Your browser is old and dusty. Try Google Chrome!

Details for ssl5091

ORF ssl5091
Accession NP_942247.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -324 -338 12.1926 0.222
NP_440795.1_7 Reverse -258 -265 5.74231 0.279
NP_441418.1_1 Forward -88 -69 17.1404 0.0628
NP_442291.1_5 Forward -267 -251 -2.30141 0.215
NP_441453.1_4 Forward -266 -258 6.90259 0.121
NP_441453.1_4 Reverse -257 -265 6.70593 0.121
NP_442151.1_6 Reverse -361 -375 7.17775 0.206
NP_442838.1_5 Forward -51 -32 12.3892 0.274
NP_440226.1_1 Reverse -257 -276 8.65258 0.0836
NP_442287.1_5 Reverse -147 -157 10.3048 0.291
NP_442173.1_1 Forward -265 -257 11.7208 0.034
NP_442173.1_1 Reverse -258 -266 7.49257 0.171
NP_443027.1_4 Reverse -255 -265 11.0914 0.107
NP_443027.1_4 Forward -231 -221 9.32148 0.166
NP_440784.1_7 Forward -265 -258 6.43063 0.218
NP_440784.1_7 Reverse -258 -265 6.23397 0.241
NP_440061.1_9 Reverse -255 -269 9.14375 0.151
NP_440110.1_4 Reverse -246 -265 3.83436 0.213
NP_441054.1_4 Forward -276 -258 -0.669169 0.187
NP_442062.1_3 Forward -88 -69 5.50599 0.182
NP_442062.1_8 Reverse -257 -267 7.25653 0.104
NP_442062.1_8 Forward -266 -256 5.28991 0.176
NP_441859.1_3 Reverse -339 -358 2.26028 0.263
NP_441859.1_3 Reverse -327 -346 1.76863 0.275
NP_441043.1_10 Forward -370 -356 13.5693 0.263
NP_442242.1_4 Forward -265 -258 13.3138 0.027
NP_440044.1_8 Forward -265 -246 -2.16383 0.261
NP_440365.1_4 Reverse -337 -356 9.24257 0.221
NP_441594.1_6 Reverse -334 -353 7.37428 0.173
NP_441925.1_2 Reverse -204 -223 2.75272 0.262
NP_441925.1_5 Reverse -234 -248 19.8624 0.0337
NP_441083.1_5 Forward -266 -256 8.23984 0.0429
NP_441083.1_5 Reverse -257 -267 1.16001 0.215
NP_441434.1_1 Forward -84 -70 9.27434 0.24
NP_441738.1_2 Forward -264 -257 13.3134 0.0335
NP_441738.1_2 Reverse -222 -229 6.03696 0.295
NP_440209.1_1 Reverse -257 -265 8.27922 0.0687
NP_441713.1_2 Forward -103 -84 14.2574 0.298
NP_441716.1_1 Forward -299 -285 5.40779 0.231
NP_441327.1_1 Forward -32 -13 3.25228 0.277
NP_440906.1_5 Forward -265 -258 6.52896 0.199
NP_440906.1_5 Reverse -258 -265 6.0373 0.262
NP_440747.1_10 Reverse -254 -266 6.92215 0.012
NP_440747.1_10 Forward -269 -257 -11.9574 0.178
NP_441486.1_1 Forward -269 -255 -5.11362 0.222
NP_442145.1_4 Forward -90 -71 6.54077 0.216
NP_442634.1_4 Reverse -255 -269 -4.52363 0.206
NP_440470.1_5 Reverse -73 -92 6.34979 0.279
NP_441695.1_8 Reverse -290 -304 10.9143 0.269
NP_443018.1_3 Forward -265 -258 5.15232 0.226
NP_443018.1_3 Reverse -258 -265 5.05399 0.238
NP_441634.1_8 Reverse -255 -269 -2.16369 0.295
NP_440376.1_1 Forward -266 -257 0.196389 0.283
NP_440376.1_1 Reverse -257 -266 -0.196935 0.285
NP_441077.1_6 Forward -84 -68 11.0929 0.152
NP_441077.1_6 Forward -28 -12 4.44078 0.255
NP_442485.1_3 Forward -310 -291 -4.81876 0.285
NP_441029.1_10 Forward -130 -111 16.7157 0.188
NP_440720.1_6 Forward -79 -61 15.5554 0.281
NP_442937.1_5 Reverse -252 -271 7.27595 0.258
NP_441958.1_5 Reverse -256 -266 1.16001 0.114
NP_442836.1_10 Forward -316 -306 9.32148 0.277
NP_442876.1_6 Forward -331 -313 13.4663 0.23
NP_442876.1_7 Reverse -178 -196 13.7855 0.292
NP_442690.1_1 Reverse -72 -91 -14.7502 0.273
NP_442690.1_1 Forward -222 -203 -15.8318 0.28
NP_442690.1_1 Reverse -229 -248 -16.0285 0.283
NP_442690.1_1 Forward -77 -58 -16.5201 0.289
NP_442690.1_1 Forward -190 -171 -16.8151 0.291
NP_442911.1_2 Forward -276 -257 5.30933 0.0341
NP_443055.1_6 Forward -307 -289 6.99988 0.164
NP_441099.1_5 Reverse -351 -370 -11.7019 0.288
NP_441099.1_10 Reverse -8 -18 19.1541 0.0842
NP_441646.1_1 Forward -306 -287 -0.197208 0.259
NP_442438.1_10 Forward -271 -257 1.17956 0.204
NP_440377.1_1 Forward -76 -59 11.0804 0.291
NP_440147.1_4 Reverse -255 -268 12.999 0.0326
NP_441550.1_8 Reverse -255 -265 5.28945 0.255
NP_441916.1_7 Forward -266 -256 1.25834 0.289
NP_440345.1_5 Forward -97 -83 14.143 0.276
NP_439966.1_7 Reverse -255 -265 5.68278 0.214
NP_442941.1_3 Forward -265 -255 9.81313 0.0263
NP_442941.1_3 Reverse -258 -268 -1.10161 0.284
NP_441554.1_4 Forward -330 -316 18.3461 0.22
NP_441514.1_4 Forward -320 -301 13.3767 0.269
NP_442281.1_1 Reverse -252 -266 12.2903 0.0385
NP_441079.1_7 Reverse -219 -238 5.99684 0.136
NP_441079.1_7 Forward -31 -12 -7.96609 0.298
NP_441860.1_1 Forward -102 -88 14.2889 0.281
NP_441644.1_6 Forward -266 -256 5.28945 0.199
NP_442215.1_2 Forward -205 -189 -1.51476 0.186
NP_442247.1_8 Reverse -255 -269 10.0294 0.247
NP_442933.1_6 Forward -90 -71 13.4162 0.287
NP_442933.1_10 Forward -266 -257 7.96454 0.0937
NP_442933.1_10 Reverse -257 -266 7.76787 0.11
NP_440382.1_2 Forward -84 -65 0.785326 0.299
NP_441751.2_8 Forward -265 -251 -3.24533 0.137
NP_442554.1_8 Forward -265 -255 13.5497 0.018
NP_442142.1_4 Forward -346 -333 2.28034 0.295
NP_442142.1_4 Reverse -254 -267 2.18201 0.299
NP_442292.1_1 Forward -265 -256 16.421 0.00748
NP_442292.1_1 Reverse -258 -267 -0.295266 0.24
NP_441726.1_4 Forward -379 -365 17.9942 0.216
NP_441371.1_3 Reverse -335 -353 4.14905 0.296
NP_441715.1_4 Forward -265 -255 16.1063 0.0144
NP_441758.1_10 Reverse -36 -55 0.883656 0.197
NP_441468.1_1 Forward -265 -258 13.0188 0.0383
NP_441468.1_1 Reverse -258 -265 6.0373 0.223
NP_441673.1_1 Forward -266 -257 1.37636 0.114
NP_441673.1_1 Reverse -257 -266 1.1797 0.163
NP_442253.1_5 Reverse -287 -304 3.28376 0.152
NP_442868.1_6 Reverse -255 -265 9.61647 0.0429
NP_442719.1_2 Reverse -314 -332 -6.17641 0.224
NP_441251.1_7 Reverse -61 -74 12.704 0.266
NP_442050.1_5 Forward -268 -258 12.1726 0.0699
NP_442903.1_2 Forward -91 -72 6.15881 0.18
NP_441114.1_3 Forward -298 -289 7.86621 0.231
NP_440558.1_2 Reverse -287 -306 0.196116 0.194
NP_441878.1_6 Forward -300 -290 1.455 0.0979
NP_441878.1_6 Reverse -290 -300 -7.19813 0.21
NP_441036.1_8 Forward -267 -257 6.56821 0.225
NP_441557.1_5 Reverse -257 -266 8.84951 0.0343
NP_441557.1_5 Forward -266 -257 0.786375 0.106
NP_441590.1_4 Reverse -292 -311 5.50519 0.277
NP_441458.1_8 Forward -30 -11 5.55986 0.259
NP_442183.1_1 Reverse -383 -397 5.01447 0.234
NP_442183.1_1 Reverse -220 -234 5.01447 0.234
NP_442347.1_2 Reverse -221 -230 6.19458 0.182
NP_442347.1_2 Forward -265 -256 5.50626 0.229
NP_441633.1_3 Reverse -255 -268 -6.17557 0.238
NP_440136.1_2 Forward -265 -258 6.52896 0.116
NP_440136.1_2 Reverse -258 -265 6.13563 0.193
NP_442590.1_10 Reverse -321 -340 4.32602 0.276
NP_441728.2_4 Forward -91 -72 23.3474 0.00228
NP_442998.1_10 Forward -264 -257 12.3305 0.0564
NP_440299.1_1 Reverse -253 -266 7.88518 0.103
NP_441799.1_1 Forward -270 -256 13.077 0.0362
NP_442158.1_2 Reverse -12 -31 15.326 0.247
NP_441866.1_4 Reverse -90 -103 12.175 0.293
NP_440215.1_6 Reverse -247 -266 15.6332 0.228
NP_440695.1_6 Forward -21 -7 9.73265 0.276
NP_442386.1_9 Reverse -289 -298 6.68581 0.219
NP_442386.1_9 Forward -267 -258 5.50585 0.25
NP_441750.1_7 Reverse -141 -151 13.943 0.254
NP_441340.1_5 Forward -265 -258 5.93897 0.198
NP_441340.1_5 Reverse -258 -265 5.84064 0.208
NP_441340.1_9 Forward -242 -232 15.1001 0.194
NP_440327.1_6 Forward -53 -34 4.81767 0.266
NP_440161.1_3 Forward -268 -249 8.25926 0.273
NP_442714.1_7 Forward -299 -280 0.786102 0.226
NP_441027.1_1 Forward -79 -65 13.4703 0.27
NP_442251.1_6 Forward -265 -258 13.0188 0.0408
NP_443051.1_1 Reverse -256 -265 0.589713 0.143
NP_439937.1_9 Reverse -295 -312 -10.0899 0.221
NP_439937.1_9 Forward -301 -284 -10.1882 0.224
NP_440398.1_2 Reverse -328 -347 3.83436 0.231
NP_440372.1_2 Forward -265 -258 6.62729 0.151
NP_440372.1_2 Reverse -258 -265 6.52896 0.188
NP_442663.1_2 Forward -370 -352 10.4422 0.178
NP_442384.1_10 Forward -266 -253 2.37923 0.228
NP_442384.1_10 Forward -349 -336 0.904263 0.275
NP_442114.1_2 Forward -83 -64 0.392778 0.262
NP_441877.1_5 Forward -269 -250 -1.18052 0.283
NP_441877.1_9 Reverse -69 -86 4.26707 0.284
NP_442262.1_10 Forward -265 -258 10.6589 0.14
NP_442262.1_10 Forward -361 -354 7.6106 0.274
NP_441689.1_5 Forward -268 -258 5.58445 0.23
NP_442917.1_1 Forward -91 -72 7.86512 0.254
NP_440297.1_9 Reverse -291 -301 6.17489 0.2
NP_442378.1_1 Reverse -175 -192 16.5584 0.22
NP_440999.1_9 Forward -270 -256 1.37622 0.166
NP_440888.1_2 Reverse -257 -271 8.84875 0.145
NP_440888.1_2 Forward -266 -252 6.68548 0.223
NP_441771.1_8 Forward -88 -69 10.5514 0.11
NP_440179.1_6 Reverse -258 -277 3.53937 0.266
NP_441543.1_2 Forward -265 -256 7.17789 0.131
NP_441543.1_2 Reverse -258 -267 4.22796 0.267
NP_441834.1_3 Reverse -88 -107 20.1573 0.0667
NP_442578.1_7 Reverse -258 -265 5.15232 0.291
NP_440148.1_1 Reverse -170 -189 -6.78538 0.268
NP_441462.1_2 Reverse -257 -267 0.766681 0.125
NP_441410.1_4 Forward -51 -32 7.07848 0.297
NP_440504.1_7 Forward -305 -286 -3.14714 0.244
NP_442780.1_1 Forward -85 -66 11.5042 0.169
NP_442780.1_1 Forward -86 -67 6.88262 0.291
NP_442872.1_1 Forward -152 -133 -2.95047 0.205
NP_440516.1_8 Reverse -257 -266 -0.393597 0.255
NP_442080.1_7 Reverse -121 -140 18.4857 0.0136
NP_440128.1_4 Reverse -216 -235 15.1424 0.125
NP_442428.1_5 Forward -265 -258 6.3323 0.193
NP_442428.1_5 Reverse -258 -265 6.13563 0.209
NP_441443.1_7 Reverse -325 -344 -2.55715 0.27
NP_441052.1_2 Reverse -361 -371 11.8781 0.0285
NP_441052.1_2 Forward -299 -289 2.33998 0.209
NP_441052.1_2 Forward -266 -256 2.04498 0.22
NP_441052.1_2 Reverse -257 -267 0.766681 0.256
NP_442219.1_9 Reverse -258 -267 8.84951 0.0681
NP_442219.1_9 Forward -265 -256 8.25953 0.0681
NP_440436.1_4 Forward -265 -256 7.47246 0.129
NP_440436.1_4 Reverse -258 -267 6.29249 0.164
NP_441884.1_9 Reverse -254 -273 -21.24 0.235
NP_442577.1_9 Reverse -302 -316 15.6336 0.209
NP_441719.1_4 Forward -265 -258 6.62729 0.151
NP_441719.1_4 Reverse -258 -265 6.52896 0.188
NP_439949.1_7 Reverse -90 -104 12.1926 0.269
NP_440296.1_6 Reverse -13 -31 9.83765 0.298
NP_443054.1_2 Reverse -289 -303 0.294584 0.269
NP_442586.1_5 Reverse -154 -173 19.764 0.104
NP_441851.1_10 Reverse -256 -266 7.55152 0.137
NP_442515.1_1 Reverse -256 -270 1.96621 0.145
NP_442689.1_8 Forward -218 -201 0.432165 0.191
NP_441349.1_10 Forward -213 -194 -1.08219 0.0988
NP_441661.1_1 Forward -317 -298 10.9142 0.147
NP_441409.1_6 Forward -272 -253 -7.76869 0.156
NP_440432.1_9 Forward -265 -250 -3.56002 0.183
NP_441124.1_5 Reverse -64 -74 15.2045 0.198
NP_441124.1_5 Forward -214 -204 11.4803 0.254
NP_441031.1_1 Reverse -67 -86 6.72632 0.259
NP_441031.1_1 Forward -92 -73 4.50898 0.288
NP_441031.1_1 Forward -30 -11 3.83414 0.293
NP_441078.1_4 Reverse -257 -266 0.196389 0.205
NP_441078.1_4 Forward -266 -257 0.196389 0.205
NP_441432.1_8 Reverse -256 -265 7.17789 0.102
NP_442320.1_8 Reverse -251 -265 -5.21195 0.209
NP_441732.1_2 Reverse -253 -269 -16.4611 0.167
NP_442447.1_1 Reverse -58 -77 6.4893 0.258
NP_442797.1_9 Forward -266 -248 14.8671 0.114
NP_442400.1_10 Reverse -47 -60 9.13351 0.271
NP_442489.1_7 Forward -266 -257 0.688044 0.152
NP_442489.1_7 Reverse -257 -266 0.491382 0.178
NP_440559.1_1 Reverse -258 -267 7.66954 0.0999
NP_440559.1_1 Forward -265 -256 7.66954 0.0999
NP_441659.2_8 Forward -266 -256 6.17489 0.084
NP_440363.1_9 Reverse -282 -300 13.0972 0.254
NP_440708.1_5 Reverse -255 -274 3.14605 0.292
NP_440335.1_9 Forward -251 -233 16.4404 0.184
NP_442346.1_5 Reverse -256 -266 6.56821 0.198
NP_442346.1_5 Forward -267 -257 4.89658 0.269
NP_440352.1_5 Reverse -55 -74 10.2223 0.278
NP_440250.1_4 Reverse -73 -92 4.52188 0.253
NP_441943.1_2 Forward -84 -65 10.9142 0.27
NP_442551.1_4 Reverse -288 -303 -1.39674 0.245
NP_442603.1_7 Reverse -257 -271 14.6503 0.0613
NP_441888.1_7 Reverse -252 -266 2.65453 0.225
NP_441833.1_4 Forward -265 -258 12.9205 0.0393
NP_441833.1_4 Reverse -258 -265 6.13563 0.198
NP_441329.1_1 Reverse -68 -87 8.16414 0.229
NP_441329.1_6 Reverse -44 -63 4.24897 0.206
NP_441895.1_2 Forward -246 -227 -18.0934 0.234
NP_442162.1_9 Forward -265 -258 6.52896 0.178
NP_442162.1_9 Reverse -258 -265 6.43063 0.208
NP_442404.1_9 Forward -346 -332 8.16044 0.296
NP_440224.1_1 Reverse -246 -265 2.3594 0.132
NP_440204.1_9 Reverse -241 -260 19.0757 0.12
NP_442140.1_3 Reverse -258 -268 3.42162 0.297
NP_441813.1_5 Reverse -255 -265 8.33817 0.047
NP_440594.1_8 Reverse -258 -271 11.5234 0.152
NP_440590.1_4 Reverse -258 -271 -6.07724 0.299
NP_440567.1_1 Reverse -258 -272 -0.0987402 0.264
NP_442497.1_10 Forward -265 -256 0.688044 0.141
NP_440821.1_4 Forward -268 -258 -0.314959 0.251
NP_440821.1_4 Reverse -255 -265 -0.41329 0.257
NP_441541.1_1 Reverse -70 -88 4.29912 0.171
NP_440546.1_4 Reverse -257 -267 8.10685 0.203
NP_440675.1_3 Forward -370 -351 13.3725 0.161
NP_442465.1_5 Forward -73 -54 18.6683 0.0928
NP_440868.1_4 Reverse -253 -265 4.95553 0.108
NP_440868.1_4 Forward -270 -258 1.31728 0.186
NP_441848.1_4 Reverse -59 -75 10.7974 0.241
NP_442039.1_4 Forward -265 -258 11.3472 0.086
NP_441811.1_8 Forward -272 -258 6.19444 0.283
NP_442696.1_2 Reverse -256 -274 8.37728 0.295
NP_442696.1_3 Reverse -283 -302 -0.688862 0.214
NP_442837.1_3 Forward -265 -258 6.52896 0.2
NP_442837.1_3 Reverse -258 -265 6.0373 0.25
NP_442053.1_1 Reverse -257 -266 5.60459 0.176
NP_440505.1_3 Reverse -255 -265 8.63316 0.138
NP_442532.1_1 Forward -84 -70 10.9882 0.23
NP_440914.1_1 Forward -266 -256 6.66328 0.269
NP_440914.1_1 Reverse -257 -267 6.07773 0.297
NP_442533.1_6 Forward -299 -290 6.48957 0.109
NP_442533.1_6 Reverse -257 -266 6.19458 0.115
NP_442533.1_6 Reverse -291 -300 4.32629 0.184
NP_442229.1_1 Reverse -264 -278 6.48882 0.219
NP_443016.1_5 Reverse -298 -317 3.83357 0.292
NP_439944.1_9 Reverse -258 -268 13.648 0.0526
NP_441697.1_5 Reverse -220 -239 -4.05883 0.22
NP_440115.1_6 Forward -269 -259 6.96153 0.166
NP_440115.1_6 Reverse -254 -264 6.76487 0.167
NP_441106.1_3 Reverse -172 -191 18.3873 0.0583
NP_001035870.1_3 Forward -53 -34 -5.01543 0.278
NP_441286.1_1 Reverse -256 -268 2.59558 0.0573
NP_441286.1_1 Forward -267 -255 -5.95921 0.235
NP_440670.1_8 Reverse -257 -266 5.70292 0.14
NP_442614.1_2 Reverse -257 -271 5.70279 0.298
NP_442401.1_2 Forward -151 -132 12.7816 0.159
NP_442213.1_5 Reverse -140 -159 0.0977854 0.273
NP_440326.1_7 Forward -19 -5 18.9775 0.0312
NP_441463.1_3 Reverse -351 -370 0.491109 0.131
NP_441463.1_3 Reverse -103 -122 -9.34199 0.278
NP_442893.1_4 Reverse -65 -84 -1.77127 0.273
NP_441626.1_2 Forward -265 -258 6.0373 0.212
NP_441626.1_2 Reverse -258 -265 5.93897 0.231
NP_441401.1_5 Forward -131 -112 9.69201 0.297
NP_441836.1_2 Forward -272 -253 6.09597 0.116
NP_441193.1_1 Reverse -293 -312 9.14342 0.277
NP_440634.1_4 Forward -136 -117 7.57094 0.257
NP_440634.1_10 Reverse -337 -356 12.7816 0.164
NP_440634.1_10 Forward -355 -336 5.70185 0.269
NP_441425.1_4 Reverse -63 -77 13.7659 0.282
NP_440293.1_3 Forward -307 -288 -5.80207 0.282
NP_439988.1_10 Reverse -11 -30 9.40425 0.226
NP_440458.1_7 Reverse -33 -52 3.24359 0.218
NP_443037.1_7 Reverse -81 -100 -4.03212 0.276
NP_440524.1_2 Forward -341 -322 1.37609 0.261
NP_442936.1_7 Reverse -64 -83 2.94938 0.255
NP_440554.1_4 Forward -265 -255 5.68323 0.135
NP_441885.1_5 Reverse -257 -267 10.1081 0.0145
NP_441885.1_5 Forward -266 -256 1.455 0.11
NP_442703.1_9 Forward -334 -316 5.03403 0.244
NP_442341.1_7 Reverse -256 -270 4.52282 0.188
NP_443000.1_7 Reverse -255 -265 10.3048 0.0345
NP_443000.1_7 Forward -12 -2 2.53664 0.226
NP_440552.1_8 Reverse -366 -383 9.60133 0.293
NP_441842.1_1 Reverse -259 -272 14.08 0.119
NP_440275.1_3 Reverse -255 -265 5.28991 0.158
NP_440091.1_1 Forward -270 -258 0.825626 0.227
NP_442275.1_3 Reverse -165 -184 11.5042 0.274
NP_441389.1_5 Reverse -244 -263 11.1109 0.251
NP_441105.1_3 Forward -208 -189 -9.93197 0.298
NP_442127.1_9 Forward -30 -11 11.1244 0.292
NP_440216.1_1 Forward -266 -252 -12.1934 0.247
NP_440172.1_1 Reverse -257 -267 15.418 0.00945
NP_441111.1_7 Forward -265 -257 8.96754 0.0463
NP_441766.1_2 Reverse -257 -266 14.0611 0.0111
NP_442403.1_9 Reverse -337 -356 2.85105 0.285
NP_442226.1_8 Forward -314 -304 14.9263 0.254
NP_440261.1_5 Reverse -258 -271 -5.29059 0.19
NP_440261.1_5 Forward -265 -252 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGGCTAATTGAATAGCTTGGTTAATCATTGTTGATCACGAGATTGATGGTAATAATCACCGGCACCATTGAACAGCAGTAAAAAGTATTTGGGCAGATAGGGCCTTGCCCACCTAACTTTAATCAGACTTGGTAGAGATCGCCAGGTTAGAAACCCCTAGTAAAAATTATTGGGATCTATTACCTTGTCTAAAATTTGCTACTGACATTGGTAAATATCGTTACATTTTAGACCCTACTTAACAGCATCTCCAACAATCAACTCAGCAGTTAACCAGGGTTGTCAGAGTATTAATGGATAAATCAGCAAAGCTTTAAAGAAAGTTAAATTTTCCAATATTTGTGGTCATTTTTATTTAGCTATTGGACAATATAAATTACTAATTTTAAGGAGTTCACT

CDS

ATGGACTTTAACCCCAATGAGTGGCCTACTCACAAACAAGGTGAGGTTGTCCGCCAACTAATACTAGATGCGCTGGACAGTCCAAAGACCAAGGAAGAATTGTCCAGTTTGTGCAACAAGAGCGTTAGACAAATCACTAGACATTTACAGCGTTTGTCCAGCGAAAACAAGATTTTGTCCACTGGCAAAGGGCAATTTGTCCGACGGATCGCCGCTGGATTTTTACTCCTTTACGTTGGACAAATTTAA

Protein

No sequence available