Your browser is old and dusty. Try Google Chrome!

Details for ssl5045

ORF ssl5045
Accession NP_942201.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Forward -269 -250 -30.6798 0.291
NP_441480.1_5 Forward -210 -191 12.2908 0.191
NP_440897.1_6 Forward -112 -93 2.35861 0.165
NP_441453.1_4 Forward -326 -318 6.80426 0.121
NP_441453.1_4 Reverse -317 -325 6.11594 0.121
NP_441818.1_1 Reverse -332 -343 8.51463 0.288
NP_440226.1_1 Reverse -317 -336 13.1758 0.0383
NP_441630.1_3 Reverse -287 -306 2.85105 0.214
NP_441098.1_3 Reverse -127 -146 -3.53503 0.28
NP_441098.1_3 Reverse -204 -223 -4.97059 0.28
NP_442744.1_9 Reverse -311 -325 12.8353 0.288
NP_441721.1_6 Forward -32 -13 7.57094 0.281
NP_442173.1_1 Reverse -318 -326 12.0158 0.0316
NP_442173.1_1 Forward -325 -317 4.83764 0.241
NP_442752.1_4 Forward -326 -319 13.8055 0.0199
NP_441225.1_1 Reverse -319 -338 -2.45882 0.167
NP_440784.1_7 Forward -325 -318 6.23397 0.241
NP_440784.1_7 Reverse -318 -325 6.13563 0.241
NP_439979.1_2 Reverse -103 -122 6.29264 0.292
NP_441859.1_3 Forward -270 -251 7.76679 0.153
NP_441802.1_1 Forward -342 -323 6.19431 0.269
NP_440916.1_1 Forward -24 -10 8.25939 0.273
NP_441925.1_4 Reverse -185 -204 -16.9142 0.287
NP_441083.1_3 Reverse -182 -192 15.8108 0.123
NP_441083.1_5 Reverse -317 -327 8.73149 0.0307
NP_441083.1_5 Forward -326 -316 8.04317 0.046
NP_441434.1_1 Reverse -47 -61 6.98253 0.291
NP_441434.1_7 Reverse -319 -333 2.75286 0.27
NP_441738.1_2 Reverse -319 -326 15.28 0.0102
NP_441738.1_2 Reverse -283 -290 8.29857 0.176
NP_440209.1_1 Forward -326 -318 8.57422 0.0425
NP_440209.1_1 Reverse -317 -325 5.52596 0.0821
NP_442570.1_3 Forward -298 -279 -6.98204 0.265
NP_439953.1_1 Reverse -15 -34 19.0757 0.163
NP_442111.1_4 Reverse -316 -330 9.93102 0.0575
NP_441495.1_1 Forward -348 -329 12.1925 0.193
NP_440343.1_3 Reverse -96 -114 7.68819 0.205
NP_440906.1_5 Forward -325 -318 6.23397 0.234
NP_440906.1_5 Reverse -318 -325 6.13563 0.241
NP_440747.1_10 Reverse -314 -326 -4.77924 0.117
NP_440842.1_6 Forward -126 -107 12.4867 0.25
NP_441014.1_10 Reverse -330 -349 2.26028 0.216
NP_443018.1_3 Reverse -318 -325 11.7405 0.0655
NP_443018.1_3 Reverse -338 -345 8.49558 0.141
NP_443018.1_3 Forward -325 -318 5.44732 0.193
NP_440376.1_1 Forward -326 -317 5.99792 0.111
NP_440376.1_1 Forward -256 -247 1.37636 0.252
NP_440376.1_1 Reverse -317 -326 -0.196935 0.285
NP_441588.1_4 Reverse -319 -329 13.943 0.0841
NP_442687.1_7 Forward -187 -177 3.71661 0.292
NP_442485.1_3 Forward -123 -104 -5.9004 0.296
NP_440533.1_9 Reverse -150 -169 5.80098 0.19
NP_441855.2_4 Forward -312 -293 9.81228 0.275
NP_441414.1_9 Forward -326 -307 -0.688862 0.0942
NP_441414.1_9 Reverse -317 -336 -10.4236 0.284
NP_440607.1_8 Forward -114 -95 4.32602 0.209
NP_442937.1_5 Forward -331 -312 5.80098 0.3
NP_441958.1_5 Forward -327 -317 9.81313 0.0174
NP_440203.1_5 Forward -75 -65 8.92768 0.281
NP_439905.1_5 Reverse -17 -31 14.4542 0.288
NP_441097.1_2 Forward -298 -281 3.18543 0.293
NP_440602.1_2 Reverse -242 -261 7.07928 0.243
NP_441099.1_5 Forward -387 -368 -11.9969 0.294
NP_442002.1_9 Forward -187 -180 12.2322 0.185
NP_441000.1_1 Reverse -64 -82 12.0363 0.229
NP_440147.1_4 Forward -328 -315 1.88757 0.216
NP_441550.1_8 Forward -328 -318 14.0409 0.0194
NP_441550.1_8 Reverse -315 -325 10.0093 0.0785
NP_441916.1_7 Reverse -317 -327 1.06167 0.294
NP_440703.1_9 Reverse -184 -197 11.7201 0.192
NP_441725.1_4 Forward -351 -337 2.8506 0.279
NP_439966.1_7 Reverse -315 -325 6.96107 0.16
NP_442941.1_3 Reverse -318 -328 1.25834 0.15
NP_441678.1_9 Reverse -368 -387 -1.18052 0.238
NP_441334.1_4 Reverse -204 -223 21.915 0.0631
NP_441079.1_7 Forward -55 -36 -2.36125 0.217
NP_440018.1_3 Forward -172 -153 3.04771 0.28
NP_442012.1_1 Forward -262 -243 -0.197208 0.253
NP_443030.1_4 Forward -262 -243 -5.21209 0.266
NP_441196.1_6 Forward -207 -188 12.1925 0.136
NP_441644.1_6 Reverse -317 -327 16.1058 0.0048
NP_441644.1_6 Forward -326 -316 4.01116 0.253
NP_443049.1_6 Forward -327 -317 12.3241 0.24
NP_442215.1_2 Forward -20 -4 -5.15301 0.246
NP_440929.1_8 Reverse -317 -326 7.07956 0.0713
NP_440780.1_1 Reverse -192 -211 7.68668 0.274
NP_440576.1_10 Forward -30 -11 20.0581 0.174
NP_442554.1_8 Reverse -318 -328 6.56821 0.112
NP_442554.1_8 Forward -325 -315 3.42162 0.226
NP_441762.1_7 Forward -327 -315 -7.13918 0.285
NP_442142.1_4 Reverse -334 -347 7.39353 0.141
NP_442292.1_1 Reverse -318 -327 7.66954 0.0634
NP_442292.1_1 Forward -325 -316 -0.0986038 0.239
NP_442292.1_5 Forward -307 -288 5.40766 0.228
NP_440620.1_4 Reverse -26 -40 15.5768 0.236
NP_441198.1_8 Forward -306 -296 14.2479 0.0869
NP_440379.1_5 Forward -121 -102 -8.752 0.254
NP_440379.1_5 Forward -264 -245 -9.73531 0.264
NP_441468.1_1 Forward -325 -318 6.13563 0.209
NP_441468.1_1 Reverse -318 -325 6.0373 0.223
NP_441673.1_1 Forward -326 -317 1.37636 0.114
NP_441673.1_1 Reverse -317 -326 1.1797 0.163
NP_441637.1_8 Forward -274 -257 12.4285 0.204
NP_442490.1_6 Forward -272 -253 17.7974 0.241
NP_442868.1_6 Reverse -315 -325 -0.314959 0.284
NP_442719.1_3 Forward -33 -20 17.8166 0.292
NP_441612.1_2 Reverse -347 -357 9.80785 0.21
NP_442227.1_2 Reverse -253 -272 -2.55715 0.276
NP_442427.1_8 Forward -335 -316 11.2092 0.152
NP_442808.1_1 Reverse -316 -326 9.616 0.0481
NP_442808.1_1 Reverse -101 -111 3.51951 0.238
NP_442747.1_1 Forward -204 -185 -7.67036 0.218
NP_440558.1_2 Reverse -180 -199 -3.44213 0.236
NP_440923.1_1 Forward -152 -134 10.5398 0.293
NP_441878.1_6 Forward -193 -183 0.373358 0.144
NP_441036.1_3 Reverse -12 -31 7.27595 0.126
NP_441557.1_5 Forward -326 -317 1.08137 0.0794
NP_441557.1_5 Reverse -317 -326 0.589713 0.134
NP_442183.1_1 Reverse -295 -309 4.22782 0.271
NP_442183.1_1 Forward -326 -312 4.12949 0.277
NP_441116.1_9 Forward -319 -305 13.8643 0.233
NP_441037.1_4 Forward -328 -318 5.95329 0.289
NP_441633.1_3 Forward -376 -363 -6.86388 0.277
NP_440136.1_2 Forward -325 -318 6.23397 0.171
NP_440136.1_2 Reverse -318 -325 6.13563 0.193
NP_442998.1_5 Reverse -12 -22 10.7964 0.204
NP_442998.1_10 Reverse -319 -326 15.5754 0.0102
NP_440899.1_8 Reverse -82 -101 1.57275 0.147
NP_441799.1_1 Reverse -313 -327 7.57046 0.138
NP_442334.1_2 Forward -196 -179 -6.35267 0.249
NP_440709.1_1 Forward -148 -129 0.392004 0.26
NP_441559.1_8 Forward -132 -118 -5.90027 0.271
NP_442756.1_2 Reverse -309 -328 13.7658 0.252
NP_441395.1_4 Reverse -58 -77 18.1898 0.163
NP_441464.1_10 Forward -292 -278 12.3893 0.201
NP_441464.1_10 Reverse -377 -391 11.3077 0.223
NP_440306.1_8 Forward -29 -10 8.06178 0.202
NP_442386.1_5 Reverse -276 -295 6.29183 0.22
NP_442386.1_9 Reverse -316 -325 11.9957 0.0754
NP_441340.1_5 Forward -325 -318 13.5105 0.0314
NP_441340.1_5 Reverse -318 -325 5.84064 0.208
NP_442791.1_5 Forward -204 -185 -8.16202 0.279
NP_440586.1_8 Reverse -318 -325 9.47853 0.146
NP_440586.1_8 Forward -325 -318 5.74197 0.283
NP_442959.1_4 Reverse -178 -197 20.649 0.0557
NP_440684.1_9 Reverse -311 -325 10.6193 0.194
NP_441262.1_3 Forward -326 -319 14.7888 0.0223
NP_443051.1_1 Forward -327 -318 16.6177 0.00754
NP_439937.1_4 Forward -23 -4 9.14423 0.278
NP_439937.1_8 Reverse -104 -123 3.34271 0.204
NP_439937.1_8 Forward -271 -252 -4.91709 0.286
NP_439943.1_8 Reverse -284 -303 15.9291 0.188
NP_440372.1_2 Forward -325 -318 13.8055 0.0214
NP_440372.1_2 Reverse -318 -325 6.52896 0.188
NP_441181.1_3 Reverse -95 -114 18.4857 0.103
NP_440819.1_5 Reverse -11 -19 7.98423 0.228
NP_440819.1_5 Reverse -12 -20 7.68924 0.266
NP_440316.1_10 Forward -327 -317 12.4681 0.214
NP_442384.1_10 Forward -377 -364 0.510939 0.289
NP_440472.1_6 Forward -33 -14 21.116 0.0757
NP_442790.1_4 Reverse -308 -327 -9.73531 0.192
NP_442262.1_10 Reverse -318 -325 13.2155 0.0213
NP_442262.1_10 Reverse -338 -345 8.59391 0.22
NP_441689.1_5 Forward -328 -318 5.78111 0.197
NP_440344.1_10 Reverse -230 -247 -13.0392 0.273
NP_442187.1_3 Forward -327 -317 13.4514 0.245
NP_441778.1_10 Reverse -202 -220 15.8619 0.217
NP_442454.1_2 Reverse -205 -224 8.6416 0.291
NP_440600.1_4 Reverse -309 -327 5.03403 0.108
NP_440600.1_4 Forward -334 -316 -6.27403 0.285
NP_441543.1_2 Reverse -318 -327 6.09625 0.153
NP_442845.1_2 Reverse -1 -15 4.42448 0.259
NP_443064.1_6 Forward -127 -117 9.07643 0.247
NP_442578.1_7 Forward -325 -318 6.0373 0.18
NP_441462.1_2 Forward -326 -316 7.55152 0.0543
NP_441462.1_2 Reverse -317 -327 0.57002 0.144
NP_441621.1_7 Reverse -258 -272 0.982901 0.149
NP_443062.1_1 Reverse -317 -335 7.57085 0.172
NP_442872.1_1 Reverse -252 -271 -13.9635 0.275
NP_440516.1_8 Forward -326 -317 18.9776 0.00442
NP_440516.1_8 Reverse -317 -326 5.01461 0.118
NP_441033.1_2 Reverse -307 -326 -5.40875 0.293
NP_442428.1_5 Forward -325 -318 6.13563 0.209
NP_442428.1_5 Reverse -318 -325 6.0373 0.212
NP_441443.1_2 Reverse -95 -114 -6.39206 0.29
NP_441867.1_2 Forward -203 -184 -17.0118 0.291
NP_440673.1_3 Reverse -319 -326 12.4288 0.0426
NP_441052.1_2 Reverse -317 -327 1.16001 0.25
NP_441052.1_2 Forward -326 -316 0.668351 0.256
NP_442219.1_8 Reverse -358 -377 8.94017 0.238
NP_442219.1_9 Forward -325 -316 8.65285 0.0681
NP_441884.1_8 Forward -204 -185 -5.99873 0.204
NP_440314.1_9 Reverse -318 -337 -8.26035 0.246
NP_441719.1_4 Forward -325 -318 6.82395 0.0855
NP_441719.1_4 Reverse -318 -325 6.52896 0.188
NP_442813.1_5 Forward -294 -275 2.55606 0.275
NP_442366.1_3 Forward -327 -309 -4.8974 0.278
NP_442366.1_5 Forward -329 -319 15.4175 0.0374
NP_442694.1_4 Forward -289 -280 11.7011 0.277
NP_442622.1_8 Reverse -317 -335 -19.2537 0.296
NP_441668.1_4 Reverse -307 -326 9.14423 0.128
NP_442689.1_8 Forward -42 -25 -0.551145 0.202
NP_441394.1_2 Forward -114 -95 16.2241 0.251
NP_440432.1_9 Reverse -318 -333 5.78142 0.0512
NP_442843.1_1 Reverse -318 -337 -9.53865 0.266
NP_440431.1_3 Reverse -121 -140 -5.99873 0.188
NP_442006.1_2 Reverse -103 -120 -9.40093 0.197
NP_442006.1_2 Forward -269 -252 -16.4808 0.254
NP_441570.1_1 Reverse -317 -335 -17.0904 0.264
NP_441078.1_4 Forward -326 -317 0.196389 0.205
NP_441078.1_4 Reverse -317 -326 -0.000272808 0.205
NP_442348.1_2 Forward -290 -281 16.6177 0.0863
NP_441432.1_8 Forward -327 -318 14.0611 0.0258
NP_441432.1_9 Forward -30 -17 10.1497 0.256
NP_440313.1_1 Reverse -336 -355 17.6007 0.162
NP_440760.1_1 Reverse -317 -336 -12.6852 0.0945
NP_442489.1_7 Forward -326 -317 0.688044 0.152
NP_442489.1_7 Reverse -317 -326 0.688044 0.152
NP_441830.1_2 Forward -201 -182 -4.42544 0.275
NP_442079.1_7 Reverse -318 -337 5.60432 0.172
NP_440559.1_1 Forward -325 -316 6.48957 0.134
NP_441659.2_8 Reverse -317 -327 8.23984 0.0462
NP_440860.1_8 Reverse -258 -277 12.8808 0.296
NP_440363.1_9 Reverse -175 -193 12.6055 0.265
NP_439956.1_7 Reverse -241 -260 4.42435 0.257
NP_440545.1_5 Reverse -364 -381 3.67709 0.289
NP_440459.1_2 Forward -201 -184 9.28195 0.23
NP_442551.1_4 Reverse -244 -259 -3.65835 0.292
NP_441585.1_2 Forward -201 -182 17.2074 0.201
NP_441047.1_2 Reverse -104 -123 -1.47551 0.267
NP_441833.1_4 Reverse -318 -325 6.52896 0.0924
NP_441833.1_4 Forward -325 -318 6.23397 0.163
NP_442162.1_9 Forward -325 -318 12.9205 0.0282
NP_442162.1_9 Reverse -318 -325 12.9205 0.0282
NP_440224.1_1 Reverse -284 -303 -3.44213 0.265
NP_442140.1_3 Forward -325 -315 4.79825 0.238
NP_442140.1_3 Reverse -318 -328 4.60159 0.242
NP_441813.1_5 Reverse -315 -325 5.48657 0.123
NP_442497.1_8 Forward -91 -72 14.1583 0.231
NP_442497.1_10 Reverse -318 -327 7.76787 0.0731
NP_441239.1_9 Reverse -250 -262 2.98891 0.3
NP_440604.1_2 Reverse -363 -382 20.7473 0.127
NP_440546.1_2 Reverse -368 -387 12.1925 0.28
NP_440546.1_4 Forward -326 -316 12.1791 0.0679
NP_440546.1_4 Reverse -317 -327 8.20381 0.199
NP_440868.1_4 Forward -330 -318 3.2839 0.137
NP_440374.1_3 Forward -233 -215 12.8934 0.272
NP_442039.1_4 Forward -325 -318 11.6422 0.0747
NP_442679.1_3 Forward -227 -209 2.28076 0.239
NP_442837.1_3 Forward -325 -318 6.0373 0.25
NP_442837.1_3 Reverse -318 -325 6.0373 0.25
NP_442053.1_1 Reverse -317 -326 14.4544 0.0114
NP_442053.1_1 Forward -326 -317 7.86621 0.0863
NP_440505.1_3 Forward -328 -318 6.46988 0.18
NP_440351.1_1 Forward -342 -323 1.37609 0.168
NP_441102.1_1 Reverse -357 -376 3.14605 0.298
NP_442844.1_2 Forward -220 -205 14.5717 0.229
NP_440914.1_1 Forward -326 -316 12.1284 0.0654
NP_440914.1_1 Reverse -317 -327 11.8356 0.0767
NP_441011.1_8 Reverse -318 -327 6.78456 0.184
NP_442533.1_6 Reverse -184 -193 7.57121 0.0898
NP_442533.1_6 Reverse -317 -326 4.42462 0.179
NP_442541.1_10 Reverse -183 -197 2.94893 0.254
NP_442541.1_10 Forward -192 -178 0.785655 0.298
NP_440854.1_5 Forward -223 -209 14.5264 0.274
NP_443016.1_1 Reverse -178 -197 -7.08038 0.267
NP_441482.1_7 Forward -332 -318 -5.21195 0.174
NP_442597.1_6 Forward -360 -341 15.2305 0.292
NP_441028.1_6 Forward -20 -10 5.38779 0.255
NP_441527.1_2 Forward -398 -379 6.4893 0.289
NP_440007.1_9 Forward -344 -330 2.45787 0.281
NP_441106.1_1 Forward -327 -318 8.75118 0.0469
NP_001035870.1_3 Reverse -306 -325 -6.09707 0.297
NP_441286.1_1 Forward -327 -315 -6.94252 0.288
NP_441809.1_7 Forward -83 -64 8.75091 0.2
NP_440670.1_8 Forward -326 -317 8.75118 0.0606
NP_440670.1_8 Reverse -317 -326 6.19458 0.124
NP_440886.1_7 Reverse -316 -326 6.66608 0.115
NP_440886.1_7 Reverse -102 -112 4.10949 0.253
NP_442382.1_7 Forward -384 -365 7.47261 0.229
NP_442022.1_4 Forward -205 -186 7.7676 0.268
NP_440907.2_8 Reverse -318 -328 14.1392 0.0325
NP_440907.2_8 Reverse -296 -306 3.8145 0.297
NP_440841.1_4 Forward -328 -309 -0.197208 0.131
NP_441463.1_3 Reverse -327 -346 -9.24366 0.278
NP_441463.1_6 Forward -348 -334 5.93276 0.287
NP_441626.1_2 Forward -325 -318 12.2322 0.0511
NP_441626.1_2 Reverse -318 -325 5.93897 0.231
NP_441460.1_5 Forward -28 -14 16.4202 0.204
NP_442794.1_1 Reverse -313 -325 8.39711 0.109
NP_442615.1_1 Reverse -308 -326 -3.02911 0.154
NP_442467.1_4 Reverse -43 -62 11.9958 0.149
NP_440855.1_1 Reverse -100 -119 -0.885524 0.266
NP_440114.1_10 Reverse -317 -331 10.1277 0.153
NP_441510.2_7 Reverse -282 -296 9.24208 0.292
NP_440766.1_5 Reverse -345 -357 8.32423 0.279
NP_441237.1_9 Forward -325 -315 11.6814 0.164
NP_440987.1_4 Forward -65 -46 10.6192 0.15
NP_440798.1_6 Reverse -318 -331 1.69091 0.205
NP_442680.1_5 Reverse -9 -28 3.49139 0.23
NP_441489.1_3 Reverse -345 -359 7.55548 0.261
NP_440554.1_4 Reverse -318 -328 5.87989 0.129
NP_441885.1_5 Forward -326 -316 9.51814 0.0206
NP_442341.1_9 Forward -328 -314 11.307 0.127
NP_441173.1_9 Forward -19 -11 9.75379 0.284
NP_440423.1_6 Forward -334 -315 -10.7186 0.159
NP_443000.1_7 Forward -328 -318 0.963343 0.278
NP_440275.1_3 Forward -328 -318 6.46988 0.105
NP_442354.1_2 Forward -308 -289 0.884433 0.299
NP_441397.1_8 Reverse -11 -24 15.245 0.156
NP_440216.1_1 Reverse -317 -331 -6.98191 0.145
NP_440216.1_9 Forward -190 -181 5.60459 0.292
NP_440172.1_1 Forward -326 -316 6.27322 0.107
NP_440172.1_1 Reverse -317 -327 4.79825 0.166
NP_441226.1_7 Forward -325 -318 12.7234 0.0312
NP_441226.1_7 Reverse -318 -325 11.5435 0.0757
NP_441111.1_7 Reverse -318 -326 8.86921 0.0589
NP_441766.1_2 Reverse -317 -326 14.7494 0.00772
NP_442417.1_5 Reverse -317 -331 7.27608 0.194
NP_442417.1_5 Reverse -103 -117 5.60446 0.255
NP_442116.1_6 Reverse -215 -232 12.7526 0.172
NP_442154.1_1 Forward -120 -102 -19.2537 0.294
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGTTGCAGTACAACCAAGACACAACCTATGACCAACCCGATAGTAGTTTTCTCAATCAATGGCGACGCAAATTAGGCGATCGGGAAATTCAACTGGTGGAATCCCGAGTTGGGGATTTGTTGTTGCAACGCGGCTATGAAGCCAGTGGACTGCCCACGATCCAGCTTACAAGTAGTCAAATAAAATCTCTTAAATTGCAGGATTGGTGGGCCCGGGCAAACTTTCGTTTACAGCGTTACGGGGCAGTCTTGTTTACTTTAAATTACATTACCAGTCGTTTACCACTTCGGGCGTGGCGGGACAGAATACAACTGAAAATCAACCAAATTGACTTGGAATATATCAAATAGATTTCGGTACTCTTACTGCAATTTCATTACTTTTTCCCCGCCCTAAGAGC

CDS

GTGTTTGAAAAGCCCCCCTGGTCCCCCAAGTTTGGGGGGAAACTAAATCAAAGTCCCCCAGTATTGGGGGATTTAGGGGGCAGAATCCGACTTTACAAACAGATTCTAAGCAACTTATTAAAAGGTATTCCATGTCTTCCGCTTTCTTCAACTATTTTGATGGCACATACATTATTAACCTAG

Protein

No sequence available