Your browser is old and dusty. Try Google Chrome!

Details for ssl5064

ORF ssl5064
Accession NP_942220.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440226.1_1 Reverse -329 -348 8.84924 0.0817
NP_440226.1_1 Reverse -358 -377 7.86593 0.0975
NP_440259.1_4 Reverse -76 -90 9.69635 0.278
NP_440637.1_7 Reverse -368 -387 11.9958 0.259
NP_442655.1_2 Reverse -166 -185 4.12936 0.23
NP_440784.1_7 Reverse -25 -32 5.84064 0.248
NP_441250.1_2 Reverse -32 -51 13.2741 0.236
NP_441054.1_2 Reverse -252 -271 11.1109 0.271
NP_441802.1_1 Forward -384 -365 10.9142 0.197
NP_442242.1_4 Forward -366 -359 10.9539 0.12
NP_441208.1_9 Reverse -326 -340 5.21113 0.275
NP_441594.1_6 Reverse -377 -396 9.3409 0.144
NP_440370.1_10 Reverse -349 -368 7.96426 0.244
NP_441925.1_5 Forward -51 -37 19.8624 0.0337
NP_440856.1_7 Reverse -371 -390 -0.197208 0.167
NP_441083.1_5 Forward -367 -357 3.81494 0.164
NP_441738.1_4 Reverse -270 -289 10.7175 0.155
NP_441713.1_8 Reverse -40 -58 7.59063 0.294
NP_441770.1_10 Reverse -113 -132 9.24257 0.254
NP_442570.1_3 Reverse -259 -278 -8.06369 0.279
NP_441716.1_2 Forward -33 -14 8.52366 0.229
NP_443013.1_7 Reverse -319 -338 16.4207 0.275
NP_441327.1_5 Reverse -143 -152 14.2577 0.233
NP_442111.1_3 Reverse -44 -57 12.7622 0.271
NP_441624.1_7 Reverse -268 -282 14.1593 0.158
NP_441014.1_10 Reverse -307 -326 -1.57461 0.262
NP_442848.1_1 Reverse -352 -366 9.14437 0.0791
NP_442848.1_1 Forward -373 -359 -0.197071 0.263
NP_443018.1_3 Reverse -302 -309 5.34899 0.212
NP_441797.1_1 Forward -253 -234 11.7008 0.295
NP_442946.1_7 Forward -391 -376 18.5887 0.158
NP_442296.1_9 Reverse -311 -330 -4.91709 0.282
NP_440360.1_1 Reverse -324 -342 16.7346 0.166
NP_442782.1_2 Reverse -329 -343 6.19444 0.229
NP_440153.1_5 Reverse -359 -373 1.57289 0.248
NP_441129.1_3 Forward -342 -323 -9.83364 0.228
NP_442771.1_1 Forward -371 -353 -1.25915 0.133
NP_440569.1_10 Reverse -121 -140 6.54077 0.234
NP_442996.1_10 Forward -95 -77 12.7038 0.264
NP_441568.1_6 Forward -35 -17 10.9836 0.295
NP_441079.1_7 Forward -66 -47 -2.75457 0.222
NP_442012.1_5 Reverse -348 -367 -1.18052 0.288
NP_442068.1_4 Forward -171 -152 10.1267 0.179
NP_441644.1_6 Reverse -329 -339 3.32285 0.288
NP_442215.1_2 Forward -319 -303 -6.92296 0.281
NP_442933.1_2 Forward -26 -8 7.16388 0.268
NP_442554.1_8 Forward -337 -327 2.14332 0.281
NP_442167.1_6 Forward -166 -150 13.2342 0.229
NP_440895.1_6 Reverse -323 -336 8.67241 0.251
NP_441865.1_1 Forward -215 -196 16.9426 0.255
NP_441715.1_4 Forward -366 -356 5.28991 0.216
NP_441016.2_6 Forward -269 -250 8.94676 0.222
NP_441251.1_2 Reverse -234 -252 15.8504 0.15
NP_442789.1_4 Forward -316 -297 0.294447 0.193
NP_440923.1_1 Forward -116 -98 12.0147 0.246
NP_440084.1_8 Forward -18 -4 11.7571 0.241
NP_441458.1_10 Reverse -265 -284 11.6025 0.108
NP_442830.1_5 Forward -164 -150 4.03056 0.239
NP_442998.1_5 Reverse -108 -118 10.2065 0.222
NP_442998.1_5 Reverse -144 -154 10.1081 0.225
NP_440299.1_1 Reverse -139 -152 2.96866 0.265
NP_441799.1_1 Forward -371 -357 6.0955 0.183
NP_441559.1_4 Reverse -338 -357 9.24257 0.102
NP_441559.1_8 Reverse -256 -270 -7.57189 0.295
NP_442993.1_1 Forward -124 -108 -10.2662 0.214
NP_441254.1_1 Reverse -126 -139 10.7368 0.295
NP_440161.1_3 Forward -391 -372 14.3558 0.121
NP_442251.1_6 Forward -366 -359 11.4455 0.0901
NP_439937.1_9 Forward -157 -140 -0.748498 0.122
NP_441803.1_2 Forward -400 -381 0.982764 0.242
NP_442384.1_10 Forward -33 -20 0.412608 0.291
NP_441018.1_7 Reverse -253 -272 7.37428 0.272
NP_441018.1_7 Reverse -231 -250 6.68596 0.283
NP_442262.1_10 Reverse -302 -309 7.6106 0.274
NP_440344.1_10 Reverse -379 -396 -13.9242 0.298
NP_440531.1_1 Forward -343 -324 9.0459 0.193
NP_441898.1_8 Forward -388 -369 7.57094 0.16
NP_440888.1_2 Reverse -386 -400 7.66879 0.186
NP_442277.1_7 Reverse -204 -220 -1.80754 0.286
NP_440771.1_8 Forward -194 -175 20.8447 0.105
NP_442710.1_7 Forward -21 -2 -6.06943 0.294
NP_440710.1_1 Forward -297 -279 -2.24246 0.19
NP_440220.1_4 Reverse -327 -346 -0.984623 0.262
NP_441621.1_7 Reverse -266 -280 -6.29359 0.283
NP_443062.1_1 Reverse -296 -314 3.76806 0.285
NP_442204.1_1 Reverse -325 -336 0.255333 0.282
NP_441351.1_8 Forward -279 -260 1.37609 0.276
NP_440255.1_3 Reverse -14 -24 14.6315 0.298
NP_442780.1_3 Forward -230 -211 5.68135 0.291
NP_440516.1_6 Reverse -371 -385 6.58715 0.293
NP_440455.1_2 Forward -54 -41 16.8112 0.225
NP_442219.1_8 Forward -321 -302 12.0324 0.168
NP_441004.1_1 Reverse -349 -368 -17.0118 0.288
NP_441004.1_2 Reverse -151 -170 -4.22878 0.29
NP_440296.1_6 Reverse -3 -21 10.8881 0.295
NP_441124.1_5 Forward -60 -50 15.8729 0.188
NP_440431.1_3 Forward -339 -320 20.649 0.00879
NP_440431.1_3 Forward -34 -15 -0.197208 0.14
NP_442006.1_2 Forward -389 -372 -10.7776 0.197
NP_441570.1_1 Forward -367 -349 -16.6971 0.252
NP_441432.1_8 Reverse -250 -259 3.44131 0.245
NP_442320.1_2 Forward -50 -31 14.9458 0.26
NP_442320.1_9 Reverse -247 -261 14.4542 0.246
NP_441732.1_2 Forward -371 -355 -16.8544 0.207
NP_440290.1_1 Forward -60 -51 15.65 0.292
NP_442797.1_2 Forward -265 -247 18.2038 0.113
NP_440713.1_4 Reverse -348 -367 1.57275 0.284
NP_441022.1_1 Reverse -47 -56 13.2728 0.216
NP_442913.1_10 Reverse -299 -318 11.1109 0.0421
NP_441040.1_8 Reverse -30 -49 18.921 0.128
NP_441800.1_7 Forward -366 -348 -4.01242 0.284
NP_440335.1_9 Reverse -34 -52 16.4404 0.184
NP_442346.1_5 Forward -34 -24 5.09324 0.262
NP_442346.1_5 Reverse -23 -33 5.09324 0.262
NP_442346.1_5 Reverse -328 -338 4.20827 0.296
NP_440459.1_2 Forward -340 -323 8.59364 0.254
NP_441895.1_2 Reverse -39 -58 -18.0934 0.234
NP_441112.1_6 Forward -149 -130 -2.26216 0.296
NP_441973.1_6 Reverse -6 -24 15.2789 0.27
NP_442199.1_5 Forward -285 -266 -1.7705 0.181
NP_440590.1_4 Forward -337 -324 -0.177378 0.179
NP_441892.1_1 Forward -165 -148 0.235503 0.172
NP_440546.1_4 Reverse -329 -339 9.94905 0.112
NP_440868.1_4 Forward -371 -359 -1.14099 0.296
NP_441084.1_6 Forward -35 -21 12.2528 0.165
NP_441811.1_8 Reverse -352 -366 8.16106 0.238
NP_442679.1_1 Forward -250 -231 -5.31042 0.292
NP_439994.1_4 Reverse -249 -268 16.4207 0.185
NP_441576.1_10 Forward -67 -48 17.6007 0.108
NP_442533.1_6 Reverse -329 -338 1.37636 0.3
NP_440854.1_7 Forward -218 -204 17.3897 0.246
NP_439944.1_9 Reverse -236 -246 10.2065 0.0917
NP_441697.1_5 Forward -65 -46 -4.53629 0.222
NP_441697.1_5 Reverse -3 -22 -9.1199 0.268
NP_440816.1_2 Forward -70 -51 8.75846 0.238
NP_441028.1_6 Reverse -309 -319 3.51951 0.292
NP_441527.1_4 Forward -247 -228 -1.00309 0.146
NP_440007.1_4 Forward -288 -269 9.73422 0.274
NP_439903.1_6 Forward -292 -273 1.37531 0.248
NP_441705.1_4 Reverse -239 -258 9.63589 0.256
NP_440886.1_7 Forward -163 -153 3.12618 0.296
NP_440083.1_1 Reverse -259 -278 1.86774 0.277
NP_441463.1_3 Forward -299 -280 -9.14533 0.277
NP_442794.1_1 Reverse -325 -337 7.61046 0.136
NP_441962.1_4 Forward -394 -375 -2.85214 0.138
NP_441836.1_2 Forward -39 -20 -2.95047 0.232
NP_441853.1_4 Forward -225 -206 20.7325 0.23
NP_441272.1_4 Reverse -62 -81 10.0292 0.181
NP_441272.1_7 Reverse -154 -164 13.7464 0.257
NP_441133.1_3 Forward -274 -255 12.6841 0.289
NP_442341.1_7 Forward -396 -382 6.88276 0.116
NP_443000.1_7 Forward -35 -25 4.20827 0.209
NP_440560.1_5 Reverse -176 -195 9.52211 0.276
NP_440091.1_1 Reverse -354 -366 0.530633 0.247
NP_442354.1_7 Forward -69 -50 6.68596 0.216
NP_442686.1_7 Reverse -229 -248 19.5258 0.164
NP_440216.1_9 Forward -355 -346 12.7828 0.223
NP_440172.1_1 Reverse -329 -339 4.3066 0.194
NP_442015.1_10 Reverse -325 -338 2.08423 0.202
NP_441226.1_7 Reverse -297 -304 8.59356 0.197
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GATATGGGAGTCACCACTGCGGAAATGAAGGGACGAGATCACTACCCCTGGCAAGATTACAAAACCATCGGCAAGGAAATTATGGAGGTCATCAATGGGACGGCTCAGTAAGGTGTTTGACACGGCTAAGGCAGAATCCGTGCCAGAGCCAGAAATAACGAAAGCAAGAAGTAACGAATTCGTTAATCTTAATTTTAAGGTAACTCCAGAAATGCGCCGTAAGCTCAAACAGTATGCCGCCAAGCACGATCTATCCCTAAAGGAAGTTTTTGAAGCGGCTCTGGATTTTTACATTGAGCATCATCCTTGACCTAAAAAAACACTAGGGGTTCAGGCAAAGTGCCAAAATTTTTTACTAGGGGTTTCAAGTGATGACTAAAAAAATTACTAAGGGTTTGGA

CDS

ATGAAAGATAACCGGTATTCTCCTGACTGGCCCCAGTTAGCCCTGAGCAAAAAGCAGTCCGTTAATTGGATCTGTGAACGGTGCGGGGTGCAATGCCTCAAGCCTGGGGAAGGGAAGGGGTTATTAAAGGAGGAACGGTATCGGCTCAGGATGGCAGTTCATCATTGTGATTATGATCCAAGTAATAACTCCCCCAGTAATTTGATGGCTTTATGCTCCCCCTGTCATCTTTATTACCACCGCAGGCAACGGGGGAATGTGACTCCAGGGCAGTTATTGCTGTTAAGATAA

Protein

No sequence available