Your browser is old and dusty. Try Google Chrome!

Details for ssl5068

ORF ssl5068
Accession NP_942224.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -56 -42 14.5526 0.0392
NP_440897.1_9 Reverse -173 -191 12.8014 0.222
NP_442877.1_6 Forward -239 -220 15.6341 0.226
NP_442151.1_1 Forward -135 -116 8.25926 0.27
NP_441818.1_1 Reverse -272 -283 9.00628 0.267
NP_442169.1_1 Reverse -136 -155 -1.37718 0.265
NP_442752.1_4 Reverse -42 -49 7.90559 0.144
NP_442289.1_4 Reverse -361 -377 13.6282 0.203
NP_440928.1_5 Forward -56 -38 6.60732 0.267
NP_440878.1_9 Reverse -220 -239 3.24438 0.174
NP_441900.1_2 Reverse -162 -180 -3.02983 0.279
NP_441208.1_9 Forward -166 -152 6.88276 0.229
NP_442276.1_2 Reverse -218 -237 9.14423 0.285
NP_442110.1_7 Reverse -230 -244 5.50613 0.169
NP_442110.1_7 Reverse -271 -285 -0.295402 0.281
NP_441083.1_5 Forward -51 -41 -0.314959 0.265
NP_441083.1_5 Forward -239 -229 -1.10161 0.295
NP_442827.1_8 Reverse -222 -241 -1.77127 0.256
NP_441434.1_3 Reverse -151 -170 -2.16383 0.262
NP_441558.1_5 Reverse -46 -65 10.0292 0.107
NP_440178.1_7 Reverse -229 -248 -12.6852 0.123
NP_442570.1_3 Reverse -214 -233 -1.67217 0.212
NP_441598.1_3 Forward -232 -213 14.7157 0.161
NP_440747.1_10 Forward -54 -42 -4.68091 0.115
NP_441486.1_1 Forward -54 -40 -6.19526 0.283
NP_442634.1_2 Reverse -221 -240 2.55606 0.285
NP_440842.1_10 Reverse -145 -159 3.63784 0.255
NP_440842.1_10 Forward -234 -220 3.34284 0.257
NP_440842.1_10 Forward -158 -144 3.24451 0.264
NP_440842.1_10 Reverse -144 -158 1.37622 0.294
NP_440057.1_1 Forward -232 -213 8.35759 0.276
NP_441014.1_8 Forward -385 -366 -8.65367 0.288
NP_442848.1_6 Forward -224 -205 16.5191 0.236
NP_441012.1_4 Forward -229 -216 8.86907 0.272
NP_443018.1_3 Reverse -115 -122 8.49558 0.141
NP_440376.1_1 Forward -258 -249 3.7363 0.195
NP_440376.1_1 Reverse -230 -239 3.63797 0.2
NP_440376.1_1 Forward -163 -154 1.86802 0.238
NP_442687.1_7 Reverse -229 -239 12.4681 0.0721
NP_442687.1_7 Reverse -153 -163 4.69992 0.238
NP_441797.1_7 Reverse -219 -237 9.95058 0.292
NP_441013.1_2 Forward -232 -214 1.00246 0.254
NP_442198.1_3 Reverse -218 -237 8.94757 0.249
NP_442205.1_9 Forward -95 -79 -3.77637 0.295
NP_440184.1_1 Reverse -331 -350 4.1203 0.228
NP_440720.1_1 Reverse -219 -238 6.98095 0.195
NP_441487.1_9 Forward -172 -153 -0.39387 0.255
NP_442937.1_5 Reverse -37 -56 10.6192 0.157
NP_442937.1_5 Reverse -8 -27 10.5209 0.158
NP_441958.1_5 Reverse -229 -239 -1.10161 0.23
NP_439905.1_2 Forward -56 -42 10.816 0.208
NP_440984.1_7 Reverse -226 -240 5.80112 0.24
NP_440153.1_5 Reverse -231 -245 3.34284 0.215
NP_440153.1_8 Reverse -230 -243 -2.53732 0.244
NP_442064.1_4 Reverse -212 -231 9.53674 0.204
NP_443055.1_6 Reverse -34 -52 3.65664 0.195
NP_443055.1_6 Reverse -48 -66 0.116744 0.249
NP_440993.1_2 Forward -244 -228 3.79511 0.256
NP_442002.1_9 Reverse -153 -160 12.2322 0.185
NP_441712.1_1 Forward -344 -325 10.4872 0.267
NP_441712.1_3 Forward -227 -214 12.704 0.288
NP_441294.1_7 Forward -61 -47 9.73057 0.229
NP_441424.1_7 Forward -233 -214 14.2574 0.158
NP_441646.1_1 Reverse -223 -242 4.52268 0.191
NP_442431.1_10 Forward -242 -224 1.29745 0.256
NP_440147.1_4 Reverse -228 -241 -0.767364 0.299
NP_441550.1_8 Reverse -228 -238 5.87944 0.224
NP_441550.1_8 Forward -59 -49 5.28945 0.255
NP_441916.1_7 Forward -258 -248 5.5849 0.128
NP_441041.1_4 Reverse -103 -122 -5.31042 0.151
NP_441041.1_4 Reverse -42 -61 -11.7019 0.251
NP_442004.1_6 Reverse -42 -56 2.94952 0.254
NP_440703.1_9 Forward -225 -212 4.64028 0.295
NP_442941.1_3 Forward -50 -40 -1.00328 0.282
NP_440289.1_7 Forward -60 -41 5.99764 0.181
NP_442281.1_1 Forward -230 -216 3.24392 0.238
NP_442256.1_2 Reverse -269 -287 -8.83064 0.236
NP_441556.1_10 Forward -56 -42 13.5313 0.178
NP_440498.1_1 Forward -145 -127 5.62401 0.1
NP_442068.1_8 Forward -257 -238 11.1109 0.107
NP_441644.1_6 Forward -239 -229 11.091 0.0552
NP_441644.1_6 Forward -286 -276 4.30615 0.242
NP_441644.1_6 Forward -368 -358 4.20782 0.245
NP_441644.1_6 Forward -51 -41 3.22451 0.293
NP_440929.1_8 Reverse -48 -57 2.16301 0.262
NP_442554.1_8 Reverse -231 -241 6.17489 0.125
NP_442554.1_8 Forward -50 -40 4.79825 0.173
NP_442554.1_8 Forward -56 -46 2.92996 0.249
NP_442142.1_4 Forward -54 -41 4.93527 0.206
NP_442292.1_1 Forward -50 -41 6.19458 0.109
NP_441024.1_6 Forward -187 -168 9.69201 0.219
NP_440895.1_10 Reverse -232 -249 -3.8944 0.187
NP_441715.1_4 Reverse -272 -282 10.3048 0.097
NP_440881.1_4 Forward -391 -372 1.0811 0.226
NP_440464.1_10 Forward -255 -245 12.6262 0.202
NP_441468.1_1 Reverse -43 -50 3.97235 0.277
NP_441020.2_7 Forward -154 -135 5.99684 0.292
NP_440265.1_7 Reverse -237 -251 16.5185 0.169
NP_441826.1_5 Reverse -225 -244 19.9606 0.0501
NP_442490.1_9 Reverse -218 -237 7.17762 0.139
NP_442719.1_2 Forward -162 -144 -1.6532 0.175
NP_440789.1_10 Forward -341 -323 14.6697 0.283
NP_442808.1_1 Forward -52 -42 3.91283 0.218
NP_440918.1_2 Reverse -214 -233 11.5042 0.259
NP_440031.1_10 Reverse -95 -114 8.94757 0.193
NP_442050.1_2 Forward -251 -232 7.4718 0.252
NP_440923.1_7 Reverse -82 -101 22.9106 0.0142
NP_441518.1_9 Reverse -219 -237 20.2753 0.0982
NP_441878.1_6 Reverse -229 -239 -0.0199663 0.163
NP_441878.1_6 Forward -240 -230 -7.19813 0.21
NP_442650.1_2 Reverse -42 -56 6.29277 0.134
NP_442503.1_9 Reverse -197 -216 8.65258 0.22
NP_440101.1_3 Reverse -302 -321 7.86593 0.17
NP_442965.1_2 Reverse -278 -297 -8.85033 0.294
NP_442590.1_10 Reverse -210 -229 7.27595 0.23
NP_440299.1_1 Reverse -226 -239 4.73861 0.201
NP_440299.1_1 Forward -55 -42 2.08368 0.299
NP_441007.1_10 Forward -244 -231 -0.37404 0.277
NP_442334.1_10 Reverse -224 -243 -16.6185 0.248
NP_443042.1_3 Forward -357 -339 17.2271 0.15
NP_441559.1_8 Forward -307 -293 -4.22864 0.219
NP_440915.1_3 Forward -244 -225 11.4058 0.29
NP_440915.1_6 Reverse -226 -240 4.62115 0.0953
NP_442069.1_1 Forward -257 -238 18.1898 0.261
NP_441939.1_3 Forward -56 -37 5.211 0.284
NP_441199.1_6 Forward -243 -224 7.86593 0.115
NP_441494.1_6 Forward -373 -360 5.91914 0.292
NP_442957.1_8 Reverse -214 -233 7.86593 0.287
NP_442386.1_9 Forward -52 -43 12.7823 0.0537
NP_442386.1_9 Reverse -41 -50 9.04574 0.175
NP_442386.1_9 Reverse -47 -56 5.89917 0.233
NP_440570.1_5 Reverse -174 -193 -0.197208 0.262
NP_441340.1_9 Forward -347 -337 15.1001 0.194
NP_442186.1_9 Forward -248 -229 6.29264 0.228
NP_440168.1_9 Reverse -92 -111 -4.72043 0.296
NP_442240.1_2 Reverse -360 -379 -14.7502 0.188
NP_442240.1_2 Reverse -207 -226 -19.3717 0.295
NP_440027.1_3 Forward -82 -64 6.21323 0.23
NP_440027.1_3 Forward -249 -231 4.83661 0.25
NP_440027.1_3 Forward -231 -213 1.98502 0.295
NP_439984.1_7 Reverse -167 -185 12.6055 0.137
NP_439937.1_9 Reverse -162 -179 -10.9749 0.237
NP_440439.1_1 Forward -242 -229 0.314277 0.194
NP_440439.1_3 Reverse -253 -271 14.0805 0.259
NP_442783.1_8 Reverse -167 -186 15.3382 0.248
NP_442783.1_8 Reverse -168 -187 14.9449 0.266
NP_442384.1_10 Reverse -42 -55 4.93583 0.142
NP_442713.1_1 Reverse -31 -50 -0.787193 0.284
NP_441018.1_7 Reverse -212 -231 13.5691 0.132
NP_442790.1_4 Reverse -221 -240 -9.44032 0.184
NP_442262.1_10 Reverse -115 -122 8.59391 0.22
NP_440344.1_10 Forward -58 -41 -9.59759 0.15
NP_441060.1_1 Reverse -284 -303 11.3045 0.294
NP_442641.1_1 Reverse -91 -110 -16.4218 0.243
NP_442126.1_9 Reverse -299 -318 10.9142 0.227
NP_440297.1_9 Forward -285 -275 -0.609952 0.292
NP_442078.1_3 Reverse -174 -193 4.42355 0.189
NP_440888.1_2 Reverse -230 -244 6.68548 0.223
NP_440888.1_2 Forward -63 -49 5.50552 0.276
NP_442033.1_6 Reverse -365 -384 13.2741 0.229
NP_442033.1_10 Reverse -228 -247 -11.3086 0.251
NP_441543.1_2 Forward -50 -41 4.91628 0.213
NP_442845.1_2 Forward -57 -43 12.0943 0.116
NP_442845.1_2 Reverse -36 -50 7.9644 0.195
NP_440208.1_1 Reverse -226 -245 -1.47551 0.135
NP_441319.1_8 Reverse -224 -242 6.31233 0.27
NP_441469.1_8 Reverse -41 -50 5.11294 0.289
NP_442337.1_8 Reverse -211 -230 5.50599 0.21
NP_441462.1_2 Reverse -230 -240 7.15819 0.0583
NP_441462.1_5 Forward -177 -158 7.47261 0.213
NP_441621.1_7 Reverse -228 -242 -0.197071 0.157
NP_441601.1_7 Forward -257 -238 10.8159 0.219
NP_441560.1_3 Forward -245 -227 6.31233 0.28
NP_440516.1_8 Reverse -42 -51 -0.590259 0.283
NP_441033.1_8 Forward -150 -131 18.4857 0.155
NP_442428.1_5 Reverse -43 -50 10.6589 0.0727
NP_442545.1_3 Reverse -34 -53 11.5042 0.0906
NP_441052.1_2 Forward -51 -41 8.04317 0.0533
NP_441052.1_2 Reverse -42 -52 5.19158 0.128
NP_442219.1_9 Reverse -43 -52 5.70292 0.135
NP_440436.1_4 Forward -50 -41 4.52254 0.256
NP_440222.1_8 Forward -139 -120 15.135 0.22
NP_441004.1_2 Reverse -143 -162 -4.03212 0.288
NP_442813.1_4 Forward -288 -269 -6.1954 0.299
NP_442813.1_4 Reverse -190 -209 -7.17871 0.299
NP_442813.1_4 Reverse -299 -318 -7.37537 0.299
NP_442813.1_5 Reverse -379 -398 2.55606 0.275
NP_442366.1_3 Forward -58 -40 -2.14413 0.221
NP_442873.1_5 Forward -253 -234 8.4551 0.259
NP_441115.1_4 Reverse -270 -288 11.2281 0.148
NP_440864.1_9 Reverse -212 -231 -6.49039 0.258
NP_441851.1_10 Reverse -41 -51 4.99491 0.233
NP_441668.1_4 Reverse -4 -23 -1.7705 0.28
NP_440593.1_3 Forward -244 -225 4.62101 0.133
NP_440593.1_3 Forward -238 -219 -5.99873 0.268
NP_441982.1_1 Reverse -2 -21 4.81767 0.2
NP_439960.1_10 Forward -105 -87 -3.71743 0.279
NP_440726.1_2 Forward -224 -205 0.982764 0.285
NP_441124.1_5 Reverse -331 -341 13.1036 0.215
NP_442006.1_2 Forward -149 -132 -7.13932 0.169
NP_440483.1_1 Reverse -94 -113 -5.9004 0.237
NP_442243.1_1 Forward -245 -227 3.36165 0.204
NP_441078.1_4 Reverse -42 -51 5.11294 0.118
NP_441078.1_4 Forward -239 -230 -1.86856 0.272
NP_441663.1_8 Forward -109 -90 1.57275 0.212
NP_440707.1_9 Reverse -107 -126 12.6841 0.193
NP_442443.1_1 Forward -235 -216 3.53937 0.169
NP_441091.1_5 Forward -296 -277 7.07928 0.204
NP_440526.1_3 Reverse -155 -166 5.17139 0.253
NP_441432.1_8 Reverse -41 -50 4.42462 0.213
NP_442320.1_8 Reverse -36 -50 -6.39192 0.283
NP_442003.1_9 Reverse -216 -235 2.65439 0.293
NP_440578.1_10 Reverse -208 -227 11.6025 0.246
NP_441057.1_4 Reverse -359 -377 -1.75081 0.272
NP_440281.1_6 Forward -397 -378 11.8975 0.268
NP_442489.1_7 Forward -239 -230 -1.18024 0.18
NP_442489.1_7 Reverse -42 -51 -1.6719 0.235
NP_441659.2_8 Reverse -230 -240 6.37155 0.0774
NP_441022.1_1 Reverse -175 -184 11.834 0.273
NP_441040.1_2 Reverse -85 -104 -7.37537 0.212
NP_441040.1_2 Forward -247 -228 -14.8485 0.286
NP_439956.1_7 Reverse -201 -220 2.55606 0.273
NP_439956.1_7 Reverse -211 -230 2.0644 0.276
NP_440708.1_4 Reverse -213 -232 8.16093 0.221
NP_441800.1_2 Forward -112 -93 11.3075 0.226
NP_440545.1_3 Reverse -226 -243 5.05372 0.0646
NP_440545.1_3 Forward -243 -226 -1.82945 0.175
NP_440545.1_3 Reverse -355 -372 -3.30441 0.203
NP_441856.1_8 Forward -247 -228 15.5357 0.187
NP_441856.1_8 Forward -253 -234 11.0125 0.274
NP_440831.1_1 Reverse -231 -250 13.1758 0.261
NP_440831.1_3 Forward -236 -217 5.12514 0.29
NP_441653.1_2 Forward -389 -370 7.10507 0.223
NP_440010.1_10 Reverse -219 -238 6.19431 0.226
NP_442311.1_8 Forward -105 -86 10.8159 0.278
NP_440847.1_3 Forward -294 -280 16.6169 0.119
NP_440449.1_6 Forward -247 -229 7.18594 0.229
NP_441948.1_4 Reverse -220 -238 -3.71743 0.203
NP_440170.1_6 Reverse -266 -285 11.2092 0.294
NP_443040.1_1 Forward -346 -332 10.4738 0.291
NP_441895.1_10 Reverse -280 -299 -18.2901 0.282
NP_441239.1_9 Forward -241 -229 7.70879 0.15
NP_441508.1_4 Reverse -172 -186 13.7625 0.293
NP_441874.1_1 Reverse -32 -46 10.6193 0.26
NP_440833.1_6 Forward -91 -77 11.7003 0.217
NP_439974.1_4 Forward -379 -360 14.8474 0.159
NP_442340.1_3 Forward -237 -218 -6.78538 0.225
NP_441582.1_5 Forward -53 -34 5.30853 0.216
NP_442402.1_10 Reverse -166 -176 14.8275 0.18
NP_442258.1_3 Forward -235 -216 13.7658 0.0356
NP_440696.1_3 Reverse -212 -230 8.96727 0.149
NP_440696.1_6 Reverse -136 -155 6.39097 0.266
NP_441203.1_1 Reverse -217 -236 -12.4886 0.143
NP_440914.1_1 Reverse -42 -52 14.5682 0.0112
NP_442533.1_6 Forward -239 -230 10.6195 0.0529
NP_442533.1_6 Reverse -42 -51 6.19458 0.115
NP_443016.1_1 Reverse -36 -55 -7.57203 0.277
NP_442269.1_4 Reverse -193 -212 19.9606 0.0643
NP_442269.1_10 Reverse -205 -224 1.57275 0.29
NP_441028.1_6 Reverse -88 -98 3.71617 0.281
NP_440116.1_8 Forward -122 -103 -3.63879 0.157
NP_441602.1_3 Reverse -225 -244 -1.27885 0.226
NP_442306.1_10 Forward -244 -225 -21.9284 0.296
NP_442072.1_9 Reverse -229 -247 -5.68405 0.067
NP_441808.1_7 Forward -247 -228 16.9124 0.115
NP_442264.1_5 Forward -57 -43 11.701 0.253
NP_441021.1_1 Forward -238 -219 -11.3086 0.259
NP_442912.1_5 Reverse -281 -300 14.4541 0.279
NP_442794.1_1 Forward -290 -278 8.59377 0.102
NP_442794.1_1 Forward -55 -43 4.66053 0.251
NP_441962.1_4 Forward -56 -37 -12.3902 0.256
NP_441431.1_3 Forward -110 -91 7.27595 0.242
NP_441993.1_1 Reverse -212 -231 3.89583 0.227
NP_439988.1_3 Reverse -142 -156 7.17775 0.277
NP_441237.1_9 Forward -50 -40 13.8447 0.062
NP_442743.1_5 Reverse -37 -56 8.45592 0.148
NP_440643.1_2 Reverse -348 -367 0.786102 0.298
NP_440643.1_9 Reverse -54 -73 17.2074 0.165
NP_442867.1_4 Forward -235 -216 10.3242 0.267
NP_440798.1_6 Reverse -49 -62 2.77255 0.16
NP_441984.1_3 Forward -378 -360 10.9339 0.184
NP_441436.1_8 Reverse -229 -248 13.3725 0.215
NP_440473.1_1 Forward -54 -35 11.161 0.283
NP_442514.1_5 Forward -239 -220 -9.73604 0.298
NP_442514.1_5 Forward -111 -92 -9.73604 0.298
NP_440756.1_1 Forward -357 -338 14.5362 0.294
NP_441885.1_5 Reverse -42 -52 -0.216628 0.189
NP_442228.1_10 Reverse -91 -110 11.5042 0.255
NP_442341.1_9 Forward -74 -60 11.602 0.122
NP_441756.1_5 Reverse -91 -110 -4.6221 0.295
NP_441173.1_9 Reverse -169 -177 11.0321 0.228
NP_442395.2_4 Forward -148 -129 -0.29631 0.288
NP_440507.2_3 Forward -60 -41 6.98015 0.293
NP_440275.1_3 Reverse -228 -238 6.17489 0.122
NP_443060.1_5 Forward -59 -40 5.2102 0.271
NP_440175.1_7 Reverse -212 -230 15.609 0.119
NP_440175.1_7 Reverse -89 -107 9.07034 0.282
NP_440149.1_8 Reverse -271 -290 -7.86702 0.294
NP_441105.1_3 Reverse -37 -56 -1.7705 0.151
NP_441105.1_3 Forward -62 -43 -6.39206 0.234
NP_440216.1_9 Forward -366 -357 5.80125 0.289
NP_440172.1_1 Reverse -42 -52 4.0116 0.208
NP_442015.1_10 Reverse -44 -57 1.88757 0.204
NP_442015.1_10 Forward -55 -42 0.707601 0.221
NP_443052.1_9 Reverse -232 -251 0.58944 0.194
NP_443052.1_9 Forward -250 -231 -2.95047 0.244
NP_443052.1_9 Reverse -220 -239 -3.63879 0.251
NP_443052.1_9 Reverse -235 -254 -5.60541 0.271
NP_442226.1_1 Forward -201 -182 10.4225 0.281
NP_440261.1_5 Reverse -62 -75 -10.9938 0.23
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGGGAAAGTGAAAGTCCCACCGAGGAACCGGAAGCCGTTGCAAACTTATCTCCTAGTAAAAATTCTGAAACTGAATCTACTCCCACTGATAACTGCCCGGAATACACCATCCTTCCCGATGGTACTCGCTTGAAGGTGTTTAAGCGTCAGCCTGAACCGGAGCCGGTGGCCCCAGAGCAAGCCCAAGCATTCCGGCAAATGATGCAGGGTTTATTCAAGAGTTTTGGTGGAAAGCGGGAGGTTTGCCCTAAGCCCCAGTCTGAACTGGAACGTCTCAATCAATGGCTCTACGACCCGGCCCTACGGGAGGAAGCAATTCACTATGCTCGGCGGGCACGCAGTGTGCCTTCGGCATCGCCAAATTACAAATACTGCTCCGAAACTGACCAAATTATCCACT

CDS

GTGAGGAGTTCTAGCCATGGAACCCTTAAACACCTCGACCTATTTGCCGGATGTGGGGGATTCACCCTGGCCGCAGAACAAACCAGAGGAAAAATACAAACAACTCAGTTTGTTGAAATCGACCCCGACTGTCACGCCATCCTTCAGCATCACTGGCCCCAGGGTGAAAATAAAACTTCGATGGCCCTTACCGGAAGTACGCCCCCGGCGATCTCGAGGCCAGGGTAG

Protein

No sequence available