Reverse -42 -51 20.1576 0.000695
NP_442489.1_7 Forward -218 -209 -1.18024 0.18
NP_440559.1_1 Forward -50 -41 17.4043 0.00658
NP_440559.1_1 Reverse -43 -52 8.75118 0.0586
NP_441659.2_8 Forward -51 -41 18.1713 0.00133
NP_441659.2_8 Reverse -42 -52 11.9764 0.0147
NP_441659.2_8 Reverse -209 -219 6.37155 0.0774
NP_441022.1_1 Reverse -154 -163 10.587 0.294
NP_442913.1_10 Forward -227 -208 2.55606 0.124
NP_441040.1_2 Reverse -64 -83 -7.37537 0.212
NP_441040.1_2 Forward -226 -207 -14.8485 0.286
NP_439956.1_7 Reverse -180 -199 2.55606 0.273
NP_439956.1_7 Reverse -190 -209 2.0644 0.276
NP_442008.1_2 Reverse -298 -317 2.3594 0.289
NP_440708.1_4 Reverse -192 -211 8.16093 0.221
NP_441800.1_2 Forward -91 -72 10.6192 0.226
NP_442346.1_5 Reverse -41 -51 16.6963 0.00248
NP_442346.1_5 Forward -52 -42 9.02648 0.118
NP_440545.1_3 Reverse -205 -222 5.05372 0.0646
NP_440545.1_3 Reverse -38 -55 0.727158 0.133
NP_440545.1_3 Forward -222 -205 -1.82945 0.175
NP_441856.1_8 Forward -226 -207 15.5357 0.187
NP_441856.1_8 Forward -232 -213 12.8808 0.261
NP_440831.1_3 Forward -215 -196 5.12514 0.29
NP_440555.1_1 Reverse -31 -50 2.45773 0.294
NP_441653.1_2 Reverse -360 -379 6.04209 0.235
NP_440010.1_10 Reverse -198 -217 6.19431 0.226
NP_442311.1_8 Forward -84 -65 10.8159 0.278
NP_440847.1_3 Reverse -382 -396 13.372 0.217
NP_440449.1_6 Forward -226 -208 7.18594 0.229
NP_441948.1_4 Forward -58 -40 7.98396 0.0623
NP_441948.1_4 Reverse -199 -217 -3.71743 0.203
NP_440170.1_6 Reverse -245 -264 11.2092 0.294
NP_441833.1_4 Forward -50 -43 15.9687 0.0124
NP_441833.1_4 Reverse -43 -50 15.9687 0.0124
NP_442162.1_9 Forward -50 -43 16.2637 0.0124
NP_442162.1_9 Reverse -43 -50 16.2637 0.0124
NP_440671.1_4 Forward -57 -43 7.57108 0.214
NP_442140.1_3 Reverse -43 -53 16.2046 0.0255
NP_442140.1_3 Forward -50 -40 12.2714 0.0632
NP_440875.1_9 Reverse -44 -54 9.15072 0.233
NP_441813.1_5 Forward -53 -43 9.91146 0.021
NP_441813.1_5 Reverse -40 -50 8.63316 0.0367
NP_440590.1_4 Reverse -43 -56 3.75586 0.0686
NP_440590.1_4 Forward -50 -37 0.707601 0.144
NP_440567.1_1 Forward -50 -36 5.1128 0.107
NP_440567.1_1 Reverse -43 -57 1.86788 0.191
NP_442497.1_10 Forward -50 -41 10.4228 0.0087
NP_442497.1_10 Reverse -43 -52 10.4228 0.0087
NP_440821.1_4 Forward -53 -43 10.2065 0.0163
NP_440821.1_4 Reverse -40 -50 9.41981 0.0286
NP_441239.1_9 Forward -310 -298 12.7237 0.0433
NP_441239.1_9 Forward -53 -41 12.3303 0.0477
NP_441239.1_9 Forward -220 -208 7.70879 0.15
NP_441239.1_9 Reverse -40 -52 5.93884 0.202
NP_440400.1_1 Reverse -352 -371 -0.886293 0.285
NP_441892.1_1 Forward -60 -43 1.51381 0.152
NP_440665.1_2 Reverse -124 -143 -4.6221 0.246
NP_442669.1_1 Forward -375 -356 0.196116 0.291
NP_441508.1_4 Reverse -151 -165 14.8129 0.27
NP_441874.1_1 Reverse -32 -46 10.6193 0.26
NP_440546.1_4 Reverse -42 -52 11.8882 0.0679
NP_440546.1_4 Forward -51 -41 10.046 0.109
NP_440462.1_6 Forward -53 -43 9.02648 0.0498
NP_440462.1_6 Reverse -40 -50 1.35667 0.294
NP_442340.1_3 Forward -216 -197 -6.78538 0.225
NP_440868.1_4 Forward -55 -43 15.7719 0.0164
NP_440868.1_4 Reverse -38 -50 5.84051 0.0879
NP_441582.1_5 Forward -53 -34 7.76679 0.164
NP_442402.1_4 Forward -148 -129 -10.031 0.296
NP_442258.1_3 Forward -214 -195 13.7658 0.0356
NP_439942.1_7 Forward -383 -364 1.0811 0.21
NP_440696.1_3 Reverse -191 -209 8.96727 0.149
NP_442039.1_4 Forward -50 -43 15.1821 0.0124
NP_442039.1_4 Reverse -43 -50 15.1821 0.0124
NP_440825.1_7 Forward -50 -40 12.9096 0.152
NP_440825.1_7 Reverse -43 -53 12.4217 0.155
NP_442837.1_3 Forward -50 -43 15.7721 0.0124
NP_442837.1_3 Reverse -43 -50 15.7721 0.0124
NP_442837.1_4 Forward -229 -210 6.78429 0.279
NP_442053.1_1 Forward -51 -42 18.3876 0.0007
NP_442053.1_1 Reverse -42 -51 18.3876 0.0007
NP_440505.1_3 Reverse -40 -50 9.22315 0.122
NP_440505.1_3 Forward -53 -43 6.76487 0.169
NP_441959.1_9 Reverse -117 -136 15.1424 0.198
NP_441252.1_6 Reverse -130 -137 11.9372 0.25
NP_441203.1_1 Reverse -196 -215 -12.4886 0.143
NP_440914.1_1 Forward -51 -41 17.5935 0.000537
NP_440914.1_1 Reverse -42 -52 8.6151 0.186
NP_441011.1_8 Reverse -43 -52 16.9127 0.00602
NP_441011.1_8 Forward -50 -41 8.25953 0.144
NP_442101.1_10 Forward -273 -254 -7.27704 0.21
NP_442533.1_1 Reverse -115 -134 -16.9135 0.277
NP_442533.1_6 Forward -51 -42 17.2076 0.00137
NP_442533.1_6 Reverse -42 -51 17.2076 0.00137
NP_442533.1_6 Forward -218 -209 10.6195 0.0529
NP_442232.1_3 Forward -59 -40 -14.9469 0.288
NP_442229.1_1 Reverse -40 -54 16.8135 0.0795
NP_443016.1_1 Reverse -36 -55 -4.6221 0.235
NP_441482.1_7 Forward -57 -43 -8.75187 0.193
NP_441482.1_7 Forward -311 -297 -12.2918 0.292
NP_439944.1_9 Forward -50 -40 10.5014 0.0887
NP_442269.1_4 Reverse -172 -191 19.9606 0.0643
NP_442269.1_10 Reverse -184 -203 1.57275 0.29
NP_441028.1_6 Reverse -67 -77 3.71617 0.281
NP_440116.1_5 Forward -54 -37 3.67709 0.225
NP_439965.1_1 Forward -60 -41 -9.93197 0.3
NP_441961.1_4 Forward -316 -297 6.09597 0.27
NP_441602.1_3 Reverse -204 -223 -1.27885 0.226
NP_441106.1_1 Forward -52 -43 18.191 0.0028
NP_441106.1_1 Reverse -41 -50 9.63616 0.0311
NP_442928.1_3 Forward -135 -116 13.4829 0.246
NP_442306.1_10 Forward -56 -37 -20.7484 0.226
NP_442306.1_10 Forward -223 -204 -21.9284 0.296
NP_441286.1_1 Reverse -41 -53 6.03717 0.0258
NP_441286.1_1 Forward -52 -40 3.38223 0.0467
NP_440670.1_8 Forward -51 -42 18.3876 0.000699
NP_440670.1_8 Reverse -42 -51 18.3876 0.000699
NP_440886.1_7 Forward -52 -42 17.7774 0.0011
NP_440886.1_7 Reverse -41 -51 7.94438 0.0805
NP_440886.1_7 Reverse -298 -308 5.38779 0.185
NP_442614.1_2 Reverse -42 -56 7.57108 0.271
NP_439995.1_5 Reverse -32 -51 5.01433 0.282
NP_442072.1_9 Reverse -208 -226 -5.68405 0.067
NP_442072.1_9 Reverse -130 -148 -23.0886 0.277
NP_441753.1_10 Forward -227 -208 0.294447 0.296
NP_441808.1_7 Forward -226 -207 16.9124 0.115
NP_441808.1_8 Forward -230 -211 7.37428 0.278
NP_440907.2_8 Reverse -43 -53 14.2375 0.0312
NP_440907.2_8 Forward -50 -40 7.64939 0.117
NP_441021.1_1 Forward -217 -198 -11.3086 0.259
NP_440841.1_4 Forward -53 -34 -7.08038 0.22
NP_441463.1_3 Reverse -32 -51 -8.45701 0.27
NP_441626.1_2 Forward -50 -43 15.7721 0.0124
NP_441626.1_2 Reverse -43 -50 15.7721 0.0124
NP_442794.1_1 Reverse -38 -50 9.38042 0.0795
NP_442794.1_1 Forward -55 -43 2.69391 0.286
NP_442615.1_1 Reverse -33 -51 11.5239 0.0177
NP_442615.1_1 Forward -60 -42 8.37728 0.0284
NP_441962.1_4 Forward -313 -294 -13.0786 0.268
NP_441742.1_4 Reverse -223 -242 12.6841 0.293
NP_440387.1_1 Forward -51 -35 7.33503 0.0282
NP_440387.1_1 Reverse -42 -58 4.3851 0.0426
NP_441431.1_2 Forward -54 -40 17.0102 0.0303
NP_441993.1_1 Reverse -191 -210 3.89583 0.227
NP_441993.1_1 Reverse -36 -55 0.484826 0.298
NP_440114.1_10 Forward -51 -37 5.80112 0.292
NP_440293.1_3 Reverse -124 -143 -3.04881 0.243
NP_439988.1_3 Reverse -121 -135 16.7159 0.158
NP_439988.1_3 Reverse -216 -230 7.66941 0.273
NP_441237.1_9 Forward -50 -40 14.828 0.0242
NP_441133.1_1 Reverse -220 -239 12.2908 0.269
NP_442867.1_4 Forward -214 -195 10.3242 0.267
NP_442867.1_8 Reverse -214 -233 9.63589 0.22
NP_440457.1_1 Forward -55 -43 2.10393 0.217
NP_440798.1_6 Reverse -43 -56 12.114 0.0516
NP_440801.1_8 Forward -52 -33 4.52268 0.198
NP_441332.1_6 Forward -127 -117 11.8404 0.244
NP_441436.1_8 Reverse -208 -227 12.2908 0.243
NP_442509.1_9 Reverse -42 -52 16.2041 0.00739
NP_442509.1_9 Forward -51 -41 8.14104 0.192
NP_441765.1_4 Forward -398 -379 10.6192 0.248
NP_442514.1_5 Forward -90 -71 -7.08111 0.275
NP_442514.1_5 Forward -218 -199 -9.73604 0.298
NP_440734.1_9 Forward -136 -117 13.2741 0.226
NP_440756.1_1 Forward -339 -320 15.5003 0.294
NP_440554.1_4 Reverse -43 -53 7.35486 0.103
NP_441885.1_5 Forward -51 -41 20.9245 0.000538
NP_441885.1_5 Reverse -42 -52 11.4848 0.00668
NP_440478.1_10 Forward -53 -39 8.75105 0.257
NP_442341.1_7 Reverse -41 -55 8.06273 0.0947
NP_442341.1_7 Forward -52 -38 7.66941 0.0994
NP_442341.1_9 Forward -53 -39 8.65209 0.166
NP_442395.2_4 Forward -127 -108 -0.00131823 0.28
NP_443000.1_7 Reverse -40 -50 10.3048 0.0345
NP_443000.1_7 Forward -53 -43 1.94665 0.226
NP_440507.2_3 Reverse -33 -52 7.76679 0.27
NP_441842.1_10 Reverse -35 -49 6.88276 0.271
NP_440275.1_3 Forward -53 -43 8.33817 0.0602
NP_440275.1_3 Reverse -40 -50 8.04317 0.0602
NP_440275.1_3 Reverse -207 -217 6.17489 0.122
NP_440091.1_1 Forward -55 -43 3.2839 0.163
NP_440091.1_1 Reverse -38 -50 -0.452677 0.273
NP_439962.1_4 Forward -236 -217 -5.01543 0.272
NP_440175.1_7 Reverse -191 -209 15.609 0.119
NP_440175.1_7 Reverse -68 -86 9.07034 0.282
NP_440149.1_8 Reverse -250 -269 -7.96535 0.296
NP_440216.1_1 Reverse -42 -56 7.07942 0.01
NP_440216.1_1 Forward -51 -37 -2.75368 0.0574
NP_440172.1_1 Forward -51 -41 15.0247 0.00945
NP_440172.1_1 Reverse -42 -52 8.73149 0.0586
NP_442015.1_10 Forward -55 -42 10.4424 0.0391
NP_442015.1_10 Reverse -38 -51 1.49425 0.204
NP_441226.1_7 Forward -50 -43 14.4934 0.0123
NP_441226.1_7 Reverse -43 -50 14.4934 0.0123
NP_441111.1_7 Forward -50 -42 18.7023 0.00294
NP_441111.1_7 Reverse -43 -51 18.7023 0.00294
NP_441766.1_2 Forward -51 -42 17.5026 0.00297
NP_441766.1_2 Reverse -42 -51 17.5026 0.00297
NP_440416.1_1 Forward -51 -32 -12.3902 0.272
NP_440416.1_9 Forward -58 -39 -14.9469 0.182
NP_443052.1_8 Reverse -32 -51 -12.3902 0.254
NP_443052.1_9 Reverse -301 -320 -0.983855 0.219
NP_443052.1_9 Forward -229 -210 -3.63879 0.251
NP_443052.1_9 Reverse -199 -218 -3.63879 0.251
NP_443052.1_9 Reverse -211 -230 -5.40875 0.27
NP_443052.1_9 Reverse -214 -233 -5.60541 0.271
NP_440072.1_5 Reverse -118 -136 0.412472 0.236
NP_442226.1_1 Forward -180 -161 10.4225 0.281
NP_441579.1_10 Forward -310 -296 19.8624 0.168
NP_440261.1_5 Reverse -43 -56 -2.93064 0.0983
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AGTCCCACCGAGGAATTGGAAGCAGTTACTAGGGGTTTGGAAAGTGTGGAACCAGTTGCAAACTTATCCCCTAATAAAAATCTTGAGGGAGCCGAGCTGGCCGCTACTGATAACTGCCCGGAATATACGACCCTACCCGATGGTACTCGCTTGAAGGTGTTTAAGCGTCAGCCCGAACCGGAGCCGGTGGCCCCAGAGCAAGCCCAAGCATTCCGGCAAATGATGCAGGGTTTATTCAAGGGTTTTGGTAGTAAGCGGGAGGTTTGCCCCAAGCCCCAGTCCGAACTGGAACGTCTCAATCAATGGCTCTATGACCCGGCCCTACGGGAGGAAGCAATTAACTATGCTCGGCGATCGCCAAATTACAAATACTGCTCCGAAACTGACCAAATTATCCACT

CDS

GTGAGGAGTTCTAGCCATGGAAAGCTTAAACACCTCGACCTATTTGCCGGATGTGGGGGATTCACCCTGGCCGCAGAACAAACCGGAGGAAAAATACAAACAACTCAGTTTGTTGAAATCGACCCCGACTGTCACGCCATCCTCCAGCATCACTGGCCCCAGGGTGAAAATAAAACTTCGATGGCCCTTACCGGAAGTACGCCCCCGGCGATCTCGAGGCCAGGGTAG

Protein

No sequence available