Your browser is old and dusty. Try Google Chrome!

Details for slr8021

ORF slr8021
Accession NP_942415.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -287 -273 1.47456 0.188
NP_441061.1_2 Forward -154 -140 1.08123 0.195
NP_441418.1_6 Forward -294 -275 -29.3032 0.221
NP_441480.1_1 Reverse -307 -326 -0.295539 0.287
NP_441453.1_4 Forward -282 -274 3.85433 0.284
NP_441453.1_7 Forward -15 -8 11.9372 0.298
NP_441818.1_9 Reverse -305 -324 -6.39206 0.263
NP_442169.1_1 Forward -143 -124 -2.85214 0.282
NP_441630.1_3 Forward -167 -148 1.37609 0.248
NP_442173.1_1 Reverse -362 -370 7.8859 0.134
NP_442752.1_4 Forward -329 -322 7.90559 0.144
NP_442752.1_4 Reverse -273 -280 7.90559 0.144
NP_442752.1_4 Forward -131 -124 6.52896 0.154
NP_442752.1_4 Forward -282 -275 5.25066 0.256
NP_443027.1_4 Forward -284 -274 7.64985 0.238
NP_440061.1_9 Reverse -271 -285 7.17714 0.216
NP_442062.1_8 Forward -282 -272 3.61828 0.26
NP_440761.1_4 Forward -299 -280 -13.1769 0.257
NP_440304.1_4 Reverse -271 -281 8.73149 0.0678
NP_441935.1_1 Forward -140 -121 4.916 0.293
NP_441083.1_5 Reverse -273 -283 -0.708283 0.276
NP_441558.1_5 Reverse -271 -290 8.84924 0.138
NP_440870.1_4 Forward -288 -270 1.49411 0.235
NP_442889.1_8 Forward -380 -366 5.70218 0.217
NP_441713.1_1 Reverse -267 -286 -15.0452 0.26
NP_440644.1_3 Reverse -375 -394 5.11266 0.17
NP_442111.1_4 Reverse -218 -232 2.94952 0.259
NP_440343.1_3 Reverse -113 -131 3.36165 0.281
NP_440747.1_10 Forward -285 -273 -12.1541 0.227
NP_441130.1_10 Forward -254 -240 5.70279 0.218
NP_441486.1_1 Forward -83 -69 -5.90027 0.266
NP_442634.1_4 Forward -284 -270 -2.65535 0.155
NP_441634.1_8 Forward -137 -123 -3.63866 0.295
NP_440376.1_1 Forward -282 -273 7.07956 0.0869
NP_440376.1_1 Reverse -273 -282 6.39124 0.1
NP_442191.1_4 Reverse -274 -288 11.8657 0.238
NP_442958.1_3 Forward -329 -310 4.52268 0.247
NP_442583.1_8 Reverse -274 -293 13.5691 0.161
NP_440642.1_10 Forward -355 -341 14.6503 0.119
NP_442296.1_9 Forward -376 -357 -0.590531 0.197
NP_442658.1_1 Reverse -271 -281 7.94438 0.199
NP_442658.1_1 Forward -207 -197 5.58445 0.262
NP_440141.1_8 Forward -106 -87 8.84924 0.23
NP_442205.1_9 Forward -288 -272 -2.69473 0.272
NP_442300.1_10 Reverse -276 -295 15.2408 0.18
NP_441958.1_5 Reverse -272 -282 1.65166 0.0872
NP_441958.1_5 Forward -283 -273 1.65166 0.0872
NP_440203.1_5 Forward -279 -269 13.6475 0.112
NP_443055.1_6 Reverse -132 -150 10.1465 0.131
NP_441348.1_7 Forward -287 -268 5.70265 0.289
NP_441099.1_5 Reverse -310 -329 -9.34199 0.219
NP_441646.1_1 Forward -289 -270 3.14605 0.208
NP_440147.1_4 Forward -82 -69 5.62415 0.119
NP_441916.1_7 Reverse -273 -283 6.37155 0.0988
NP_441916.1_10 Forward -325 -306 15.6341 0.0939
NP_440206.1_4 Reverse -274 -293 -2.36125 0.295
NP_440345.1_3 Reverse -23 -37 10.4202 0.282
NP_440465.1_10 Forward -285 -266 -0.885524 0.29
NP_442004.1_6 Reverse -273 -287 6.58777 0.171
NP_441725.1_5 Forward -281 -271 -1.10161 0.288
NP_442941.1_3 Forward -281 -271 7.84651 0.0564
NP_442941.1_3 Reverse -274 -284 -0.0199663 0.244
NP_442281.1_1 Forward -375 -361 5.21053 0.166
NP_442281.1_1 Reverse -268 -282 2.06395 0.278
NP_442847.1_3 Reverse -273 -292 10.6184 0.217
NP_440437.1_1 Reverse -144 -163 -2.0655 0.21
NP_442982.1_5 Forward -292 -273 -3.54046 0.299
NP_441644.1_6 Reverse -273 -283 7.74772 0.117
NP_441644.1_6 Forward -282 -272 7.55106 0.123
NP_443049.1_6 Reverse -248 -258 13.2024 0.194
NP_440867.1_9 Forward -292 -273 21.4356 0.103
NP_442215.1_1 Reverse -146 -165 4.916 0.247
NP_442029.1_6 Reverse -356 -375 6.39097 0.238
NP_442933.1_10 Reverse -273 -282 4.42462 0.246
NP_442554.1_8 Forward -281 -271 6.46988 0.117
NP_442554.1_8 Reverse -274 -284 6.37155 0.12
NP_441762.1_7 Reverse -70 -82 -6.15587 0.276
NP_442292.1_1 Forward -281 -272 5.21127 0.152
NP_443009.1_5 Forward -283 -272 11.9562 0.0586
NP_443009.1_5 Reverse -272 -283 4.77807 0.23
NP_441741.1_4 Reverse -207 -226 18.7761 0.208
NP_441198.1_8 Reverse -271 -281 10.7322 0.247
NP_440379.1_5 Reverse -269 -288 4.22769 0.136
NP_440464.1_10 Forward -328 -318 14.4405 0.169
NP_441468.1_1 Reverse -274 -281 3.97235 0.277
NP_441673.1_1 Forward -282 -273 1.27803 0.155
NP_441673.1_1 Reverse -273 -282 1.27803 0.155
NP_441330.1_1 Reverse -356 -375 -14.3569 0.219
NP_442719.1_2 Reverse -82 -100 3.75497 0.155
NP_442361.1_3 Reverse -140 -153 9.36073 0.276
NP_442808.1_1 Forward -283 -273 3.61784 0.234
NP_442050.1_5 Reverse -69 -79 7.45273 0.256
NP_440342.1_1 Forward -297 -278 10.9142 0.279
NP_440558.1_2 Reverse -269 -288 -1.37718 0.214
NP_441878.1_6 Reverse -272 -282 1.65166 0.0795
NP_441878.1_6 Forward -283 -273 -0.216628 0.169
NP_441557.1_5 Forward -282 -273 0.393051 0.166
NP_441557.1_5 Reverse -273 -282 0.393051 0.166
NP_441308.1_8 Reverse -271 -281 13.353 0.218
NP_442192.1_7 Reverse -77 -95 14.4738 0.299
NP_442183.1_1 Forward -282 -268 7.76774 0.131
NP_441549.1_9 Forward -163 -145 -6.1757 0.198
NP_441549.1_9 Reverse -269 -287 -7.25734 0.206
NP_441549.1_9 Forward -286 -268 -9.42063 0.248
NP_441549.1_9 Reverse -304 -322 -10.1089 0.269
NP_442590.1_10 Forward -138 -119 4.12936 0.281
NP_442590.1_10 Reverse -273 -292 2.94938 0.299
NP_441799.1_1 Forward -286 -272 9.24208 0.0966
NP_441007.1_10 Reverse -268 -281 -0.177378 0.268
NP_442333.2_5 Reverse -139 -158 -14.5535 0.278
NP_440256.1_1 Forward -285 -266 -5.70374 0.189
NP_440087.1_1 Forward -168 -149 -2.55715 0.215
NP_441559.1_8 Forward -287 -273 -0.0987402 0.172
NP_441559.1_8 Reverse -127 -141 -5.90027 0.271
NP_441559.1_8 Reverse -268 -282 -7.57189 0.295
NP_440915.1_6 Forward -286 -272 -3.44199 0.296
NP_440026.1_4 Forward -285 -266 14.5524 0.239
NP_440327.1_6 Reverse -356 -375 2.45773 0.296
NP_442240.1_1 Reverse -80 -99 4.81688 0.268
NP_440586.1_8 Reverse -250 -257 8.88855 0.205
NP_440192.1_4 Forward -143 -124 9.39761 0.276
NP_443051.1_1 Reverse -272 -281 -0.000272808 0.245
NP_443051.1_1 Forward -283 -274 -0.000272808 0.245
NP_439984.1_3 Forward -166 -152 18.8785 0.0523
NP_440439.1_1 Forward -285 -272 11.229 0.0339
NP_440439.1_1 Reverse -270 -283 -1.35735 0.263
NP_442384.1_10 Reverse -273 -286 16.7355 0.00732
NP_442384.1_10 Reverse -150 -163 0.412608 0.291
NP_442262.1_10 Reverse -147 -154 8.39725 0.234
NP_441689.1_5 Reverse -271 -281 5.58445 0.23
NP_440344.1_10 Forward -384 -367 -10.6792 0.187
NP_441335.1_8 Forward -223 -204 6.58763 0.281
NP_442832.1_7 Reverse -87 -106 18.4857 0.223
NP_441965.1_10 Forward -285 -269 9.20332 0.123
NP_441965.1_10 Reverse -270 -286 4.48343 0.238
NP_440297.1_9 Forward -281 -271 -0.216628 0.282
NP_440999.1_9 Forward -374 -360 -0.688726 0.214
NP_440999.1_9 Forward -209 -195 -1.18038 0.229
NP_440888.1_2 Forward -282 -268 9.14375 0.137
NP_440792.1_1 Reverse -375 -394 3.14605 0.273
NP_442948.1_2 Forward -283 -264 4.03102 0.274
NP_440575.1_8 Forward -26 -7 8.65258 0.11
NP_441543.1_2 Forward -281 -272 3.93297 0.3
NP_442845.1_2 Reverse -267 -281 10.816 0.142
NP_441469.1_8 Reverse -272 -281 5.21127 0.283
NP_443064.1_6 Reverse -320 -330 12.7608 0.0796
NP_440710.1_1 Forward -290 -272 -8.83064 0.282
NP_441462.1_2 Reverse -273 -283 0.668351 0.135
NP_441462.1_2 Forward -282 -272 0.668351 0.135
NP_442204.1_1 Reverse -241 -252 2.91027 0.266
NP_440516.1_2 Reverse -267 -285 1.00246 0.211
NP_440516.1_8 Forward -294 -285 -0.196935 0.185
NP_442428.1_5 Reverse -274 -281 10.6589 0.0727
NP_442120.1_10 Forward -395 -376 0.786102 0.156
NP_442823.1_8 Reverse -273 -292 10.8159 0.297
NP_440673.1_3 Forward -256 -249 10.9539 0.106
NP_441052.1_2 Reverse -273 -283 5.38824 0.12
NP_441884.1_9 Forward -101 -82 -23.1083 0.284
NP_441004.1_1 Forward -147 -128 -9.047 0.206
NP_441004.1_4 Reverse -103 -113 7.94484 0.282
NP_442366.1_3 Forward -156 -138 1.00246 0.16
NP_442854.1_6 Forward -294 -275 0.884433 0.287
NP_442312.1_1 Forward -233 -214 11.9958 0.266
NP_441851.1_10 Reverse -272 -282 5.19158 0.221
NP_440463.1_8 Forward -82 -63 7.11264 0.267
NP_441349.1_10 Reverse -263 -282 -9.83364 0.297
NP_440432.1_9 Forward -79 -64 3.42148 0.0911
NP_440588.1_2 Reverse -264 -283 -5.21209 0.243
NP_440588.1_2 Reverse -359 -378 -5.40875 0.25
NP_442335.1_7 Reverse -286 -300 12.2903 0.27
NP_442006.1_2 Forward -295 -278 -17.3657 0.274
NP_441078.1_4 Reverse -273 -282 14.8477 0.00707
NP_441078.1_4 Forward -282 -273 0.589713 0.174
NP_441432.1_8 Forward -295 -286 5.60459 0.147
NP_441432.1_8 Reverse -272 -281 4.42462 0.213
NP_443024.1_2 Forward -125 -112 15.0633 0.24
NP_442320.1_8 Reverse -65 -79 -4.62196 0.177
NP_441732.1_2 Reverse -269 -285 -16.6577 0.186
NP_440629.1_6 Forward -288 -269 14.3596 0.181
NP_442797.1_7 Forward -289 -271 2.67408 0.238
NP_440199.1_10 Forward -162 -152 6.8632 0.257
NP_440281.1_4 Forward -66 -47 14.2566 0.297
NP_442489.1_7 Reverse -273 -282 8.06287 0.0371
NP_442489.1_7 Forward -282 -273 0.589713 0.17
NP_441659.2_8 Forward -282 -272 9.12481 0.0355
NP_441659.2_8 Reverse -273 -283 1.35667 0.242
NP_442346.1_5 Reverse -272 -282 5.87989 0.225
NP_442346.1_5 Forward -283 -273 5.48657 0.243
NP_440545.1_3 Forward -286 -269 3.57876 0.0817
NP_440545.1_3 Reverse -269 -286 -5.56602 0.253
NP_440459.1_2 Reverse -335 -352 7.90532 0.276
NP_440010.1_6 Forward -143 -124 10.8159 0.191
NP_440010.1_10 Reverse -51 -70 3.04771 0.264
NP_442603.1_7 Forward -155 -141 8.55376 0.171
NP_442799.1_2 Reverse -138 -157 2.26107 0.217
NP_440875.1_9 Reverse -275 -285 9.54007 0.233
NP_442028.1_1 Reverse -15 -28 9.229 0.261
NP_441239.1_9 Forward -284 -272 9.77374 0.0972
NP_441239.1_9 Reverse -276 -288 6.72548 0.178
NP_441892.1_1 Reverse -240 -257 0.137172 0.173
NP_442082.1_2 Forward -368 -349 2.9486 0.298
NP_442044.1_1 Forward -287 -268 1.86774 0.147
NP_440546.1_4 Forward -282 -272 8.59164 0.181
NP_440462.1_6 Forward -284 -274 7.15819 0.089
NP_442053.1_1 Forward -282 -273 5.21127 0.203
NP_440505.1_3 Forward -284 -274 7.05986 0.165
NP_440914.1_1 Reverse -273 -283 14.5682 0.0112
NP_441011.1_8 Reverse -274 -283 9.53783 0.123
NP_441011.1_8 Reverse -72 -81 5.11294 0.283
NP_442533.1_6 Reverse -273 -282 15.536 0.00533
NP_442533.1_6 Forward -282 -273 7.76787 0.0883
NP_439944.1_9 Forward -79 -69 9.51814 0.1
NP_441028.1_6 Reverse -93 -103 5.48612 0.255
NP_440007.1_9 Reverse -269 -283 2.75286 0.277
NP_441680.1_4 Reverse -130 -149 0.0977854 0.246
NP_441106.1_1 Reverse -272 -281 5.50626 0.145
NP_439903.1_6 Forward -362 -343 6.48849 0.167
NP_441021.1_1 Reverse -274 -293 -7.08038 0.181
NP_442365.1_7 Reverse -269 -288 -0.885524 0.187
NP_442794.1_1 Reverse -142 -154 6.72548 0.163
NP_440387.1_1 Reverse -273 -289 -2.49807 0.148
NP_441431.1_3 Forward -234 -215 4.62101 0.263
NP_440467.1_3 Forward -293 -274 14.2837 0.176
NP_440114.1_10 Forward -282 -268 10.226 0.151
NP_440114.1_10 Reverse -273 -287 7.07942 0.246
NP_440293.1_3 Forward -289 -270 -6.98204 0.296
NP_440766.1_4 Reverse -142 -156 0.589577 0.276
NP_442514.1_9 Reverse -381 -400 13.7658 0.182
NP_440554.1_4 Forward -281 -271 3.61828 0.222
NP_441885.1_5 Reverse -273 -283 -0.609952 0.215
NP_442341.1_7 Forward -156 -142 2.75286 0.247
NP_442341.1_7 Reverse -319 -333 1.67122 0.282
NP_442341.1_9 Forward -284 -270 14.9452 0.0585
NP_442341.1_9 Forward -379 -365 7.57046 0.196
NP_443000.1_7 Forward -284 -274 0.963343 0.278
NP_441842.1_1 Reverse -152 -165 14.7683 0.0928
NP_441902.1_3 Forward -398 -388 15.7998 0.179
NP_440216.1_1 Reverse -273 -287 -2.16369 0.0482
NP_440216.1_9 Forward -14 -5 5.3096 0.298
NP_440172.1_1 Reverse -273 -283 5.5849 0.14
NP_441718.1_7 Forward -399 -380 7.37428 0.253
NP_442015.1_10 Reverse -316 -329 2.67422 0.187
NP_442417.1_5 Reverse -245 -259 8.94771 0.142
NP_442417.1_5 Reverse -219 -233 8.65272 0.15
NP_440416.1_9 Reverse -139 -158 -18.1918 0.253
NP_442154.1_1 Forward -148 -130 -16.8938 0.246
NP_440261.1_5 Reverse -151 -164 -6.56889 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GCTGGGGCAGCAAATACTTCATCGGCCCTCAGCAACCTCAAGATGGTTTCCTTGCCTGATTCAGAGATTTTGGTGAGCCGCAAGGAACCCGTCACTAACAGATAGAGGCAAGCGGGCAGGGCATCGCCTTCATAAAATACAACTTCATCGCTCTCGTAGGTCTTCAGACTACTGTGCTCGGCAAGTTGACCTAGCAGTAATGGCTCTAATTCTTTAAACAGGCTGATGTACTGAAGCTGCTGGACATCGATCTGCATGGTGACATTGTCGGGGAGGCTCATGAACCTCCATTAGACCATAGGGGACATCAGGAACAGGTCAGCGTTCTCTCCATGAGCTACCTCATAAACAGGACTAAGCCCCTCTGTGAGAATAAAAGTATACTTCCCTGGTAAATGTC

CDS

ATGACGGTCACTCCACTCAATCTTAAGACTGCTTCTGGACATCAAGTGCTAGCCGCGGCCGGTAAAAAGATCCTGCGTCCCGGCGGGCGGAAAGCCACAGAAATCCTCTTTACCTGGGTCAATTTTCAACCCGGTGAGACGGTGCTAGAGCTAGCCGCCAGTTTTGGTTACAGTGCCATTGCCCTAGCCCAGCGTTATGGTGTCAAGGTGGTGGGCATCGAAAAAAATCCTGACAGTGTGGCCCGCGCCCGGGCCAACGTGGAAGCTGCTGGCCTGAGTGCTCAGGTGGATATCCGTGAAGGCGACTTTTTTCACCTGGAGCGCATCCCAGGGCAATTTGACTATGTTCTGGGAGAAGCCATTTTATCCATGCAGTCAGCCCCCGCTAAAGCCAAAATTCTACAGGGGGTAGGAGCTCGTCTTAAACCTGGTGGGCAATACCTCAGCCATGAAATGCTAGCCCAAGGTGCCCACATCGAAGATATTTACCGAGAACTGGCAACCACTATTCGGGTCAACACAGCCCCGCTCAATGAACTGGACTGGCAAGGAACCTATGAACAGGCAAACCTAACTGTGCAACAGCACCGCACTGGTCCCATGGCTTTACTTAACCCTCTGACCATCGCCCAAGAAGAAGGCTTGGGTACCCTGCTGAGCTTGGGTTGGAATTTACTGGTGCATCCGCCTATGCGGCAACGGATTTTAGCCATGAGGCGGGTATTTACCAAGTACGGCGACGATCTAGGCTACATCATTCTCCGTGCCCAGAAGCCTAGCTAG

Protein

No sequence available