Your browser is old and dusty. Try Google Chrome!

Details for slr8044

ORF slr8044
Accession NP_942438.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442100.1_4 Forward -109 -90 9.63507 0.278
NP_441418.1_1 Reverse -344 -363 10.074 0.205
NP_441480.1_1 Forward -115 -96 -0.787193 0.287
NP_440897.1_6 Reverse -223 -242 3.9319 0.14
NP_442151.1_1 Reverse -60 -79 4.42435 0.287
NP_440226.1_9 Reverse -166 -185 12.1925 0.215
NP_441098.1_3 Reverse -186 -205 -6.50185 0.28
NP_440996.1_1 Reverse -174 -193 18.6308 0.0234
NP_440996.1_2 Reverse -130 -139 14.8477 0.248
NP_441812.1_4 Reverse -233 -251 11.9172 0.253
NP_441470.1_4 Reverse -303 -322 27.5321 0.0000116
NP_441470.1_5 Reverse -365 -384 29.2979 0.00000912
NP_441470.1_6 Reverse -160 -179 28.2204 0.0000759
NP_441470.1_7 Reverse -259 -278 27.2371 0.000139
NP_442861.1_4 Forward -376 -357 -1.77127 0.297
NP_442972.1_2 Reverse -148 -162 15.5352 0.136
NP_442268.1_3 Forward -237 -218 12.9783 0.284
NP_441492.1_1 Reverse -55 -74 11.1109 0.148
NP_441365.1_5 Reverse -55 -74 37.5619 0.000000115
NP_440300.1_5 Forward -46 -28 12.225 0.271
NP_441434.1_1 Forward -206 -192 10.0383 0.233
NP_441434.1_1 Reverse -192 -206 7.93745 0.26
NP_440178.1_7 Forward -230 -211 -23.2067 0.298
NP_441716.1_2 Forward -23 -4 3.35565 0.229
NP_442973.1_5 Reverse -63 -82 9.93088 0.287
NP_441014.1_10 Forward -361 -342 2.16195 0.216
NP_442730.1_8 Forward -109 -90 8.16011 0.185
NP_442687.1_7 Reverse -104 -114 4.20827 0.262
NP_442687.1_7 Forward -334 -324 4.10993 0.266
NP_442720.1_8 Forward -363 -345 10.0489 0.297
NP_442720.1_8 Forward -286 -268 7.59063 0.297
NP_442658.1_1 Reverse -70 -80 6.37109 0.231
NP_442496.1_5 Reverse -122 -140 4.83737 0.288
NP_441317.1_4 Forward -374 -360 16.2438 0.136
NP_440950.1_8 Reverse -362 -381 13.3077 0.148
NP_442816.1_7 Forward -376 -357 17.4269 0.0347
NP_442816.1_7 Forward -377 -358 7.30471 0.238
NP_440200.1_7 Reverse -118 -137 6.22677 0.204
NP_441913.1_1 Reverse -231 -247 13.6262 0.246
NP_442598.1_2 Forward -265 -256 14.2577 0.252
NP_441000.1_1 Reverse -54 -72 13.3937 0.184
NP_441369.1_1 Reverse -20 -39 38.7419 0.000000157
NP_441369.1_2 Reverse -50 -69 38.9385 0.0000000955
NP_441369.1_3 Reverse -3 -17 28.5156 0.00021
NP_441079.1_3 Reverse -74 -93 13.4708 0.166
NP_441566.1_3 Reverse -118 -137 14.5524 0.198
NP_001035871.2_4 Forward -338 -319 10.3234 0.248
NP_442288.1_5 Reverse -18 -32 16.7159 0.12
NP_441556.1_6 Reverse -22 -40 12.4797 0.296
NP_442247.1_5 Forward -47 -33 14.4865 0.234
NP_442933.1_1 Forward -373 -354 7.68668 0.253
NP_442933.1_1 Forward -171 -152 7.11373 0.253
NP_442933.1_2 Reverse -362 -380 7.64134 0.257
NP_442933.1_2 Reverse -352 -370 7.64134 0.257
NP_442671.1_2 Reverse -28 -47 24.6829 0.000359
NP_442554.1_9 Forward -382 -363 12.4065 0.279
NP_442970.1_1 Reverse -30 -44 9.56081 0.269
NP_440405.1_6 Reverse -186 -204 2.18243 0.26
NP_440881.1_10 Forward -237 -224 11.3273 0.249
NP_442076.1_5 Reverse -24 -43 9.93088 0.186
NP_440183.1_1 Forward -299 -280 8.25926 0.244
NP_441826.1_2 Reverse -223 -237 -0.197071 0.204
NP_441826.1_6 Reverse -184 -198 20.5508 0.0182
NP_441612.1_2 Reverse -128 -138 11.5505 0.21
NP_441911.1_10 Reverse -353 -372 7.40211 0.274
NP_440871.1_3 Forward -24 -10 15.905 0.166
NP_442775.1_6 Forward -305 -286 10.5209 0.277
NP_442903.1_2 Reverse -352 -371 6.92274 0.165
NP_440274.1_2 Forward -324 -310 12.3887 0.236
NP_441878.1_6 Reverse -323 -333 -7.29646 0.217
NP_441036.1_7 Reverse -124 -134 16.7941 0.0578
NP_442356.1_2 Reverse -207 -226 12.8206 0.288
NP_441445.1_1 Forward -247 -228 1.17943 0.259
NP_440084.1_5 Forward -312 -293 13.7658 0.124
NP_441116.1_10 Forward -136 -117 4.71934 0.257
NP_442047.1_2 Forward -250 -236 15.4376 0.161
NP_441633.1_6 Forward -149 -130 8.75091 0.182
NP_440136.1_1 Forward -183 -167 9.69426 0.238
NP_442998.1_5 Reverse -51 -61 8.53483 0.261
NP_440899.1_8 Forward -374 -355 -6.68705 0.231
NP_440899.1_8 Forward -43 -24 -9.14533 0.258
NP_441118.1_2 Reverse -91 -110 24.4839 0.000875
NP_441118.1_10 Reverse -223 -241 24.0119 0.000829
NP_441362.1_2 Reverse -26 -45 5.55684 0.243
NP_440537.1_7 Reverse -4 -23 16.6629 0.0599
NP_440306.1_3 Reverse -187 -206 4.71934 0.295
NP_440306.1_5 Reverse -357 -376 5.99764 0.121
NP_441340.1_5 Reverse -230 -237 8.8889 0.084
NP_441248.1_10 Reverse -307 -317 14.9073 0.277
NP_440192.1_4 Reverse -306 -325 12.6963 0.169
NP_440372.1_3 Reverse -31 -45 15.0039 0.165
NP_441138.1_5 Forward -372 -359 20.879 0.0216
NP_441293.1_6 Forward -322 -303 16.09 0.1
NP_442114.1_8 Reverse -357 -371 6.98048 0.234
NP_442910.1_1 Reverse -241 -260 -7.57203 0.254
NP_440189.1_2 Reverse -316 -335 1.27776 0.268
NP_440562.1_5 Forward -287 -268 3.04771 0.261
NP_440350.1_5 Forward -383 -364 6.88262 0.134
NP_440350.1_5 Forward -276 -257 1.57275 0.158
NP_440350.1_5 Forward -377 -358 0.982764 0.158
NP_440350.1_5 Forward -368 -349 -4.32711 0.273
NP_442129.1_6 Reverse -29 -48 13.9464 0.246
NP_440888.1_2 Reverse -324 -338 7.96378 0.175
NP_440888.1_2 Forward -107 -93 6.19383 0.243
NP_441771.1_4 Reverse -127 -146 -4.42544 0.292
NP_440179.1_6 Forward -332 -313 4.03102 0.246
NP_440663.1_6 Forward -237 -218 14.4541 0.0249
NP_442277.1_7 Reverse -357 -373 1.05721 0.205
NP_442277.1_7 Reverse -351 -367 -1.61656 0.278
NP_442845.1_2 Reverse -223 -237 3.93283 0.272
NP_442710.1_6 Reverse -137 -156 6.39097 0.204
NP_442710.1_7 Reverse -27 -46 -7.22274 0.294
NP_439907.1_10 Reverse -221 -240 11.0117 0.273
NP_441462.1_2 Forward -333 -323 -0.904945 0.265
NP_441929.1_6 Reverse -356 -375 4.32602 0.294
NP_440519.1_6 Forward -112 -98 9.43936 0.29
NP_440544.1_5 Forward -278 -271 13.8024 0.28
NP_440454.1_2 Reverse -363 -377 13.285 0.227
NP_440454.1_2 Reverse -359 -373 9.94278 0.291
NP_441052.1_2 Reverse -384 -394 1.94665 0.221
NP_442139.1_10 Forward -307 -288 12.1917 0.188
NP_442694.1_8 Forward -44 -26 12.3105 0.191
NP_443054.1_2 Reverse -322 -336 0.982901 0.251
NP_441396.1_2 Forward -370 -353 7.21627 0.107
NP_441982.1_10 Forward -72 -53 8.55343 0.143
NP_440005.1_3 Reverse -190 -209 21.2407 0.00993
NP_442689.1_8 Forward -44 -27 -8.61428 0.294
NP_441661.1_3 Reverse -265 -282 -3.99273 0.226
NP_441409.1_8 Reverse -357 -376 11.0656 0.209
NP_441124.1_5 Reverse -23 -33 12.7217 0.215
NP_440431.1_3 Reverse -222 -241 -10.7186 0.276
NP_440431.1_4 Reverse -349 -368 6.34979 0.07
NP_440431.1_4 Reverse -360 -379 -4.34531 0.224
NP_440040.1_8 Reverse -346 -365 7.87766 0.203
NP_440943.1_5 Reverse -69 -83 14.1593 0.22
NP_442348.1_2 Forward -283 -274 11.7994 0.225
NP_442906.1_9 Forward -148 -129 4.32602 0.207
NP_441432.1_8 Reverse -97 -106 2.85133 0.281
NP_441333.1_1 Forward -362 -352 13.0198 0.217
NP_441333.1_1 Forward -373 -363 12.9245 0.217
NP_442400.1_10 Reverse -358 -371 13.8126 0.173
NP_442489.1_7 Reverse -324 -333 -1.47524 0.203
NP_441706.1_1 Forward -372 -353 4.52268 0.081
NP_440284.1_8 Reverse -61 -80 29.6945 0.000000161
NP_440284.1_9 Reverse -129 -148 28.8104 0.00000727
NP_441329.1_1 Forward -134 -115 5.29938 0.265
NP_441329.1_6 Reverse -259 -278 12.0793 0.106
NP_441329.1_6 Reverse -354 -373 11.2199 0.106
NP_441329.1_6 Reverse -358 -377 10.265 0.109
NP_441329.1_6 Reverse -360 -379 1.76618 0.231
NP_441329.1_6 Reverse -257 -276 -2.14899 0.293
NP_441329.1_6 Reverse -356 -375 -2.91293 0.294
NP_442436.1_4 Forward -172 -158 13.2743 0.218
NP_442028.1_1 Forward -382 -369 12.4757 0.251
NP_441239.1_9 Forward -335 -323 4.26721 0.256
NP_442691.1_10 Reverse -155 -173 12.3105 0.27
NP_442568.1_8 Reverse -259 -273 10.7177 0.257
NP_441541.1_1 Reverse -40 -58 -3.43572 0.264
NP_440833.1_4 Forward -288 -270 14.3755 0.0722
NP_440212.1_9 Forward -390 -371 9.01884 0.14
NP_442499.1_4 Reverse -227 -241 11.0127 0.226
NP_442840.1_7 Reverse -131 -150 13.5691 0.064
NP_440341.1_7 Forward -257 -243 12.6843 0.2
NP_439948.1_2 Reverse -359 -377 13.5618 0.259
NP_441811.1_8 Reverse -312 -326 5.80112 0.289
NP_442679.1_1 Reverse -354 -373 4.42435 0.147
NP_442679.1_1 Reverse -361 -380 -2.26216 0.24
NP_442679.1_1 Reverse -355 -374 -2.45882 0.24
NP_442679.1_1 Reverse -152 -171 -5.60541 0.293
NP_442053.1_1 Reverse -324 -333 5.70292 0.172
NP_441959.1_8 Reverse -30 -43 8.61288 0.286
NP_442456.1_5 Reverse -94 -112 6.80398 0.26
NP_442532.1_1 Reverse -344 -358 11.5713 0.215
NP_442533.1_6 Reverse -324 -333 2.35967 0.259
NP_441482.1_7 Reverse -318 -332 -11.0135 0.229
NP_442203.1_1 Reverse -347 -361 14.8129 0.228
NP_441028.1_6 Forward -135 -125 14.6309 0.158
NP_441527.1_4 Reverse -361 -380 13.9891 0.0458
NP_441527.1_4 Reverse -364 -383 12.6523 0.0458
NP_441527.1_4 Reverse -357 -376 9.97848 0.0593
NP_441527.1_4 Reverse -358 -377 5.49036 0.106
NP_441527.1_4 Reverse -351 -370 3.77151 0.111
NP_441527.1_4 Reverse -360 -379 1.76618 0.131
NP_441527.1_4 Reverse -258 -277 -1.09858 0.146
NP_441527.1_4 Reverse -257 -276 -1.28956 0.146
NP_441527.1_4 Reverse -260 -279 -1.67153 0.148
NP_441527.1_4 Reverse -354 -373 -3.29489 0.164
NP_441527.1_4 Reverse -261 -280 -4.15432 0.179
NP_441527.1_4 Reverse -349 -368 -4.72727 0.188
NP_441527.1_4 Reverse -355 -374 -7.59203 0.235
NP_441527.1_4 Reverse -348 -367 -9.88384 0.262
NP_441527.1_4 Reverse -259 -278 -11.5072 0.282
NP_441527.1_4 Reverse -362 -381 -11.7937 0.284
NP_441527.1_4 Reverse -120 -139 -12.1756 0.285
NP_441527.1_4 Reverse -359 -378 -12.3666 0.285
NP_441527.1_4 Reverse -345 -364 -12.7486 0.293
NP_441527.1_4 Reverse -363 -382 -13.1306 0.298
NP_439965.1_1 Forward -292 -273 -10.4236 0.3
NP_442673.1_5 Forward -154 -136 11.4255 0.272
NP_441106.1_7 Reverse -291 -310 13.0766 0.205
NP_441825.1_4 Forward -283 -273 12.5664 0.249
NP_440670.1_8 Reverse -324 -333 3.14632 0.296
NP_442463.1_3 Forward -113 -94 10.0292 0.275
NP_439940.1_1 Reverse -2 -21 31.957 0.00000438
NP_440404.1_9 Reverse -345 -364 10.265 0.209
NP_442842.1_10 Forward -380 -361 1.63036 0.254
NP_442842.1_10 Forward -365 -346 0.950819 0.254
NP_441460.1_1 Reverse -358 -377 14.4492 0.228
NP_441401.1_4 Reverse -369 -382 16.2439 0.131
NP_440855.1_3 Forward -264 -245 9.63507 0.185
NP_441431.1_1 Forward -45 -27 5.06306 0.245
NP_440082.1_5 Forward -376 -357 15.3242 0.256
NP_442805.1_6 Reverse -91 -110 1.86774 0.292
NP_440114.1_10 Reverse -72 -86 7.37441 0.236
NP_440114.1_10 Forward -333 -319 5.80112 0.292
NP_442324.1_7 Reverse -60 -79 6.24429 0.268
NP_440766.1_5 Reverse -126 -138 7.65579 0.288
NP_440278.1_1 Reverse -284 -303 9.53756 0.155
NP_440213.1_4 Forward -154 -135 15.6421 0.217
NP_442680.1_5 Reverse -197 -216 7.78977 0.177
NP_441436.1_8 Reverse -247 -266 7.07928 0.293
NP_441496.1_1 Forward -144 -130 14.3354 0.265
NP_440185.1_9 Reverse -314 -331 11.9369 0.264
NP_440628.1_1 Reverse -363 -373 14.6456 0.248
NP_442703.1_9 Reverse -359 -377 4.73903 0.244
NP_440191.1_6 Forward -45 -31 13.1895 0.294
NP_441397.1_8 Reverse -126 -139 15.8179 0.142
NP_441902.1_3 Reverse -126 -136 13.0789 0.23
NP_442451.1_7 Reverse -25 -44 12.9791 0.113
NP_441190.1_2 Reverse -134 -153 4.03102 0.17
NP_441207.1_7 Reverse -351 -365 15.0642 0.179
NP_441207.1_7 Reverse -366 -380 11.5789 0.241
NP_440175.1_4 Reverse -316 -335 -2.36049 0.122
NP_440216.1_9 Reverse -231 -240 5.50626 0.292
NP_441064.1_4 Forward -252 -233 7.07928 0.276
NP_441045.1_1 Reverse -149 -168 11.3075 0.3
NP_440117.1_7 Reverse -167 -181 17.9942 0.0592
NP_442116.1_6 Reverse -251 -268 12.5616 0.172
NP_442116.1_6 Forward -46 -29 7.50051 0.254
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTCTTTCTCGATAACGTAGTTCTTTTTTTTTCTGTTTATTTTCATTTTCTTTAATGCGTAATATACGGCACTCGGCCTCACTCCAAATTTCTTGGCTCTGTCTATCAATCTTGCATCGGGATTTTCTTCTACGTCTTTTTTTAGAGCTTCCCAGTCTAATTTCCTATGGCGACGCTCTACTTTTATTGGGCTTAAATCTACTCTATTTAACCATCTGTATATCGAGGCTTTTCCTATTTTACATATCTTGGAAGCCTCAGTTATTTTTCCTCCAGCTTCTATATAAGCTACTACCCTTTGCCTTAAATCTAAACTGTAAGCCATTGTTTAAACCTGTTCATTTTGTACACTCCATAATTTTACATTAAATTCTCTCATCGTTAATTGAAATGACTATAT

CDS

ATGGGATCTATGACCGCCGAAGAAGCTCTTAAACGGACCGTGGCCAAGGTACTCTTAGGTGGACCTATGTCTAACGAAGCGGCAGAGCAACTGGCCACCGCAGCTAAAAGCTTGTTCGACGTAGCTATAAACGAATACGCAATCGAGACGACGGATGGTAGATACAGTTTTAACGAGCAGCAGAGTAGATCTGCTTCACTCTTAGCCTTCTACCTCAAAGCGGCAGAAGATGTGCTGACAGACATCAAAGTGGAAGGCCGGATGAACACCAAGGCCCTCTCAGAGCTTGGCTACGTTGACCACTTAGACAGGCTACAAAACCTAGATCTGACAGGAGGTCTAGCCTATATAAACGAGATAGAGCAAAACGTAAGACAGAGCGCCATCCTCGGAGAGGAAGACTCTCTAGCAGTTTGGACCATTATGGACGAGCTTAAACAGGGCTACACACAAGTTAAGAGCGGCGCAGTTAGCCCTGACTCGCTAGAAGGTATGTTGAGCACTGCAAAGGAGCAGTTAGGACAGCTTGGAGCTAACACCAACATGCTGACTTCGACTATAGACTTGTACTTAGAGAATGAGGATGTGGCTCTCAGATATAAAGAAGCGGGTAGGGCAGCAAACATTATCCTACCCACCGCAGAGGAGCTAGAGCAAGCCTCAGGTACAGAGTACGAGCAGATGCGCGAGCAGTTAAAGCTTAGTCTGTATAATCTTTACTCCTTTGGCCAACTTAATAAGTACCTACAAACTCAAATGGACCCGGGGTTGAACCGTGTGACGGTAGCAACGGGGATGCAGGACACGACCAGGCTGGAAGCGCACTACGCCCAGCTGCTAACCCAAGCGGAGCTTGACCTGTACACAGTTAGTACAAAAGACAAGGAAGCCTACGCGAGCATCCAGGAGACGCTAATAACCCTAGGATCCATGCTAGAAGAGAACCTCGGCTACATGAACCAAGCCAAGGTTAGATCCACCTACGCCCTGCAGCACATGAGTGTACTACAGCTAGGGGCGCTGAGTTCTGACAATTTAGGTATTAATTGGGGCGGCGTTGACCCCGACAACAACCTAACCGAACAACAAAGAAGGGCGATAGAGGTAGACACCTTAGCGTCGCAGCTAACCTTTGAGTTCAGTCAAGGTTACAGCTCTTCTACAGCAAAGACTCTACCCAGGGTATTGACGGGCAGACAAAACAAAGGATTGTTATCTGCTAGCCCCGCATACAACTTCTTCAAAGGTTTCTTCGATGCCTACGCCTCTGGAAGGCCAGAGGACTTCGAGAATTTACAAGAGAACGCCGCCTACATGCGTGACGTTAAGAGAGTCAGCAGCCAGGTTATGCGGAACGGTTACGACAGTGTAGACAGTAGGGTCAACATCTTAGTAGACGACTACGTTCGACAACTGATCAGCCCGGAAAGTCCTATCAGTTCTCAAGCTCGGTTCTTGGTCAGCGATCTGTCCACATGA

Protein

No sequence available