Your browser is old and dusty. Try Google Chrome!

Details for slr7101

ORF slr7101
Accession NP_942389.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -178 -164 4.81781 0.143
NP_440557.1_1 Forward -178 -159 -1.96717 0.28
NP_442100.1_1 Reverse -331 -350 6.82725 0.277
NP_441480.1_5 Reverse -101 -120 11.0125 0.231
NP_440897.1_6 Forward -310 -291 -2.75457 0.221
NP_441453.1_4 Reverse -146 -154 9.75419 0.0493
NP_441453.1_7 Forward -136 -129 12.9205 0.23
NP_441623.1_1 Forward -136 -118 -4.60241 0.274
NP_442151.1_6 Forward -179 -165 7.17775 0.206
NP_442151.1_8 Reverse -13 -26 18.2105 0.27
NP_441818.1_1 Forward -178 -167 14.0211 0.0577
NP_440259.1_4 Forward -203 -189 16.4448 0.131
NP_440150.1_4 Forward -32 -13 13.3725 0.11
NP_442752.1_4 Reverse -170 -177 10.5605 0.1
NP_442752.1_4 Reverse -361 -368 9.47889 0.109
NP_443027.1_4 Forward -222 -212 10.5014 0.128
NP_440784.1_7 Forward -178 -171 8.59391 0.129
NP_442861.1_1 Forward -355 -336 13.4708 0.26
NP_442062.1_2 Reverse -159 -178 10.7175 0.284
NP_442062.1_8 Reverse -76 -86 3.71661 0.256
NP_441900.1_2 Reverse -4 -22 -6.66806 0.295
NP_440304.1_4 Forward -87 -77 7.84651 0.099
NP_441781.1_7 Forward -149 -130 6.39097 0.186
NP_441200.1_4 Reverse -130 -149 8.65258 0.251
NP_441208.1_9 Reverse -80 -94 7.9644 0.219
NP_441925.1_4 Reverse -301 -320 -16.1275 0.281
NP_441738.1_2 Forward -83 -76 10.0685 0.125
NP_441738.1_2 Forward -141 -134 6.72528 0.236
NP_440209.1_1 Forward -85 -77 5.13263 0.17
NP_442889.1_8 Forward -182 -168 6.98048 0.167
NP_440447.1_5 Reverse -126 -136 14.4347 0.277
NP_441770.1_5 Reverse -68 -87 7.17762 0.177
NP_440178.1_7 Forward -209 -190 -20.65 0.196
NP_442570.1_3 Forward -328 -309 -8.55534 0.288
NP_441716.1_1 Reverse -301 -315 3.44117 0.265
NP_441598.1_4 Forward -138 -119 15.8307 0.285
NP_441163.1_1 Forward -294 -277 7.41293 0.245
NP_441533.1_7 Forward -177 -159 11.6214 0.299
NP_440747.1_10 Forward -134 -122 -12.0557 0.199
NP_440747.1_10 Reverse -167 -179 -12.4491 0.282
NP_441130.1_3 Forward -28 -9 20.6481 0.217
NP_442634.1_4 Reverse -209 -223 -4.81863 0.22
NP_442848.1_5 Reverse -145 -163 -1.84914 0.276
NP_442848.1_5 Reverse -8 -26 -2.0458 0.278
NP_443018.1_3 Reverse -77 -84 9.77388 0.118
NP_443018.1_3 Reverse -217 -224 5.34899 0.212
NP_441634.1_8 Reverse -168 -182 -2.36035 0.295
NP_441634.1_9 Forward -270 -251 9.7334 0.274
NP_442687.1_7 Forward -209 -199 4.50326 0.245
NP_442687.1_7 Reverse -300 -310 3.91327 0.278
NP_441077.1_6 Reverse -70 -86 6.0797 0.244
NP_442485.1_3 Forward -67 -48 -3.93378 0.277
NP_442485.1_3 Reverse -159 -178 -5.80207 0.296
NP_441846.1_10 Forward -320 -301 -14.3569 0.222
NP_441846.1_10 Forward -322 -303 -20.7484 0.256
NP_441029.1_5 Forward -27 -8 12.3951 0.273
NP_440360.1_10 Forward -119 -105 10.7177 0.18
NP_442782.1_2 Forward -85 -71 1.47456 0.281
NP_442782.1_2 Reverse -338 -352 0.687908 0.286
NP_442496.1_5 Forward -320 -302 8.18062 0.256
NP_442205.1_9 Reverse -70 -86 3.89344 0.171
NP_442205.1_9 Forward -226 -210 3.69678 0.176
NP_442223.1_3 Forward -31 -12 17.8957 0.0578
NP_442937.1_5 Reverse -165 -184 8.84924 0.209
NP_441958.1_5 Forward -86 -76 0.373358 0.154
NP_440318.1_1 Reverse -9 -28 3.93269 0.244
NP_442690.1_1 Forward -350 -331 -10.522 0.215
NP_442690.1_1 Reverse -340 -359 -13.5702 0.264
NP_442064.1_4 Forward -183 -164 9.34008 0.208
NP_442536.1_4 Forward -133 -115 19.0954 0.048
NP_443055.1_6 Forward -121 -103 -0.571569 0.263
NP_440993.1_4 Reverse -47 -64 4.85706 0.272
NP_440602.1_4 Forward -187 -168 13.9625 0.112
NP_441099.1_5 Forward -165 -146 -10.817 0.262
NP_442598.1_2 Forward -199 -190 14.2577 0.252
NP_441646.1_1 Forward -186 -167 6.19431 0.173
NP_442431.1_10 Reverse -164 -182 2.87075 0.228
NP_441292.1_2 Reverse -354 -373 -6.29373 0.241
NP_441752.1_6 Reverse -13 -32 2.45773 0.235
NP_440377.1_1 Reverse -341 -358 12.3367 0.26
NP_440147.1_4 Forward -181 -168 5.52582 0.122
NP_441916.1_5 Forward -241 -222 14.8474 0.273
NP_441916.1_7 Forward -85 -75 3.91327 0.198
NP_441916.1_10 Forward -100 -81 7.37428 0.194
NP_440465.1_10 Forward -314 -295 5.50599 0.212
NP_441041.1_1 Reverse -158 -177 6.29264 0.274
NP_442396.1_5 Reverse -357 -370 10.344 0.114
NP_441725.1_4 Reverse -206 -220 17.0102 0.0693
NP_441725.1_5 Reverse -77 -87 -0.118297 0.232
NP_439966.1_7 Forward -87 -77 8.73102 0.13
NP_442941.1_3 Forward -178 -168 6.8632 0.0954
NP_442941.1_3 Forward -219 -209 2.14332 0.143
NP_442941.1_3 Reverse -77 -87 0.373358 0.212
NP_440983.1_5 Reverse -146 -165 -1.18052 0.228
NP_440983.1_5 Reverse -251 -270 -7.37537 0.288
NP_442281.1_1 Reverse -71 -85 2.65393 0.26
NP_439983.1_1 Reverse -302 -320 10.8348 0.289
NP_441087.1_6 Reverse -303 -321 -3.81647 0.296
NP_442982.1_5 Forward -95 -76 -1.08219 0.263
NP_441644.1_6 Reverse -224 -234 6.17443 0.165
NP_441644.1_6 Reverse -76 -86 3.12618 0.297
NP_441644.1_8 Forward -27 -8 23.0089 0.0466
NP_442215.1_2 Forward -181 -165 1.14018 0.14
NP_442177.1_5 Forward -269 -255 8.45605 0.276
NP_442933.1_1 Forward -204 -185 7.4002 0.253
NP_442933.1_10 Forward -85 -76 5.40793 0.19
NP_441751.2_8 Reverse -77 -91 5.30946 0.0448
NP_441751.2_8 Forward -178 -164 -6.88358 0.289
NP_439922.1_3 Forward -213 -194 10.7424 0.226
NP_442554.1_8 Forward -178 -168 5.38824 0.15
NP_442554.1_8 Forward -154 -144 3.22496 0.235
NP_442142.1_4 Forward -176 -163 16.0466 0.0264
NP_442142.1_4 Reverse -274 -287 8.77016 0.108
NP_442292.1_1 Forward -178 -169 5.80125 0.129
NP_440919.1_1 Forward -221 -202 -2.75381 0.221
NP_440895.1_6 Forward -343 -330 8.67241 0.251
NP_440895.1_10 Forward -174 -157 -4.87771 0.262
NP_443009.1_5 Forward -86 -75 4.08976 0.263
NP_443009.1_5 Reverse -169 -180 3.99143 0.268
NP_441715.1_4 Forward -178 -168 7.55152 0.108
NP_441448.1_2 Reverse -306 -325 -0.0996487 0.25
NP_441468.1_1 Reverse -171 -178 4.26735 0.246
NP_441015.1_10 Reverse -48 -67 -5.9004 0.235
NP_441673.1_1 Forward -106 -97 -8.06341 0.254
NP_441826.1_2 Reverse -164 -178 -4.4253 0.296
NP_442868.1_6 Reverse -168 -178 -0.314959 0.284
NP_441056.1_1 Forward -179 -160 -2.0655 0.196
NP_441056.1_1 Reverse -140 -159 -8.16202 0.282
NP_441612.1_2 Forward -131 -121 15.5198 0.209
NP_441612.1_2 Forward -106 -96 8.45247 0.214
NP_441612.1_2 Forward -92 -82 6.32259 0.294
NP_443058.1_7 Forward -288 -269 3.53937 0.262
NP_442808.1_1 Forward -107 -97 14.3359 0.0409
NP_442808.1_1 Reverse -13 -23 1.5529 0.282
NP_441176.1_4 Forward -192 -173 14.1591 0.29
NP_442775.1_6 Forward -166 -147 11.2092 0.277
NP_442050.1_5 Forward -87 -77 11.5826 0.0915
NP_442739.1_2 Forward -357 -338 15.2669 0.246
NP_441114.1_3 Reverse -201 -210 7.27622 0.247
NP_440558.1_2 Forward -182 -163 -6.1954 0.272
NP_440558.1_2 Reverse -175 -194 -6.88371 0.283
NP_441878.1_6 Forward -311 -301 -7.0998 0.204
NP_441557.1_5 Forward -85 -76 -0.885252 0.26
NP_441433.1_8 Reverse -122 -141 2.3594 0.223
NP_442962.1_1 Reverse -101 -120 8.35759 0.239
NP_442419.1_4 Reverse -9 -27 13.9821 0.0477
NP_442830.1_5 Forward -63 -49 5.89884 0.225
NP_442192.1_4 Reverse -293 -312 10.815 0.274
NP_442183.1_1 Reverse -76 -90 4.52282 0.26
NP_441574.1_1 Reverse -158 -177 -4.81876 0.254
NP_442347.1_2 Reverse -252 -261 8.35786 0.0927
NP_442347.1_2 Reverse -212 -221 6.29291 0.175
NP_442645.1_2 Reverse -162 -181 -14.2585 0.172
NP_441633.1_3 Forward -181 -168 -6.17557 0.238
NP_440899.1_8 Forward -249 -230 -9.047 0.258
NP_440299.1_1 Forward -110 -97 5.52525 0.172
NP_441743.1_4 Forward -121 -102 16.5191 0.283
NP_440256.1_1 Forward -88 -69 -8.752 0.266
NP_440256.1_1 Reverse -73 -92 -8.752 0.266
NP_441395.1_8 Reverse -186 -205 8.35759 0.253
NP_440915.1_6 Forward -159 -145 0.687908 0.155
NP_442069.1_8 Reverse -126 -145 6.88262 0.235
NP_442866.1_1 Forward -277 -258 -7.76869 0.268
NP_440702.1_2 Reverse -95 -114 -2.85214 0.257
NP_442993.1_1 Forward -85 -69 -0.826444 0.0826
NP_442386.1_9 Forward -122 -113 9.34074 0.166
NP_442386.1_10 Forward -321 -308 13.6873 0.107
NP_440570.1_5 Reverse -60 -79 1.0811 0.247
NP_442054.1_8 Forward -278 -259 16.6174 0.181
NP_440168.1_9 Reverse -168 -187 -1.67217 0.277
NP_442506.1_5 Reverse -92 -111 17.8957 0.283
NP_441160.1_9 Forward -187 -168 8.45592 0.264
NP_440586.1_8 Forward -178 -171 9.28187 0.164
NP_440586.1_9 Reverse -129 -148 4.81767 0.288
NP_441262.1_3 Reverse -76 -83 10.6589 0.0722
NP_440027.1_3 Forward -131 -113 3.55831 0.27
NP_443051.1_1 Forward -86 -77 -0.000272808 0.245
NP_439937.1_8 Forward -111 -92 2.75272 0.21
NP_439937.1_9 Reverse -300 -317 -15.3997 0.287
NP_440171.1_3 Forward -324 -305 5.50599 0.284
NP_440316.1_10 Forward -321 -311 7.84651 0.245
NP_440316.1_10 Reverse -163 -173 5.87989 0.277
NP_440267.1_2 Reverse -71 -85 7.3738 0.198
NP_442384.1_10 Reverse -170 -183 2.57589 0.22
NP_440364.1_6 Reverse -163 -176 15.4566 0.275
NP_441018.1_7 Forward -183 -164 8.06259 0.256
NP_442262.1_10 Reverse -77 -84 11.1505 0.115
NP_442262.1_10 Forward -373 -366 8.49558 0.226
NP_442262.1_10 Reverse -217 -224 7.6106 0.274
NP_441689.1_5 Forward -87 -77 12.4676 0.132
NP_441689.1_5 Forward -376 -366 5.58445 0.23
NP_440282.1_10 Forward -110 -91 -9.24366 0.275
NP_440531.1_6 Reverse -269 -288 0.491109 0.191
NP_440189.1_10 Reverse -290 -309 6.4893 0.249
NP_441335.1_8 Reverse -52 -71 8.25926 0.264
NP_442280.1_1 Forward -321 -302 5.01433 0.222
NP_441592.1_4 Reverse -305 -324 -1.86883 0.26
NP_440888.1_2 Reverse -284 -298 6.58715 0.228
NP_441543.1_2 Forward -178 -169 11.6028 0.0504
NP_441543.1_2 Reverse -77 -86 4.42462 0.246
NP_442845.1_2 Forward -161 -147 3.73617 0.279
NP_441551.1_5 Reverse -361 -377 8.41597 0.238
NP_441469.1_8 Forward -180 -171 11.9961 0.136
NP_442315.1_2 Forward -326 -314 16.1653 0.245
NP_443064.1_6 Forward -370 -360 8.88251 0.262
NP_440710.1_1 Reverse -293 -311 -7.45401 0.238
NP_441462.1_2 Forward -85 -75 -0.314959 0.206
NP_443062.1_1 Forward -286 -268 7.08331 0.185
NP_440519.1_8 Reverse -158 -174 13.9232 0.146
NP_442204.1_1 Reverse -166 -177 1.33697 0.274
NP_441351.1_8 Forward -181 -162 4.81767 0.22
NP_442428.1_5 Reverse -171 -178 11.4455 0.062
NP_442120.1_10 Forward -85 -66 -10.7186 0.261
NP_440673.1_3 Reverse -279 -286 9.67555 0.179
NP_443048.1_6 Forward -325 -306 16.9686 0.239
NP_441052.1_2 Forward -179 -169 5.28991 0.124
NP_442219.1_8 Forward -83 -64 8.26374 0.251
NP_440436.1_4 Forward -178 -169 4.7192 0.244
NP_442907.1_9 Forward -72 -53 2.16274 0.174
NP_441004.1_5 Forward -324 -310 8.35772 0.274
NP_442813.1_4 Reverse -347 -366 -8.85033 0.299
NP_442366.1_3 Forward -86 -68 -3.6191 0.253
NP_442139.1_10 Reverse -24 -43 19.3698 0.188
NP_440129.1_10 Reverse -127 -141 2.16287 0.271
NP_442206.1_1 Forward -121 -102 -12.7836 0.235
NP_442206.1_10 Reverse -170 -185 0.569883 0.254
NP_442430.1_10 Reverse -267 -286 10.2251 0.265
NP_440864.1_9 Forward -165 -146 -2.65548 0.177
NP_441851.1_10 Reverse -133 -143 9.22315 0.114
NP_441851.1_10 Reverse -169 -179 4.79825 0.247
NP_442011.1_1 Reverse -1 -20 1.27776 0.268
NP_442856.1_7 Reverse -161 -180 -1.37718 0.225
NP_440593.1_3 Reverse -59 -78 -4.91709 0.254
NP_441982.1_6 Reverse -317 -326 11.1485 0.288
NP_441046.1_2 Reverse -135 -154 0.0977854 0.271
NP_442689.1_8 Forward -346 -329 -1.14113 0.209
NP_441349.1_10 Reverse -66 -85 -9.53865 0.294
NP_440389.1_5 Forward -365 -346 11.2584 0.287
NP_442843.1_1 Forward -32 -13 5.89931 0.144
NP_442843.1_1 Reverse -171 -190 -9.14533 0.264
NP_442843.1_1 Forward -275 -256 -10.4236 0.278
NP_439960.1_4 Reverse -163 -182 13.3716 0.256
NP_439960.1_6 Forward -179 -160 11.6025 0.206
NP_439960.1_10 Forward -138 -120 1.88744 0.191
NP_439960.1_10 Reverse -163 -181 -0.570838 0.231
NP_440474.1_8 Forward -84 -70 5.50552 0.25
NP_440396.1_1 Reverse -251 -270 9.43923 0.141
NP_440431.1_3 Reverse -198 -217 -11.8003 0.291
NP_440588.1_2 Reverse -44 -63 -6.68705 0.289
NP_442006.1_2 Forward -319 -302 -4.97604 0.137
NP_441570.1_1 Forward -337 -319 -17.6804 0.287
NP_441078.1_4 Reverse -97 -106 -1.27858 0.246
NP_441078.1_4 Forward -106 -97 -2.06522 0.295
NP_442348.1_2 Forward -209 -200 6.5879 0.299
NP_440707.1_6 Reverse -269 -288 11.0117 0.274
NP_442443.1_1 Reverse -162 -181 -3.73712 0.267
NP_442443.1_1 Reverse -171 -190 -4.6221 0.275
NP_440526.1_3 Forward -178 -167 1.3365 0.267
NP_441432.1_8 Forward -86 -77 7.96454 0.0953
NP_441432.1_8 Reverse -169 -178 4.22796 0.235
NP_441432.1_8 Reverse -96 -105 3.14632 0.259
NP_441432.1_9 Forward -205 -192 17.0336 0.0855
NP_443024.1_3 Forward -218 -208 14.238 0.255
NP_442320.1_8 Forward -112 -98 -5.90027 0.254
NP_442320.1_8 Reverse -140 -154 -5.9986 0.261
NP_441732.1_2 Forward -135 -119 -15.2811 0.145
NP_440629.1_4 Forward -363 -344 16.5191 0.148
NP_442003.1_4 Reverse -268 -287 10.7175 0.288
NP_442157.1_9 Forward -40 -21 14.9458 0.281
NP_440760.1_1 Forward -179 -160 -8.85033 0.0807
NP_442727.1_1 Forward -331 -317 12.9793 0.256
NP_442751.1_2 Reverse -4 -23 8.06178 0.206
NP_442489.1_7 Reverse -170 -179 -1.6719 0.235
NP_442489.1_7 Reverse -76 -85 -1.86856 0.259
NP_441022.1_1 Reverse -340 -349 15.0954 0.183
NP_441022.1_1 Forward -350 -341 15.0954 0.183
NP_441092.1_1 Reverse -64 -83 14.6508 0.191
NP_442913.1_10 Reverse -275 -294 -4.22878 0.23
NP_441807.1_5 Forward -25 -6 13.2741 0.122
NP_442346.1_5 Reverse -169 -179 10.2065 0.103
NP_440486.1_6 Forward -320 -301 6.98095 0.278
NP_440459.1_2 Forward -42 -25 7.41366 0.291
NP_441943.1_8 Forward -140 -121 -12.7836 0.261
NP_441943.1_8 Reverse -125 -144 -13.6686 0.294
NP_440847.1_3 Reverse -217 -231 13.9619 0.207
NP_441888.1_7 Reverse -19 -33 8.65272 0.182
NP_441050.1_5 Reverse -131 -149 0.0191479 0.254
NP_440671.1_4 Reverse -70 -84 11.701 0.127
NP_440671.1_4 Reverse -164 -178 5.1128 0.292
NP_442199.1_5 Reverse -138 -157 -6.98204 0.284
NP_442140.1_3 Reverse -171 -181 6.37155 0.172
NP_442140.1_3 Reverse -147 -157 3.81494 0.278
NP_442723.1_1 Reverse -293 -312 9.14342 0.273
NP_442254.1_1 Reverse -35 -54 -0.000545616 0.265
NP_440590.1_4 Forward -178 -165 1.49425 0.122
NP_440590.1_4 Reverse -158 -171 -2.63565 0.247
NP_441239.1_9 Forward -64 -52 4.5622 0.251
NP_441239.1_9 Forward -376 -364 4.07055 0.264
NP_441239.1_9 Forward -181 -169 3.18557 0.292
NP_441892.1_1 Reverse -67 -84 -4.48438 0.261
NP_440665.1_2 Forward -138 -119 -0.295539 0.208
NP_440833.1_6 Reverse -190 -204 8.75042 0.272
NP_442216.1_4 Forward -142 -134 15.3586 0.255
NP_443035.1_10 Forward -381 -364 6.13536 0.273
NP_440354.1_5 Reverse -362 -381 4.916 0.204
NP_441119.1_5 Forward -81 -62 4.71934 0.259
NP_440546.1_4 Reverse -365 -375 11.6943 0.0748
NP_440546.1_4 Forward -155 -145 8.00989 0.209
NP_442041.1_5 Forward -380 -361 0.294447 0.257
NP_440462.1_6 Reverse -74 -84 3.12662 0.26
NP_440868.1_6 Reverse -116 -135 12.7825 0.261
NP_441249.1_1 Reverse -110 -129 1.57275 0.257
NP_442787.1_7 Forward -379 -360 18.6207 0.227
NP_442479.1_9 Forward -349 -330 -11.6036 0.275
NP_440402.1_3 Reverse -191 -210 4.52268 0.276
NP_442402.1_6 Forward -134 -125 15.7327 0.241
NP_441848.1_4 Reverse -331 -347 11.7523 0.215
NP_441843.2_9 Reverse -202 -220 10.8811 0.225
NP_442039.1_7 Forward -135 -125 10.4031 0.257
NP_442039.1_7 Reverse -226 -236 6.8632 0.292
NP_441811.1_1 Reverse -207 -226 5.60432 0.28
NP_441926.1_3 Reverse -76 -92 6.25339 0.17
NP_442696.1_6 Forward -125 -106 -11.9969 0.244
NP_442837.1_3 Reverse -212 -219 6.52896 0.2
NP_442360.1_5 Forward -136 -126 13.2547 0.28
NP_442532.1_4 Forward -361 -343 7.48014 0.297
NP_442532.1_7 Reverse -170 -184 10.816 0.151
NP_440914.1_1 Forward -40 -30 6.27291 0.288
NP_442533.1_6 Forward -179 -170 5.11294 0.155
NP_442533.1_6 Reverse -146 -155 3.34298 0.216
NP_442541.1_10 Reverse -266 -280 0.687325 0.3
NP_442322.1_4 Reverse -304 -321 -9.99156 0.297
NP_442229.1_9 Reverse -202 -221 20.4514 0.0621
NP_441028.1_6 Reverse -252 -262 6.0761 0.232
NP_441028.1_6 Reverse -123 -133 5.09279 0.267
NP_441028.1_6 Reverse -124 -134 3.8145 0.281
NP_441527.1_4 Forward -106 -87 -9.31089 0.256
NP_440007.1_9 Reverse -166 -180 9.34103 0.171
NP_442728.1_10 Reverse -9 -28 12.7825 0.297
NP_441680.1_4 Reverse -55 -74 -1.57384 0.265
NP_441602.1_3 Reverse -10 -29 -4.81876 0.274
NP_439903.1_6 Reverse -73 -92 1.27698 0.249
NP_440886.1_7 Forward -180 -170 8.04271 0.0805
NP_440828.1_4 Forward -180 -161 -7.76943 0.291
NP_441001.1_10 Reverse -169 -188 7.47261 0.249
NP_442614.1_2 Forward -313 -299 5.70279 0.298
NP_442072.1_9 Forward -93 -75 -22.007 0.216
NP_441808.1_6 Forward -335 -316 11.405 0.221
NP_441021.1_1 Forward -178 -159 -4.22878 0.167
NP_441463.1_2 Forward -196 -178 3.63839 0.198
NP_442893.1_6 Forward -178 -159 6.19431 0.205
NP_442794.1_1 Reverse -166 -178 5.64384 0.212
NP_442794.1_1 Forward -362 -350 3.57889 0.286
NP_442615.1_1 Reverse -67 -85 -4.8974 0.197
NP_442467.1_3 Forward -327 -313 18.1831 0.146
NP_441962.1_4 Reverse -165 -184 2.3594 0.103
NP_440387.1_1 Reverse -76 -92 -2.49807 0.148
NP_440387.1_1 Reverse -170 -186 -5.448 0.232
NP_440855.1_5 Reverse -305 -324 2.06362 0.295
NP_441993.1_1 Forward -179 -160 3.89583 0.227
NP_440114.1_10 Forward -85 -71 7.37441 0.236
NP_440114.1_10 Reverse -76 -90 5.89945 0.292
NP_440287.1_6 Reverse -275 -294 0.0977854 0.298
NP_440766.1_5 Forward -355 -343 9.9476 0.275
NP_440502.1_3 Reverse -124 -134 14.5691 0.212
NP_440457.1_1 Forward -314 -302 4.75886 0.154
NP_440798.1_7 Forward -89 -70 3.04771 0.294
NP_442297.1_4 Forward -135 -116 14.864 0.183
NP_441984.1_6 Reverse -41 -53 16.2636 0.18
NP_441332.1_6 Reverse -311 -321 15.4224 0.121
NP_440473.1_9 Forward -297 -278 -6.29373 0.228
NP_442509.1_5 Reverse -304 -321 14.7877 0.229
NP_442509.1_9 Forward -307 -297 9.71433 0.192
NP_442936.1_10 Forward -351 -337 8.30683 0.269
NP_442514.1_5 Reverse -215 -234 2.06362 0.172
NP_442514.1_5 Reverse -120 -139 -8.45774 0.285
NP_440478.1_7 Reverse -159 -178 17.404 0.25
NP_440649.2_5 Forward -353 -334 20.1573 0.135
NP_442341.1_7 Reverse -145 -159 5.80112 0.145
NP_442341.1_9 Reverse -56 -70 4.8172 0.291
NP_441756.1_5 Reverse -1 -20 -1.18052 0.253
NP_440750.1_3 Forward -30 -11 31.7604 0.000178
NP_443000.1_7 Reverse -168 -178 7.35486 0.0859
NP_440507.2_3 Forward -170 -151 8.35677 0.253
NP_442513.1_5 Forward -26 -7 11.5033 0.266
NP_440679.1_10 Reverse -163 -182 -21.7317 0.297
NP_443010.1_7 Forward -182 -163 11.11 0.278
NP_441359.1_5 Forward -309 -290 1.17943 0.29
NP_439962.1_6 Reverse -160 -178 7.29564 0.287
NP_441105.1_3 Reverse -65 -84 -6.1954 0.23
NP_441105.1_3 Reverse -159 -178 -8.06369 0.265
NP_440216.1_9 Reverse -226 -235 7.66954 0.286
NP_440172.1_1 Forward -85 -75 6.96153 0.0959
NP_440167.1_3 Reverse -160 -179 12.5858 0.198
NP_441226.1_7 Forward -120 -113 8.29857 0.205
NP_442379.1_9 Forward -287 -273 19.0758 0.217
NP_440416.1_9 Forward -80 -61 -17.7985 0.247
NP_443052.1_8 Forward -320 -301 -12.8819 0.267
NP_440072.1_5 Forward -320 -302 -0.669169 0.244
NP_442116.1_6 Forward -385 -368 5.39969 0.299
NP_442154.1_1 Forward -321 -303 -19.1554 0.291
NP_442564.1_10 Forward -138 -124 8.75105 0.296
NP_440261.1_5 Forward -285 -272 -6.86388 0.201
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTAGGTAATGATCTGATGTTCCTGAAACAGATGGCTCCCCAACAATATGGCAAAACTTTTGTTGAAGTTCGTCCTTTTTGGGGACTGGGGGGCGGTGAACCGACAGTGGAAGTCCGCAATGGTCTGGAACTGGTTAGTTTGGGGGTCAACAGTTTTCAGACTAAGTTTGCCACGGGTCAATGGGATCAATTGGGCATTAGTCTATTTTTTGTAGGCATTTCTGCCATCACCAGTGCCGCTTCTGTAGCTATGGGCATATCATTCCCCCTGGGGAAAGACACCCAACGCTCCTACGACGAAAGCCATAAGGAGAAAGTCAATCGCTTTTTCCAACGGGCCCGCATGACCCTGACCCAAATGCACGATGAGCAACAGCAGGAGTTGCTGGAACCCGGCGCTG

CDS

ATGATGATAATTTGCTGGAGGATGACTATGAGTTTGGCCGATATAACTGATTTCAGTGAAGCCTTAGCTCTGTTAGGGTTATATGAGCGGGAGGTGATGACCACGGGCGTTATGGAGTATGTGGTTCCCCCGAAGGTGCCAGCAAAACCAGCGCCAGTACCTGATTCAGTGGCTAGTCCTAGCCCCCCTAACGAACAAGCATCTTCACACCCCCCGGCAAATATTCCCCAGGATACACCGGCTCTTCCAGAAGCAACCCCAACTTCAAGCCCAGTAAACAATACCACCATCAATGAGGGCATCATCATTGTCAATGGCGTTCATGACTCAGAAGATGGCAATGAACCACCATCTCAGATTCAAAAAGTCGATGCTTCGCAAGAAACATTACCATTGCCAACCCCTGGACCTTCGGAGTTGGAGCTATTGCTTGAACAACAGCAGGTGGAAAAGCGTTTGTTCTACCTTTTTGTTGAGGAGATAGAAAAAACTGGTGATTTAGGAAAATTACCGGTGGCTTTGCAACCAACCGGCAAGAGCTAA

Protein

No sequence available