Your browser is old and dusty. Try Google Chrome!

Details for ssl5015

ORF ssl5015
Accession NP_942171.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Reverse -149 -168 9.24257 0.125
NP_440795.1_7 Forward -156 -149 14.6904 0.0123
NP_440795.1_7 Reverse -149 -156 14.6904 0.0123
NP_441418.1_6 Reverse -148 -167 7.66927 0.00575
NP_441453.1_1 Forward -164 -146 2.67334 0.288
NP_441453.1_4 Reverse -148 -156 16.539 0.00633
NP_441453.1_4 Forward -157 -149 16.539 0.00633
NP_441960.1_3 Reverse -266 -285 15.8971 0.183
NP_442151.1_6 Reverse -148 -162 17.5025 0.00997
NP_442151.1_6 Forward -157 -143 11.3077 0.104
NP_440226.1_1 Forward -157 -138 18.0924 0.0169
NP_440226.1_1 Reverse -148 -167 11.3075 0.0547
NP_440259.1_4 Forward -100 -86 11.3353 0.259
NP_442173.1_1 Forward -156 -148 15.4574 0.00633
NP_442173.1_1 Reverse -149 -157 15.4574 0.00633
NP_442752.1_4 Forward -157 -150 13.8055 0.0199
NP_442752.1_4 Reverse -148 -155 13.8055 0.0199
NP_443027.1_4 Forward -159 -149 16.2046 0.0437
NP_441812.1_3 Reverse -147 -161 11.0127 0.215
NP_442975.1_10 Forward -161 -147 13.077 0.0459
NP_442975.1_10 Reverse -144 -158 1.47397 0.297
NP_441675.1_4 Forward -388 -369 2.26107 0.294
NP_440784.1_7 Forward -156 -149 15.9687 0.0123
NP_440784.1_7 Reverse -149 -156 15.9687 0.0123
NP_440061.1_9 Forward -159 -145 7.96378 0.185
NP_440110.1_8 Reverse -146 -165 -1.18052 0.237
NP_440878.1_9 Forward -167 -148 -2.26216 0.258
NP_442062.1_8 Forward -157 -147 17.3846 0.00193
NP_442062.1_8 Reverse -148 -158 10.3048 0.0493
NP_440761.1_4 Reverse -143 -162 -13.7669 0.257
NP_440304.1_4 Forward -159 -149 19.9412 0.00364
NP_440304.1_4 Reverse -146 -156 1.84832 0.299
NP_442242.1_4 Forward -156 -149 14.3954 0.0124
NP_442242.1_4 Reverse -149 -156 14.3954 0.0124
NP_441208.1_9 Reverse -145 -159 7.27608 0.223
NP_442110.1_7 Reverse -148 -162 21.4357 0.013
NP_441083.1_5 Forward -157 -147 20.3345 0.00053
NP_441083.1_5 Reverse -148 -158 11.2881 0.0159
NP_441083.1_5 Reverse -229 -239 2.63497 0.193
NP_442841.1_5 Reverse -133 -152 19.6648 0.11
NP_441738.1_2 Forward -155 -148 15.28 0.0102
NP_441738.1_2 Reverse -150 -157 15.28 0.0102
NP_441558.1_5 Forward -159 -140 21.6323 0.00277
NP_441558.1_5 Reverse -146 -165 4.71934 0.271
NP_440209.1_1 Reverse -148 -156 18.1123 0.00295
NP_440209.1_1 Forward -157 -149 18.1123 0.00295
NP_442889.1_8 Forward -160 -146 10.0287 0.0916
NP_440447.1_1 Forward -162 -144 3.95239 0.242
NP_441713.1_1 Reverse -142 -161 -15.5368 0.265
NP_441713.1_1 Forward -163 -144 -15.7335 0.27
NP_440178.1_7 Reverse -147 -166 -22.6167 0.268
NP_442570.1_3 Forward -96 -77 -4.81876 0.235
NP_441716.1_1 Reverse -148 -162 3.63784 0.259
NP_442111.1_4 Reverse -147 -161 20.3541 0.00311
NP_442111.1_4 Forward -158 -144 6.58777 0.12
NP_440906.1_5 Forward -156 -149 15.8704 0.0124
NP_440906.1_5 Reverse -149 -156 15.8704 0.0124
NP_440747.1_10 Reverse -145 -157 14.887 0.00223
NP_440747.1_10 Forward -160 -148 7.80712 0.00223
NP_441486.1_1 Forward -160 -146 5.80112 0.0344
NP_441486.1_1 Reverse -145 -159 4.22782 0.0475
NP_442634.1_4 Reverse -146 -160 7.76774 0.0479
NP_440403.1_4 Reverse -155 -174 -8.16202 0.251
NP_442848.1_1 Forward -163 -149 -0.885388 0.263
NP_441012.1_4 Forward -161 -148 5.91914 0.286
NP_443018.1_3 Forward -156 -149 14.8871 0.0123
NP_443018.1_3 Reverse -149 -156 14.8871 0.0123
NP_440376.1_1 Forward -157 -148 19.4693 0.000692
NP_440376.1_1 Reverse -148 -157 19.4693 0.000692
NP_440376.1_1 Reverse -141 -150 0.589713 0.267
NP_441588.1_4 Forward -155 -145 15.9097 0.0369
NP_442687.1_7 Forward -158 -148 9.02648 0.0994
NP_442687.1_7 Reverse -147 -157 8.92815 0.0994
NP_442191.1_4 Reverse -149 -163 15.9379 0.0454
NP_440642.1_8 Forward -155 -136 14.681 0.188
NP_442658.1_1 Forward -159 -149 13.0576 0.04
NP_442658.1_1 Reverse -146 -156 6.76441 0.214
NP_442782.1_2 Reverse -148 -162 8.25939 0.198
NP_441414.1_9 Forward -157 -138 3.83436 0.0572
NP_442937.1_5 Forward -243 -224 8.25926 0.229
NP_441958.1_5 Forward -158 -148 21.2195 0.000805
NP_441958.1_5 Reverse -147 -157 12.2714 0.00183
NP_440203.1_5 Reverse -151 -161 14.9258 0.0886
NP_443001.1_7 Reverse -149 -168 2.75272 0.279
NP_440984.1_7 Reverse -143 -157 11.406 0.122
NP_439990.1_5 Forward -162 -149 8.08242 0.181
NP_442911.1_2 Forward -167 -148 -3.44213 0.112
NP_442911.1_2 Reverse -138 -157 -4.03212 0.124
NP_442911.1_2 Forward -28 -9 -5.80207 0.167
NP_441580.1_6 Forward -168 -149 -0.0988766 0.153
NP_440153.1_5 Reverse -149 -163 11.701 0.0763
NP_442064.1_1 Reverse -143 -162 -5.01543 0.209
NP_440993.1_2 Forward -162 -146 10.0883 0.106
NP_442210.1_9 Reverse -144 -162 19.3903 0.11
NP_440138.1_6 Forward -162 -143 0.981987 0.291
NP_441294.1_7 Forward -154 -140 10.2105 0.205
NP_440411.1_10 Reverse -146 -165 12.1159 0.26
NP_442438.1_10 Forward -162 -148 9.73436 0.0602
NP_442438.1_10 Reverse -143 -157 3.04785 0.166
NP_442431.1_10 Forward -244 -226 1.49411 0.253
NP_440147.1_4 Reverse -146 -159 10.7374 0.0355
NP_440147.1_4 Forward -159 -146 3.75586 0.181
NP_441550.1_8 Reverse -146 -156 14.6309 0.0132
NP_441550.1_8 Forward -159 -149 13.0576 0.0273
NP_441916.1_7 Reverse -148 -158 18.9579 0.00144
NP_441916.1_7 Forward -157 -147 10.3048 0.0261
NP_441916.1_10 Forward -165 -146 7.7676 0.184
NP_441041.1_4 Reverse -148 -167 -0.885524 0.0986
NP_441041.1_7 Forward -160 -148 6.34865 0.211
NP_442396.1_5 Reverse -144 -157 20.1771 0.00762
NP_442004.1_6 Reverse -148 -162 6.58777 0.171
NP_440703.1_9 Forward -163 -150 9.36014 0.216
NP_441725.1_4 Forward -162 -148 4.03056 0.278
NP_441725.1_5 Reverse -149 -159 11.1898 0.0247
NP_441725.1_5 Forward -156 -146 2.04498 0.115
NP_439966.1_7 Forward -159 -149 14.8275 0.0177
NP_439966.1_7 Reverse -146 -156 7.25606 0.15
NP_442941.1_3 Reverse -149 -159 19.9412 0.00262
NP_442941.1_3 Forward -156 -146 11.0914 0.0116
NP_440289.1_2 Forward -160 -147 3.85419 0.0735
NP_440983.1_5 Reverse -119 -138 4.916 0.179
NP_440260.1_8 Reverse -139 -157 1.98577 0.182
NP_442281.1_1 Forward -162 -148 16.9119 0.00698
NP_442281.1_1 Reverse -198 -212 5.21053 0.166
NP_441334.1_7 Reverse -146 -165 -20.8467 0.281
NP_440437.1_1 Forward -163 -144 -0.983855 0.192
NP_441556.1_10 Reverse -142 -156 11.2925 0.231
NP_440498.1_1 Forward -166 -148 1.49411 0.204
NP_440498.1_1 Reverse -139 -157 0.117479 0.218
NP_442982.1_5 Forward -167 -148 7.66927 0.121
NP_441644.1_6 Reverse -148 -158 19.0557 0.000803
NP_441644.1_6 Forward -157 -147 17.3841 0.00127
NP_442215.1_2 Reverse -146 -162 16.2831 0.0155
NP_442215.1_2 Forward -172 -156 4.58176 0.0832
NP_442215.1_2 Forward -159 -143 -3.28472 0.213
NP_442029.1_6 Reverse -143 -162 22.9106 0.0104
NP_440929.1_8 Forward -157 -148 19.2726 0.000701
NP_440929.1_8 Reverse -148 -157 19.2726 0.000701
NP_442933.1_10 Forward -157 -148 17.601 0.00325
NP_442933.1_10 Reverse -148 -157 17.601 0.00325
NP_440430.1_4 Forward -167 -148 13.0766 0.276
NP_441751.2_8 Reverse -149 -163 -0.885388 0.129
NP_442554.1_8 Reverse -149 -159 16.9913 0.0065
NP_442554.1_8 Forward -156 -146 15.3197 0.00882
NP_442970.1_1 Forward -234 -220 10.0383 0.269
NP_441762.1_7 Forward -158 -146 0.530633 0.0747
NP_441762.1_7 Reverse -147 -159 -6.94252 0.284
NP_442313.1_5 Forward -93 -74 3.93269 0.279
NP_442142.1_4 Forward -160 -147 14.8666 0.0302
NP_442142.1_4 Reverse -145 -158 3.55864 0.251
NP_442292.1_1 Forward -156 -147 18.486 0.00229
NP_442292.1_1 Reverse -149 -158 17.5026 0.00435
NP_442292.1_1 Forward -34 -25 2.16301 0.227
NP_442476.1_6 Forward -156 -142 11.0127 0.0601
NP_443009.1_5 Reverse -147 -158 14.5128 0.02
NP_443009.1_5 Forward -158 -147 10.1862 0.0792
NP_442408.2_1 Reverse -148 -167 -5.70374 0.276
NP_441715.1_4 Reverse -149 -159 14.238 0.0295
NP_441715.1_4 Forward -156 -146 7.94484 0.107
NP_441198.1_8 Forward -159 -149 13.2713 0.108
NP_440464.1_10 Forward -156 -146 13.0082 0.169
NP_441468.1_1 Forward -156 -149 15.8704 0.0124
NP_441468.1_1 Reverse -149 -156 15.8704 0.0124
NP_441020.2_6 Reverse -146 -163 10.1669 0.151
NP_441015.1_10 Forward -162 -143 -0.590531 0.169
NP_441673.1_1 Forward -157 -148 20.8459 0.000698
NP_441673.1_1 Reverse -148 -157 20.8459 0.000698
NP_441826.1_2 Forward -163 -149 14.3559 0.02
NP_441826.1_2 Reverse -142 -156 -3.04867 0.282
NP_441330.1_1 Forward -162 -143 -13.1769 0.183
NP_441330.1_1 Reverse -74 -93 -14.9469 0.253
NP_441637.1_9 Forward -103 -85 -4.01242 0.296
NP_441764.1_6 Forward -264 -253 16.185 0.284
NP_442868.1_6 Reverse -146 -156 9.81313 0.038
NP_442868.1_6 Forward -159 -149 1.06167 0.205
NP_442719.1_2 Forward -103 -85 -2.34152 0.186
NP_442719.1_2 Forward -341 -323 -11.8796 0.297
NP_441056.1_1 Reverse -148 -167 -6.1954 0.268
NP_441612.1_2 Forward -157 -147 8.54929 0.21
NP_442361.1_3 Forward -163 -150 15.4572 0.0906
NP_442808.1_1 Forward -158 -148 8.73102 0.0481
NP_442808.1_1 Reverse -147 -157 8.63269 0.0481
NP_440145.1_3 Reverse -138 -157 -0.39387 0.14
NP_442050.1_5 Forward -159 -149 18.0724 0.00365
NP_442050.1_5 Reverse -146 -156 7.64939 0.243
NP_442903.1_2 Forward -385 -366 5.49036 0.196
NP_441878.1_6 Forward -158 -148 10.5014 0.0176
NP_441878.1_6 Reverse -147 -157 10.4031 0.0176
NP_441878.1_6 Reverse -160 -170 -7.29646 0.217
NP_441036.1_8 Forward -158 -148 15.713 0.00724
NP_441036.1_8 Reverse -147 -157 8.33817 0.174
NP_441557.1_5 Forward -157 -148 19.9609 0.000699
NP_441557.1_5 Reverse -148 -157 19.9609 0.000699
NP_441445.1_1 Reverse -155 -174 6.98095 0.138
NP_442066.2_4 Forward -150 -131 -7.67036 0.286
NP_441308.1_8 Forward -159 -149 13.353 0.218
NP_440101.1_3 Reverse -143 -162 2.0644 0.259
NP_442183.1_1 Reverse -148 -162 9.04604 0.103
NP_441549.1_9 Reverse -144 -162 -4.50408 0.198
NP_442347.1_2 Forward -156 -147 12.4878 0.056
NP_442347.1_2 Reverse -149 -158 3.34298 0.284
NP_442645.1_2 Reverse -140 -159 -22.0267 0.29
NP_441037.1_4 Reverse -146 -156 7.9999 0.237
NP_441037.1_4 Forward -159 -149 7.31769 0.237
NP_442317.1_2 Reverse -86 -105 9.3409 0.204
NP_441633.1_3 Reverse -146 -159 1.00259 0.11
NP_440136.1_2 Forward -156 -149 15.9687 0.0123
NP_440136.1_2 Reverse -149 -156 15.9687 0.0123
NP_442590.1_10 Reverse -148 -167 15.9291 0.113
NP_442998.1_5 Forward -128 -118 8.23984 0.267
NP_442998.1_10 Forward -155 -148 15.5754 0.0102
NP_442998.1_10 Reverse -150 -157 15.5754 0.0102
NP_440899.1_2 Forward -168 -149 7.07848 0.242
NP_440299.1_1 Reverse -144 -157 18.9965 0.00298
NP_440299.1_1 Forward -161 -148 13.195 0.0319
NP_441799.1_1 Reverse -144 -158 15.8302 0.0163
NP_441799.1_1 Forward -161 -147 6.48882 0.17
NP_441007.1_10 Forward -162 -149 1.39592 0.203
NP_441007.1_10 Reverse -143 -156 -0.865694 0.295
NP_442333.2_5 Forward -168 -149 5.211 0.146
NP_440256.1_1 Reverse -145 -164 10.3242 0.0186
NP_440256.1_1 Forward -160 -141 -0.000545616 0.0884
NP_440256.1_1 Reverse -50 -69 -7.96535 0.248
NP_440456.1_7 Forward -338 -324 13.1759 0.281
NP_441559.1_8 Forward -162 -148 1.17956 0.156
NP_441559.1_8 Forward -99 -85 -5.11362 0.248
NP_440915.1_6 Reverse -144 -158 9.73436 0.039
NP_440915.1_6 Forward -161 -147 3.8345 0.1
NP_442158.1_4 Reverse -180 -190 13.5497 0.231
NP_442785.1_7 Forward -159 -145 10.4227 0.228
NP_441704.1_8 Forward -168 -149 12.4867 0.122
NP_442866.1_1 Reverse -143 -162 3.04771 0.151
NP_441494.1_6 Forward -162 -149 6.1158 0.289
NP_442993.1_1 Reverse -154 -170 -9.77456 0.194
NP_442386.1_9 Reverse -147 -156 13.8639 0.0289
NP_442386.1_9 Forward -164 -155 7.2758 0.219
NP_442386.1_9 Forward -158 -149 6.39082 0.219
NP_441340.1_5 Forward -156 -149 15.6737 0.0124
NP_441340.1_5 Reverse -149 -156 15.6737 0.0124
NP_442484.1_2 Forward -168 -149 4.81767 0.182
NP_442484.1_2 Reverse -137 -156 2.16274 0.226
NP_440327.1_6 Reverse -137 -156 4.42435 0.274
NP_442240.1_2 Reverse -149 -168 -13.0786 0.163
NP_440586.1_8 Forward -156 -149 13.2151 0.026
NP_440586.1_8 Reverse -149 -156 13.2151 0.026
NP_442251.1_6 Forward -156 -149 15.2804 0.0124
NP_442251.1_6 Reverse -149 -156 15.2804 0.0124
NP_440192.1_4 Forward -319 -300 8.71846 0.29
NP_441262.1_3 Reverse -148 -155 14.7888 0.0223
NP_441262.1_3 Forward -157 -150 14.7888 0.0223
NP_440027.1_3 Forward -167 -149 4.63995 0.255
NP_443051.1_1 Forward -158 -149 19.5676 0.00335
NP_443051.1_1 Reverse -147 -156 10.4228 0.00754
NP_439937.1_9 Reverse -321 -338 -12.0565 0.269
NP_439937.1_9 Forward -174 -157 -15.5964 0.287
NP_440408.1_7 Reverse -148 -167 12.3892 0.21
NP_440439.1_1 Forward -160 -147 9.06573 0.0475
NP_439943.1_1 Forward -94 -75 -10.6203 0.29
NP_440372.1_2 Forward -156 -149 16.3621 0.0124
NP_440372.1_2 Reverse -149 -156 16.3621 0.0124
NP_441803.1_2 Forward -162 -143 5.01433 0.171
NP_439977.1_5 Reverse -142 -161 -0.000545616 0.217
NP_440139.1_1 Reverse -142 -161 0.883656 0.279
NP_441572.1_7 Forward -163 -144 6.4893 0.0801
NP_440267.1_2 Forward -162 -148 8.65209 0.162
NP_442384.1_10 Forward -157 -144 16.7355 0.00732
NP_442384.1_10 Reverse -148 -161 15.4572 0.00986
NP_442384.1_10 Reverse -161 -174 1.69091 0.249
NP_442384.1_10 Forward -170 -157 0.805932 0.278
NP_440221.1_8 Forward -93 -74 17.404 0.0747
NP_441877.1_5 Reverse -358 -377 0.294447 0.276
NP_442572.1_10 Forward -363 -344 16.4673 0.248
NP_441018.1_7 Reverse -144 -163 8.65258 0.241
NP_442262.1_10 Forward -156 -149 14.1988 0.0123
NP_442262.1_10 Reverse -149 -156 14.1988 0.0123
NP_441689.1_5 Forward -159 -149 17.8758 0.0158
NP_441689.1_5 Reverse -146 -156 5.78111 0.197
NP_440344.1_10 Forward -164 -147 -6.94266 0.115
NP_440282.1_3 Forward -168 -149 -0.885524 0.298
NP_440282.1_10 Forward -167 -148 -4.6221 0.25
NP_440282.1_10 Forward -174 -155 -10.1286 0.294
NP_440531.1_6 Forward -165 -146 2.75272 0.151
NP_440562.1_2 Reverse -357 -374 18.1317 0.187
NP_440297.1_9 Reverse -149 -159 9.22315 0.0917
NP_440297.1_9 Forward -156 -146 -0.118297 0.282
NP_442280.1_10 Forward -98 -80 17.3373 0.0964
NP_440999.1_9 Forward -161 -147 3.44117 0.13
NP_440888.1_2 Reverse -148 -162 16.6169 0.00609
NP_440888.1_2 Forward -157 -143 12.5853 0.0424
NP_440600.1_4 Forward -165 -147 -6.96235 0.291
NP_441543.1_2 Forward -156 -147 16.9127 0.00359
NP_441543.1_2 Reverse -149 -158 15.9293 0.00518
NP_442845.1_2 Reverse -142 -156 14.5526 0.0796
NP_442845.1_2 Reverse -148 -162 7.37441 0.195
NP_442845.1_2 Forward -163 -149 5.89945 0.22
NP_441469.1_8 Forward -158 -149 6.5879 0.227
NP_441469.1_8 Reverse -147 -156 6.48957 0.227
NP_443064.1_6 Forward -157 -147 12.5669 0.0796
NP_443064.1_6 Reverse -148 -158 10.8217 0.13
NP_442578.1_7 Forward -156 -149 14.5921 0.026
NP_442578.1_7 Reverse -149 -156 14.5921 0.026
NP_440710.1_1 Forward -165 -147 -3.22577 0.208
NP_441462.1_2 Reverse -148 -158 20.2362 0.000805
NP_441462.1_2 Forward -157 -147 11.5831 0.00406
NP_441621.1_7 Reverse -146 -160 -5.31028 0.25
NP_440519.1_3 Forward -352 -333 15.3391 0.123
NP_442204.1_1 Forward -161 -150 19.2332 0.0136
NP_442204.1_2 Forward -167 -148 5.99764 0.292
NP_440516.1_8 Forward -157 -148 16.9127 0.00442
NP_440516.1_8 Reverse -148 -157 16.9127 0.00442
NP_442428.1_5 Forward -156 -149 15.8704 0.0124
NP_442428.1_5 Reverse -149 -156 15.8704 0.0124
NP_440673.1_3 Forward -155 -148 12.4288 0.0426
NP_440673.1_3 Reverse -150 -157 12.4288 0.0426
NP_441052.1_2 Forward -157 -147 19.9412 0.00106
NP_441052.1_2 Reverse -148 -158 10.4031 0.0285
NP_442219.1_9 Forward -156 -147 17.7976 0.00718
NP_442219.1_9 Reverse -149 -158 8.25953 0.0681
NP_440436.1_4 Forward -156 -147 17.2072 0.00233
NP_440436.1_4 Reverse -149 -158 9.24241 0.0871
NP_442864.1_3 Reverse -142 -161 11.7008 0.181
NP_440314.1_9 Forward -156 -137 0.392778 0.0952
NP_442907.1_9 Forward -162 -143 8.84924 0.115
NP_441719.1_2 Reverse -145 -159 16.4239 0.191
NP_441719.1_4 Forward -156 -149 16.3621 0.0124
NP_441719.1_4 Reverse -149 -156 16.3621 0.0124
NP_441719.1_6 Reverse -225 -244 4.71854 0.297
NP_441004.1_1 Reverse -155 -174 -12.7836 0.251
NP_441004.1_1 Reverse -142 -161 -15.3402 0.275
NP_441004.1_3 Forward -244 -225 2.0644 0.275
NP_442366.1_5 Reverse -145 -155 15.4175 0.0374
NP_441115.1_4 Forward -158 -140 14.6697 0.0525
NP_442206.1_10 Reverse -148 -163 3.81481 0.181
NP_443054.1_2 Forward -159 -145 1.57289 0.245
NP_441851.1_10 Reverse -147 -157 15.8113 0.00552
NP_441851.1_10 Forward -158 -148 8.53483 0.114
NP_442515.1_1 Forward -158 -144 -4.32697 0.298
NP_442515.1_1 Reverse -147 -161 -4.91696 0.298
NP_441349.1_10 Reverse -138 -157 1.47442 0.0833
NP_440432.1_9 Reverse -149 -164 -3.36336 0.179
NP_441124.1_5 Reverse -245 -255 11.4803 0.254
NP_440431.1_3 Forward -158 -139 -4.03212 0.178
NP_442450.1_5 Forward -159 -149 9.41981 0.115
NP_442450.1_5 Reverse -146 -156 7.55152 0.13
NP_442243.1_1 Forward -163 -145 11.9164 0.112
NP_441570.1_1 Reverse -148 -166 9.95058 0.00991
NP_441570.1_1 Forward -157 -139 -17.2871 0.269
NP_441078.1_4 Forward -157 -148 19.6659 0.0007
NP_441078.1_4 Reverse -148 -157 19.6659 0.0007
NP_442348.1_2 Forward -206 -197 7.07956 0.291
NP_440526.1_3 Forward -156 -145 1.04151 0.267
NP_441432.1_8 Reverse -147 -156 16.8143 0.00595
NP_441432.1_8 Forward -158 -149 16.8143 0.00595
NP_442320.1_8 Reverse -142 -156 5.01447 0.0442
NP_442320.1_8 Forward -163 -149 -4.13031 0.148
NP_442344.1_7 Forward -156 -137 -5.50708 0.168
NP_441732.1_2 Forward -161 -145 11.5633 0.00662
NP_440760.1_1 Forward -157 -138 -21.535 0.238
NP_442797.1_7 Forward -158 -140 -0.374176 0.282
NP_440913.1_1 Reverse -146 -164 9.85225 0.176
NP_440713.1_4 Forward -167 -148 5.50599 0.208
NP_442489.1_7 Forward -157 -148 20.1576 0.000695
NP_442489.1_7 Reverse -148 -157 20.1576 0.000695
NP_440559.1_1 Forward -156 -147 17.4043 0.00658
NP_440559.1_1 Reverse -149 -158 8.65285 0.0586
NP_440559.1_1 Forward -180 -171 7.17789 0.11
NP_441659.2_8 Reverse -148 -158 20.9245 0.000805
NP_441659.2_8 Forward -157 -147 18.1713 0.00133
NP_442913.1_10 Reverse -139 -158 -4.52377 0.24
NP_441040.1_2 Reverse -146 -165 -16.2252 0.294
NP_440335.1_9 Forward -68 -50 10.1472 0.28
NP_442776.1_1 Forward -168 -149 7.27595 0.209
NP_442346.1_5 Reverse -147 -157 16.6963 0.00248
NP_442346.1_5 Forward -158 -148 16.303 0.00248
NP_440545.1_3 Reverse -144 -161 12.9202 0.0193
NP_440025.1_4 Reverse -315 -334 13.4708 0.222
NP_440250.1_4 Forward -258 -239 1.6703 0.297
NP_440459.1_2 Forward -159 -142 11.2486 0.18
NP_442603.1_7 Reverse -148 -162 11.5037 0.115
NP_441833.1_4 Forward -156 -149 15.9687 0.0124
NP_441833.1_4 Reverse -149 -156 15.9687 0.0124
NP_441329.1_6 Forward -27 -8 3.29405 0.216
NP_441329.1_6 Forward -389 -370 0.333799 0.258
NP_442162.1_9 Forward -156 -149 16.2637 0.0124
NP_442162.1_9 Reverse -149 -156 16.2637 0.0124
NP_440671.1_4 Forward -163 -149 17.6992 0.0185
NP_440224.1_1 Reverse -137 -156 2.16274 0.132
NP_440224.1_1 Forward -168 -149 -0.787193 0.149
NP_442140.1_3 Forward -156 -146 12.2714 0.0632
NP_442021.1_3 Reverse -142 -161 1.17943 0.191
NP_440875.1_9 Reverse -150 -160 8.27469 0.233
NP_441813.1_5 Forward -159 -149 15.9097 0.01
NP_441813.1_5 Reverse -146 -156 8.63316 0.0367
NP_440590.1_4 Forward -156 -143 7.78743 0.0494
NP_440590.1_4 Reverse -149 -162 -4.20895 0.258
NP_440567.1_1 Forward -156 -142 16.4209 0.0166
NP_440567.1_1 Reverse -149 -163 5.50613 0.102
NP_442497.1_10 Reverse -149 -158 17.601 0.00813
NP_442497.1_10 Forward -156 -147 10.4228 0.0087
NP_440821.1_4 Forward -159 -149 11.0914 0.0146
NP_440821.1_4 Reverse -146 -156 9.41981 0.0286
NP_441239.1_9 Forward -159 -147 12.1337 0.0494
NP_441239.1_9 Reverse -146 -158 3.38223 0.285
NP_441951.1_4 Reverse -148 -167 5.40766 0.273
NP_441892.1_1 Forward -166 -149 10.3636 0.0642
NP_442044.1_9 Reverse -148 -167 4.916 0.224
NP_442643.1_1 Reverse -142 -161 -0.688862 0.143
NP_441541.1_5 Forward -66 -47 14.6508 0.265
NP_441526.1_3 Reverse -331 -350 17.4032 0.183
NP_441782.1_10 Forward -139 -125 17.2194 0.126
NP_440546.1_4 Reverse -148 -158 13.5365 0.0459
NP_440546.1_4 Forward -157 -147 10.046 0.109
NP_440675.1_1 Reverse -145 -164 7.57094 0.195
NP_440462.1_6 Forward -159 -149 16.893 0.00853
NP_440462.1_6 Reverse -146 -156 1.35667 0.294
NP_442899.1_4 Forward -66 -50 6.2527 0.259
NP_442144.1_1 Reverse -145 -161 16.6765 0.152
NP_440868.1_4 Forward -161 -149 6.1355 0.0878
NP_440868.1_4 Reverse -144 -156 6.1355 0.0878
NP_441474.1_1 Forward -167 -148 -0.0996487 0.255
NP_442402.1_4 Forward -232 -213 -4.81951 0.231
NP_441084.1_6 Forward -159 -145 16.8098 0.0523
NP_440696.1_3 Reverse -144 -162 -3.81576 0.29
NP_442039.1_4 Forward -156 -149 15.1821 0.0124
NP_442039.1_4 Reverse -149 -156 15.1821 0.0124
NP_442039.1_7 Reverse -291 -301 8.04317 0.267
NP_442679.1_1 Forward -335 -316 -5.40875 0.293
NP_440825.1_7 Forward -156 -146 12.9096 0.152
NP_442837.1_3 Forward -156 -149 15.7721 0.0124
NP_442837.1_3 Reverse -149 -156 15.7721 0.0124
NP_442053.1_1 Forward -157 -148 18.3876 0.0007
NP_442053.1_1 Reverse -148 -157 18.3876 0.0007
NP_440505.1_3 Forward -159 -149 15.123 0.014
NP_440505.1_3 Reverse -146 -156 9.22315 0.122
NP_441102.1_1 Reverse -149 -168 9.83255 0.154
NP_441203.1_1 Reverse -149 -168 -3.63879 0.0702
NP_441408.2_7 Reverse -77 -96 -2.45882 0.269
NP_440914.1_1 Forward -157 -147 17.5935 0.000537
NP_440914.1_1 Reverse -148 -158 16.3248 0.00196
NP_441011.1_8 Reverse -149 -158 16.6177 0.00602
NP_441011.1_8 Forward -156 -147 8.25953 0.144
NP_442101.1_10 Reverse -140 -159 -5.9004 0.178
NP_442533.1_6 Forward -157 -148 17.2076 0.00137
NP_442533.1_6 Reverse -148 -157 17.2076 0.00137
NP_441482.1_7 Forward -163 -149 17.6992 0.00499
NP_439944.1_9 Reverse -149 -159 17.6796 0.00347
NP_439944.1_9 Forward -156 -146 10.5014 0.0887
NP_439944.1_9 Reverse -27 -37 7.25653 0.149
NP_440116.1_5 Reverse -145 -162 7.31533 0.155
NP_440116.1_8 Forward -156 -137 15.4374 0.0186
NP_440116.1_8 Reverse -149 -168 -3.73712 0.158
NP_441527.1_4 Forward -332 -313 -6.35064 0.217
NP_441527.1_5 Forward -159 -140 13.3767 0.297
NP_440115.1_6 Forward -160 -150 7.45319 0.147
NP_440007.1_9 Forward -161 -147 11.996 0.163
NP_441170.1_4 Reverse -139 -157 2.77242 0.283
NP_441972.1_5 Forward -156 -137 -3.3438 0.199
NP_441972.1_5 Reverse -149 -168 -9.047 0.278
NP_441106.1_1 Forward -158 -149 18.486 0.0028
NP_441106.1_1 Reverse -147 -156 9.63616 0.0311
NP_439903.1_6 Reverse -145 -164 -0.591301 0.283
NP_441186.1_4 Forward -285 -275 15.5158 0.235
NP_441286.1_1 Reverse -147 -159 14.3953 0.00424
NP_441286.1_1 Forward -158 -146 3.48056 0.0467
NP_442674.1_3 Forward -165 -146 3.34192 0.294
NP_440670.1_8 Forward -157 -148 18.3876 0.000699
NP_440670.1_8 Reverse -148 -157 18.3876 0.000699
NP_440886.1_7 Forward -158 -148 8.04271 0.0805
NP_440886.1_7 Reverse -147 -157 7.94438 0.0805
NP_442614.1_2 Forward -157 -143 6.19444 0.291
NP_442382.1_7 Forward -170 -151 7.57094 0.229
NP_442072.1_9 Reverse -147 -165 -4.79907 0.0516
NP_442072.1_9 Forward -158 -140 -20.4337 0.204
NP_442072.1_9 Forward -151 -133 -22.4003 0.234
NP_442072.1_9 Reverse -140 -158 -23.2853 0.288
NP_440907.2_8 Reverse -149 -159 9.51767 0.103
NP_440907.2_8 Forward -156 -146 7.64939 0.117
NP_440326.1_5 Reverse -146 -159 15.2606 0.179
NP_440841.1_4 Forward -159 -140 -9.93197 0.267
NP_441463.1_3 Reverse -138 -157 -10.4236 0.294
NP_441463.1_6 Forward -159 -145 6.99573 0.265
NP_442842.1_4 Reverse -149 -168 3.14605 0.265
NP_441626.1_2 Forward -156 -149 15.7721 0.0124
NP_441626.1_2 Reverse -149 -156 15.7721 0.0124
NP_442912.1_3 Reverse -203 -222 22.0247 0.0273
NP_440107.1_5 Reverse -147 -166 -0.688862 0.178
NP_442794.1_1 Forward -161 -149 10.2654 0.0721
NP_442794.1_1 Reverse -144 -156 9.38042 0.0795
NP_441401.1_5 Reverse -330 -349 16.281 0.264
NP_442615.1_1 Reverse -139 -157 23.5203 0.00231
NP_440387.1_1 Forward -157 -141 7.04003 0.0282
NP_440387.1_1 Reverse -148 -164 5.07341 0.0353
NP_441431.1_2 Forward -160 -146 7.66879 0.237
NP_442020.1_1 Reverse -298 -317 -1.37794 0.291
NP_441993.1_1 Reverse -148 -167 2.72635 0.254
NP_442698.1_10 Reverse -82 -101 -1.57384 0.3
NP_440287.1_6 Reverse -139 -158 5.40766 0.182
NP_440293.1_3 Reverse -152 -171 -6.58872 0.291
NP_440766.1_4 Forward -161 -147 6.98109 0.097
NP_440766.1_4 Forward -216 -202 2.2612 0.191
NP_440766.1_5 Forward -337 -325 6.79636 0.292
NP_441237.1_9 Forward -156 -146 14.828 0.0242
NP_440457.1_1 Forward -161 -149 8.39711 0.101
NP_440457.1_1 Forward -216 -204 5.25052 0.142
NP_440457.1_1 Reverse -144 -156 0.825626 0.25
NP_440798.1_6 Forward -156 -143 5.91914 0.14
NP_440798.1_6 Reverse -149 -162 1.9859 0.188
NP_441801.1_4 Forward -166 -156 2.7333 0.262
NP_440473.1_1 Forward -160 -141 12.8963 0.213
NP_442509.1_9 Forward -157 -147 8.14104 0.192
NP_442509.1_9 Reverse -148 -158 8.04271 0.192
NP_441496.1_1 Reverse -319 -333 16.5317 0.265
NP_440554.1_4 Reverse -149 -159 16.1063 0.0189
NP_442737.1_5 Reverse -147 -166 13.0729 0.248
NP_441885.1_5 Forward -157 -147 20.9245 0.000538
NP_441885.1_5 Reverse -148 -158 11.3864 0.00668
NP_442341.1_7 Reverse -147 -161 8.55439 0.0864
NP_442341.1_9 Forward -159 -145 9.24208 0.155
NP_442341.1_9 Reverse -146 -160 8.25877 0.174
NP_441173.1_9 Reverse -225 -233 9.75379 0.284
NP_443000.1_7 Forward -159 -149 17.4829 0.00719
NP_443000.1_7 Reverse -146 -156 10.3048 0.0345
NP_441842.1_10 Reverse -141 -155 9.43936 0.192
NP_440275.1_3 Forward -159 -149 9.12481 0.055
NP_440275.1_3 Reverse -146 -156 8.04317 0.0602
NP_440275.1_7 Reverse -74 -92 19.882 0.13
NP_440091.1_1 Reverse -144 -156 1.41561 0.197
NP_441902.1_3 Forward -337 -327 15.4111 0.201
NP_440149.1_8 Reverse -148 -167 15.2408 0.023
NP_441105.1_3 Reverse -137 -156 -5.40875 0.219
NP_440216.1_1 Forward -157 -143 8.35772 0.0061
NP_440216.1_1 Reverse -148 -162 7.27608 0.00942
NP_440172.1_1 Reverse -148 -158 17.5813 0.00421
NP_440172.1_1 Forward -157 -147 15.0247 0.00945
NP_442015.1_10 Forward -161 -148 11.229 0.0372
NP_442015.1_10 Reverse -144 -157 1.49425 0.204
NP_441226.1_7 Forward -156 -149 14.4934 0.0123
NP_441226.1_7 Reverse -149 -156 14.4934 0.0123
NP_442834.1_9 Reverse -152 -171 3.6377 0.298
NP_441757.1_3 Reverse -147 -166 8.84924 0.104
NP_441111.1_7 Forward -156 -148 18.7023 0.00294
NP_441111.1_7 Reverse -149 -157 18.7023 0.00294
NP_441766.1_2 Forward -157 -148 17.5026 0.00297
NP_441766.1_2 Reverse -148 -157 17.5026 0.00297
NP_442417.1_5 Reverse -148 -162 17.0108 0.0349
NP_442179.1_3 Forward -156 -137 11.6025 0.163
NP_440416.1_9 Reverse -141 -160 -20.7484 0.288
NP_442116.1_2 Forward -267 -248 11.3067 0.289
NP_440885.1_6 Reverse -294 -313 6.43804 0.248
NP_440261.1_5 Reverse -149 -162 -1.16069 0.0662
NP_440261.1_5 Forward -156 -143 -10.4038 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGTTGTCTTATTAAAAAGCTGAGCAAGAATCGAAACATTTACCTGTTCAGATTCCGGTAAGCTTTGGGAAGAAATACCAGAGGAACCATTTTGTGTGAAGTTTCCCAAGTAGAAGTTAACAAAGCTACTAGCTGCATCAGGATCAAGATTTTGTAAAGCTGTGGTGATTTGGTGAATAGTTTCACCAGTAGGATCGGTCTTTTCGTGAAACCAACGAAATACAATCGGACGGTCAACACCCAAGGCGATCGCCAAACGACTCTGGCTGATGTTGTGTAGATCTAAAGTCTGTTTTAATGCTTGTCCTGCTTTTCCCATGACTTGATTATCACAGAAAAATCAAGCGTCAGTGTTATCATATATGATAACATCGCATAACTACTGAGAGCACTAAGCAATT

CDS

ATGAGTGATTTCCCAAAAGACTGGGCAATGTACGAACCCGATGGTGATTTTGCGGTTTCAGAAATGATGCGTGAAGTTAAAGCAGCTCTGAAAAATATGCCTTTGCCTGAAGTACGGACGCTGTTAAAAGCAAAAATTGAACTTGTAGGCATAAGTCATGGTGAAATTTATGATTCGGAAGTACGTAATAAAATCGAGAGTTATTTGACTTCTTGGGCTTGTGAAGTGCATGAACTTAATGATACTTGGAACACCTTATCTCGTTCTTATTGGAGCCTGTAA

Protein

No sequence available