Your browser is old and dusty. Try Google Chrome!

Details for slr7099

ORF slr7099
Accession NP_942387.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -233 -247 22.3207 0.00505
NP_440795.1_7 Forward -240 -233 14.6904 0.0123
NP_440795.1_7 Reverse -233 -240 14.6904 0.0123
NP_441418.1_6 Reverse -232 -251 -9.83364 0.0294
NP_442291.1_5 Reverse -231 -247 -0.531451 0.185
NP_442291.1_5 Forward -242 -226 -3.08806 0.234
NP_441453.1_4 Reverse -232 -240 16.539 0.00633
NP_441453.1_4 Forward -241 -233 16.539 0.00633
NP_441453.1_7 Reverse -349 -356 11.9372 0.298
NP_442151.1_6 Forward -241 -227 14.7492 0.032
NP_442151.1_6 Reverse -232 -246 10.226 0.127
NP_441818.1_1 Reverse -233 -244 10.1862 0.232
NP_441818.1_9 Forward -283 -264 -10.9153 0.299
NP_440226.1_1 Forward -241 -222 6.88262 0.118
NP_442623.1_3 Reverse -233 -252 -10.7186 0.193
NP_440150.1_2 Reverse -234 -253 8.75009 0.221
NP_442744.1_8 Reverse -238 -257 -1.27885 0.269
NP_442173.1_1 Forward -240 -232 15.4574 0.00633
NP_442173.1_1 Reverse -233 -241 15.4574 0.00633
NP_442752.1_4 Forward -241 -234 13.8055 0.0199
NP_442752.1_4 Reverse -232 -239 13.8055 0.0199
NP_442752.1_4 Forward -98 -91 9.47889 0.109
NP_443027.1_4 Forward -243 -233 14.0414 0.0452
NP_443027.1_4 Reverse -230 -240 7.25653 0.24
NP_441812.1_1 Forward -116 -102 16.8135 0.188
NP_441812.1_3 Forward -242 -228 10.4227 0.222
NP_442975.1_10 Reverse -228 -242 18.3868 0.00755
NP_442975.1_10 Forward -245 -231 4.91554 0.234
NP_440784.1_7 Forward -240 -233 15.9687 0.0123
NP_440784.1_7 Reverse -233 -240 15.9687 0.0123
NP_442909.1_7 Reverse -233 -247 10.8154 0.131
NP_440061.1_9 Reverse -230 -244 9.53707 0.143
NP_442062.1_8 Reverse -232 -242 17.3846 0.00193
NP_442062.1_8 Forward -241 -231 10.3048 0.0493
NP_441859.1_3 Reverse -231 -250 2.26028 0.263
NP_440304.1_4 Forward -243 -233 10.8948 0.051
NP_440304.1_4 Reverse -230 -240 10.8948 0.051
NP_440304.1_4 Reverse -176 -186 6.27322 0.167
NP_442242.1_4 Forward -240 -233 14.3954 0.0124
NP_442242.1_4 Reverse -233 -240 14.3954 0.0124
NP_440044.1_8 Forward -240 -221 4.916 0.107
NP_440044.1_8 Reverse -233 -252 -2.95047 0.274
NP_441581.1_5 Forward -138 -119 14.4445 0.288
NP_441208.1_9 Reverse -229 -243 6.88276 0.229
NP_441594.1_6 Forward -250 -231 2.16274 0.255
NP_441594.1_6 Forward -334 -315 0.982764 0.276
NP_442110.1_7 Reverse -232 -246 10.7177 0.0644
NP_442110.1_7 Forward -241 -227 1.57289 0.222
NP_442896.1_3 Reverse -205 -219 22.6157 0.0695
NP_441083.1_5 Reverse -232 -242 20.3345 0.00053
NP_441083.1_5 Forward -241 -231 11.2881 0.0159
NP_441738.1_2 Forward -239 -232 15.28 0.0102
NP_441738.1_2 Reverse -234 -241 15.28 0.0102
NP_441558.1_5 Forward -243 -224 4.52268 0.28
NP_441558.1_5 Reverse -236 -255 3.93269 0.294
NP_440209.1_1 Reverse -232 -240 18.1123 0.00295
NP_440209.1_1 Forward -241 -233 18.1123 0.00295
NP_442765.1_2 Forward -300 -281 5.70265 0.239
NP_442889.1_8 Reverse -229 -243 7.86545 0.14
NP_441713.1_1 Forward -247 -228 -6.29373 0.118
NP_441770.1_5 Reverse -224 -243 1.47442 0.238
NP_440178.1_7 Forward -242 -223 -21.24 0.215
NP_440687.1_6 Forward -320 -302 24.0119 0.028
NP_440538.1_10 Reverse -79 -98 13.7658 0.235
NP_441716.1_1 Reverse -232 -246 19.4691 0.00947
NP_442111.1_4 Reverse -231 -245 9.34103 0.0609
NP_442111.1_4 Forward -242 -228 8.65272 0.0709
NP_441163.1_9 Reverse -257 -276 11.8975 0.292
NP_440906.1_5 Forward -240 -233 15.8704 0.0124
NP_440906.1_5 Reverse -233 -240 15.8704 0.0124
NP_440747.1_10 Forward -244 -232 17.2469 0.000522
NP_440747.1_10 Reverse -229 -241 5.54551 0.0128
NP_441130.1_10 Forward -243 -229 7.47274 0.158
NP_442973.1_5 Forward -250 -231 14.4541 0.14
NP_441486.1_1 Reverse -229 -243 12.291 0.0126
NP_441486.1_1 Forward -244 -230 6.3911 0.0344
NP_442634.1_4 Reverse -230 -244 7.47274 0.0479
NP_442634.1_4 Reverse -176 -190 -5.80194 0.279
NP_441639.1_3 Forward -242 -223 2.85105 0.264
NP_440403.1_10 Forward -250 -231 0.58944 0.3
NP_442848.1_1 Forward -247 -233 8.06273 0.0791
NP_441012.1_4 Forward -245 -232 7.49244 0.272
NP_443018.1_3 Forward -240 -233 14.8871 0.0123
NP_443018.1_3 Reverse -233 -240 14.8871 0.0123
NP_441634.1_8 Forward -243 -229 2.85119 0.16
NP_440376.1_1 Forward -241 -232 19.4693 0.000692
NP_440376.1_1 Reverse -232 -241 19.4693 0.000692
NP_441588.1_4 Forward -239 -229 6.96153 0.178
NP_442687.1_7 Reverse -231 -241 9.02648 0.0994
NP_442687.1_7 Forward -242 -232 8.92815 0.0994
NP_442946.1_5 Forward -332 -314 20.2753 0.0988
NP_440642.1_10 Forward -132 -118 7.3738 0.221
NP_440642.1_10 Forward -85 -71 2.8506 0.277
NP_442296.1_9 Reverse -272 -291 -3.73712 0.257
NP_440236.1_2 Reverse -194 -212 4.9357 0.243
NP_442720.1_5 Reverse -192 -211 15.5357 0.234
NP_442658.1_1 Reverse -230 -240 13.0576 0.04
NP_442658.1_1 Forward -243 -233 6.76441 0.214
NP_440141.1_4 Reverse -235 -254 -7.17871 0.298
NP_441855.2_4 Forward -249 -230 9.61947 0.275
NP_442782.1_7 Forward -249 -230 12.0942 0.0929
NP_442205.1_9 Reverse -226 -242 -1.61309 0.264
NP_441256.1_1 Forward -295 -276 -6.88371 0.239
NP_441256.1_1 Reverse -268 -287 -9.34199 0.282
NP_442937.1_5 Forward -252 -233 8.25926 0.229
NP_441958.1_5 Reverse -231 -241 21.2195 0.000805
NP_441958.1_5 Forward -242 -232 12.2714 0.00183
NP_440203.1_5 Reverse -235 -245 15.7125 0.0611
NP_443001.1_7 Forward -253 -234 3.04771 0.279
NP_440995.1_3 Forward -119 -101 15.9488 0.168
NP_440984.1_7 Reverse -227 -241 17.9942 0.0178
NP_439990.1_5 Forward -246 -233 11.3273 0.128
NP_442911.1_2 Forward -251 -232 5.211 0.0344
NP_440153.1_5 Forward -240 -226 6.19444 0.191
NP_440153.1_5 Reverse -233 -247 5.80112 0.191
NP_440858.1_1 Forward -181 -162 -3.93378 0.27
NP_442064.1_4 Forward -251 -232 5.2102 0.274
NP_440138.1_6 Reverse -233 -252 5.50519 0.23
NP_441099.1_5 Forward -251 -232 0.0977854 0.0846
NP_442032.1_2 Forward -156 -137 12.3892 0.0952
NP_440809.1_9 Reverse -223 -241 -7.94566 0.225
NP_441294.1_7 Reverse -228 -242 18.4655 0.00537
NP_441504.1_2 Forward -206 -189 10.3636 0.258
NP_441646.1_1 Forward -248 -229 1.76941 0.228
NP_442438.1_10 Forward -246 -232 8.84938 0.0718
NP_441000.1_6 Forward -242 -228 -5.40861 0.275
NP_440147.1_4 Reverse -230 -243 12.9006 0.0326
NP_440147.1_4 Forward -243 -230 1.59258 0.224
NP_441550.1_8 Reverse -230 -240 15.3192 0.0132
NP_441550.1_8 Forward -243 -233 12.3692 0.0336
NP_441916.1_7 Forward -241 -231 18.9579 0.00144
NP_441916.1_7 Reverse -232 -242 10.3048 0.0261
NP_440345.1_3 Forward -161 -147 17.9641 0.161
NP_441041.1_7 Reverse -126 -138 9.45833 0.111
NP_441041.1_7 Reverse -229 -241 8.38938 0.137
NP_441547.1_2 Forward -252 -234 25.5852 0.00906
NP_442004.1_6 Reverse -232 -246 8.45605 0.14
NP_442004.1_6 Reverse -79 -93 6.88276 0.17
NP_442004.1_6 Reverse -83 -97 1.96621 0.276
NP_441725.1_4 Forward -246 -232 3.63724 0.278
NP_441725.1_5 Reverse -233 -243 11.2881 0.0247
NP_441725.1_5 Forward -240 -230 1.94665 0.115
NP_439966.1_7 Forward -243 -233 15.8108 0.0124
NP_439966.1_7 Reverse -230 -240 6.27276 0.185
NP_439966.1_7 Reverse -87 -97 5.38779 0.226
NP_442941.1_3 Reverse -233 -243 19.9412 0.00262
NP_442941.1_3 Forward -240 -230 11.0914 0.0116
NP_440289.1_2 Forward -244 -231 -3.02898 0.263
NP_440289.1_2 Reverse -229 -242 -4.79893 0.294
NP_440260.1_8 Forward -257 -239 -5.68405 0.276
NP_442281.1_1 Forward -246 -232 17.6002 0.00542
NP_442281.1_1 Reverse -227 -241 9.34041 0.0717
NP_440395.1_9 Forward -256 -237 20.059 0.212
NP_442256.1_2 Forward -243 -225 0.707465 0.115
NP_442012.1_1 Forward -247 -228 -1.67217 0.294
NP_440498.1_1 Reverse -223 -241 -1.45582 0.225
NP_441644.1_6 Forward -241 -231 19.0557 0.000803
NP_441644.1_6 Reverse -232 -242 17.3841 0.00127
NP_441644.1_6 Reverse -238 -248 6.96107 0.141
NP_442215.1_2 Reverse -230 -246 5.27008 0.0796
NP_442215.1_2 Forward -256 -240 -2.10475 0.192
NP_442215.1_2 Forward -250 -234 -4.66135 0.237
NP_442029.1_1 Reverse -236 -255 -17.0118 0.272
NP_440253.1_2 Reverse -232 -250 -2.24246 0.262
NP_440929.1_8 Forward -241 -232 19.2726 0.000701
NP_440929.1_8 Reverse -232 -241 19.2726 0.000701
NP_441346.1_7 Forward -141 -122 12.2908 0.203
NP_442933.1_10 Forward -241 -232 17.601 0.00325
NP_442933.1_10 Reverse -232 -241 17.601 0.00325
NP_441310.1_9 Reverse -148 -167 1.47442 0.217
NP_441751.2_8 Reverse -233 -247 17.6992 0.00776
NP_442554.1_8 Forward -240 -230 16.4013 0.0065
NP_442554.1_8 Reverse -233 -243 15.9097 0.00747
NP_442554.1_8 Reverse -239 -249 3.61828 0.218
NP_442554.1_8 Forward -186 -176 3.42162 0.226
NP_442970.1_1 Reverse -364 -378 9.7518 0.269
NP_441762.1_7 Forward -242 -230 0.333971 0.0747
NP_441762.1_7 Reverse -231 -243 -6.74586 0.284
NP_442142.1_4 Forward -244 -231 16.0466 0.0264
NP_442142.1_4 Reverse -229 -242 2.47701 0.29
NP_442292.1_1 Reverse -233 -242 18.486 0.00229
NP_442292.1_1 Forward -240 -231 17.5026 0.00435
NP_442292.1_1 Forward -186 -177 2.65466 0.219
NP_443009.1_5 Forward -242 -231 14.5128 0.02
NP_443009.1_5 Reverse -231 -242 10.1862 0.0792
NP_443009.1_5 Reverse -256 -267 4.28642 0.254
NP_443009.1_5 Reverse -128 -139 3.40144 0.296
NP_441715.1_4 Reverse -233 -243 14.828 0.0268
NP_441715.1_4 Forward -240 -230 7.35486 0.108
NP_440730.1_4 Forward -281 -262 -4.72043 0.298
NP_441198.1_8 Reverse -230 -240 12.783 0.116
NP_441468.1_1 Forward -240 -233 15.8704 0.0124
NP_441468.1_1 Reverse -233 -240 15.8704 0.0124
NP_441015.1_10 Reverse -227 -246 -7.27704 0.265
NP_441015.1_10 Reverse -233 -252 -11.6036 0.298
NP_441673.1_1 Forward -241 -232 20.8459 0.000698
NP_441673.1_1 Reverse -232 -241 20.8459 0.000698
NP_441731.1_3 Forward -249 -230 -5.60541 0.284
NP_441956.1_9 Reverse -231 -250 8.45592 0.25
NP_441826.1_2 Forward -247 -233 21.9274 0.00378
NP_441330.1_1 Reverse -227 -246 -12.8819 0.183
NP_442490.1_9 Forward -253 -234 -1.18052 0.181
NP_441764.1_8 Reverse -204 -214 13.8947 0.284
NP_442868.1_6 Forward -243 -233 9.91146 0.038
NP_442868.1_6 Reverse -230 -240 0.963343 0.205
NP_442719.1_2 Forward -145 -127 -7.84802 0.239
NP_441056.1_1 Reverse -232 -251 4.71934 0.117
NP_441612.1_2 Reverse -232 -242 8.54929 0.21
NP_442227.1_2 Reverse -84 -103 -3.54046 0.293
NP_442361.1_3 Forward -247 -234 7.59077 0.3
NP_442427.1_8 Reverse -223 -242 11.9958 0.152
NP_442808.1_1 Reverse -231 -241 8.73102 0.0481
NP_442808.1_1 Forward -242 -232 8.63269 0.0481
NP_442050.1_5 Forward -243 -233 16.4991 0.00812
NP_442050.1_5 Reverse -230 -240 9.22267 0.193
NP_440558.1_2 Forward -250 -231 -1.08219 0.208
NP_441878.1_6 Reverse -231 -241 10.5014 0.0176
NP_441878.1_6 Forward -242 -232 10.4031 0.0176
NP_441036.1_8 Reverse -231 -241 15.713 0.00724
NP_441036.1_8 Forward -242 -232 8.33817 0.174
NP_442650.1_2 Reverse -232 -246 6.58777 0.13
NP_441557.1_5 Forward -241 -232 19.9609 0.000699
NP_441557.1_5 Reverse -232 -241 19.9609 0.000699
NP_441445.1_1 Reverse -223 -242 2.45773 0.233
NP_440101.1_3 Reverse -227 -246 3.14605 0.237
NP_442183.1_1 Reverse -232 -246 16.3225 0.0151
NP_442183.1_1 Forward -353 -339 9.43936 0.098
NP_440595.1_8 Reverse -232 -251 15.4374 0.156
NP_441549.1_9 Forward -245 -227 -8.63398 0.234
NP_442347.1_2 Reverse -233 -242 12.4878 0.056
NP_442347.1_2 Forward -160 -151 7.96454 0.122
NP_442347.1_2 Forward -240 -231 3.34298 0.284
NP_442645.1_2 Forward -249 -230 -17.6018 0.259
NP_442645.1_2 Reverse -230 -249 -19.1751 0.285
NP_441037.1_4 Reverse -230 -240 15.0168 0.028
NP_442594.1_7 Forward -252 -233 10.52 0.186
NP_441633.1_3 Forward -243 -230 -6.07724 0.236
NP_441633.1_3 Reverse -230 -243 -6.07724 0.236
NP_440136.1_1 Reverse -352 -368 11.9559 0.238
NP_440136.1_2 Forward -240 -233 15.9687 0.0123
NP_440136.1_2 Reverse -233 -240 15.9687 0.0123
NP_442998.1_5 Reverse -126 -136 11.4848 0.184
NP_442998.1_10 Forward -239 -232 15.5754 0.0102
NP_442998.1_10 Reverse -234 -241 15.5754 0.0102
NP_440299.1_1 Forward -245 -232 22.3398 0.000547
NP_441799.1_1 Reverse -228 -242 18.4851 0.0085
NP_441799.1_1 Forward -245 -231 6.29216 0.176
NP_441007.1_10 Reverse -227 -240 1.39592 0.203
NP_441007.1_10 Forward -246 -233 -0.865694 0.295
NP_440256.1_1 Forward -244 -225 12.8808 0.0109
NP_440256.1_1 Reverse -229 -248 -10.227 0.297
NP_441090.1_6 Reverse -238 -252 14.9459 0.125
NP_441559.1_8 Forward -246 -232 -6.68692 0.279
NP_440915.1_6 Forward -245 -231 12.8809 0.0206
NP_442866.1_1 Reverse -227 -246 -1.67217 0.204
NP_441199.1_6 Reverse -228 -247 1.86774 0.207
NP_439985.1_7 Reverse -265 -284 6.58763 0.192
NP_440677.1_6 Forward -250 -231 15.2408 0.141
NP_442386.1_9 Forward -242 -233 13.8639 0.0289
NP_442386.1_9 Reverse -231 -240 6.39082 0.219
NP_442386.1_10 Reverse -283 -296 4.93583 0.262
NP_441340.1_5 Forward -240 -233 15.6737 0.0124
NP_441340.1_5 Reverse -233 -240 15.6737 0.0124
NP_441340.1_9 Forward -67 -57 7.38756 0.27
NP_441947.1_4 Reverse -221 -240 13.0775 0.223
NP_440586.1_8 Forward -240 -233 13.2151 0.026
NP_440586.1_8 Reverse -233 -240 13.2151 0.026
NP_440586.1_8 Reverse -239 -246 5.8403 0.283
NP_442251.1_6 Forward -240 -233 15.2804 0.0124
NP_442251.1_6 Reverse -233 -240 15.2804 0.0124
NP_440684.1_9 Forward -247 -233 15.2409 0.0988
NP_441262.1_3 Reverse -232 -239 14.7888 0.0223
NP_441262.1_3 Forward -241 -234 14.7888 0.0223
NP_440027.1_8 Forward -244 -225 5.89851 0.279
NP_443051.1_1 Reverse -231 -240 19.5676 0.00335
NP_443051.1_1 Forward -242 -233 10.4228 0.00754
NP_439937.1_9 Forward -242 -225 -14.5148 0.287
NP_440408.1_7 Reverse -232 -251 7.66927 0.284
NP_440439.1_1 Forward -244 -231 7.00078 0.0703
NP_440439.1_1 Reverse -229 -242 4.34585 0.104
NP_439943.1_1 Forward -253 -234 -11.3086 0.29
NP_440372.1_2 Forward -240 -233 16.3621 0.0124
NP_440372.1_2 Reverse -233 -240 16.3621 0.0124
NP_441181.1_6 Reverse -233 -251 3.16574 0.283
NP_441803.1_2 Forward -246 -227 5.40766 0.17
NP_440139.1_1 Reverse -226 -245 2.75194 0.224
NP_441572.1_7 Forward -247 -228 -1.57384 0.188
NP_442549.1_3 Forward -291 -272 7.96426 0.271
NP_442384.1_10 Reverse -232 -245 17.4239 0.00585
NP_442384.1_10 Forward -241 -228 8.08242 0.0692
NP_442384.1_10 Forward -280 -267 1.88757 0.243
NP_442114.1_8 Forward -17 -3 7.17714 0.234
NP_441877.1_7 Reverse -261 -280 6.1935 0.218
NP_441018.1_7 Forward -251 -232 7.07928 0.277
NP_441018.1_7 Reverse -228 -247 6.68596 0.283
NP_442790.1_4 Forward -250 -231 0.687771 0.0876
NP_442262.1_10 Forward -240 -233 14.1988 0.0123
NP_442262.1_10 Reverse -233 -240 14.1988 0.0123
NP_441689.1_5 Forward -243 -233 15.3192 0.0403
NP_441689.1_5 Reverse -230 -240 8.3377 0.132
NP_441689.1_5 Reverse -77 -87 5.58445 0.23
NP_440163.1_10 Forward -244 -234 12.4681 0.159
NP_440344.1_10 Forward -248 -231 -7.23765 0.116
NP_440344.1_10 Reverse -225 -242 -7.23765 0.116
NP_440531.1_6 Forward -295 -276 -2.0655 0.244
NP_442910.1_1 Forward -248 -229 2.16274 0.119
NP_441965.1_3 Forward -251 -232 1.37609 0.221
NP_441640.1_8 Reverse -233 -252 -4.22878 0.26
NP_440297.1_9 Reverse -233 -243 9.32148 0.0917
NP_440297.1_9 Forward -240 -230 -0.216628 0.282
NP_440350.1_5 Forward -212 -193 -5.80207 0.292
NP_441592.1_4 Reverse -232 -251 -2.55715 0.265
NP_441896.1_1 Forward -261 -242 7.66846 0.263
NP_440834.1_6 Forward -338 -319 11.9958 0.206
NP_440999.1_9 Forward -245 -231 0.786239 0.177
NP_440999.1_9 Forward -191 -177 -2.16369 0.261
NP_440888.1_2 Reverse -232 -246 15.8302 0.00862
NP_440888.1_2 Forward -241 -227 8.16044 0.171
NP_440888.1_2 Forward -60 -46 6.78381 0.22
NP_440888.1_2 Forward -187 -173 6.58715 0.228
NP_440600.1_4 Reverse -224 -242 -0.275845 0.148
NP_442948.1_2 Reverse -231 -250 13.6675 0.113
NP_441543.1_2 Reverse -233 -242 16.9127 0.00359
NP_441543.1_2 Forward -240 -231 15.9293 0.00518
NP_442845.1_2 Forward -247 -233 14.7492 0.0774
NP_442845.1_2 Reverse -226 -240 11.0127 0.138
NP_442845.1_2 Reverse -232 -246 7.76774 0.195
NP_441319.1_8 Forward -247 -229 6.80398 0.27
NP_441469.1_8 Reverse -231 -240 6.5879 0.227
NP_441469.1_8 Forward -242 -233 6.48957 0.227
NP_443064.1_6 Reverse -232 -242 12.5669 0.0796
NP_443064.1_6 Forward -241 -231 10.8217 0.13
NP_442578.1_7 Forward -240 -233 14.5921 0.026
NP_442578.1_7 Reverse -233 -240 14.5921 0.026
NP_441462.1_2 Forward -241 -231 20.2362 0.000805
NP_441462.1_2 Reverse -232 -242 11.5831 0.00406
NP_443062.1_1 Reverse -232 -250 6.20575 0.206
NP_442204.1_1 Forward -245 -234 9.69511 0.0736
NP_442204.1_1 Reverse -228 -239 6.74518 0.152
NP_442204.1_5 Reverse -222 -241 3.44104 0.19
NP_440544.1_5 Forward -79 -72 14.5681 0.264
NP_440516.1_2 Forward -247 -229 4.83737 0.137
NP_440516.1_8 Forward -241 -232 16.9127 0.00442
NP_440516.1_8 Reverse -232 -241 16.9127 0.00442
NP_442428.1_5 Forward -240 -233 15.8704 0.0124
NP_442428.1_5 Reverse -233 -240 15.8704 0.0124
NP_441443.1_7 Reverse -274 -293 -3.63879 0.299
NP_441664.1_1 Forward -300 -281 11.3067 0.203
NP_442120.1_10 Reverse -272 -291 -14.2585 0.288
NP_440673.1_3 Forward -239 -232 12.4288 0.0426
NP_440673.1_3 Reverse -234 -241 12.4288 0.0426
NP_440865.1_9 Reverse -226 -245 -9.14533 0.277
NP_441052.1_2 Reverse -232 -242 19.9412 0.00106
NP_441052.1_2 Forward -241 -231 10.4031 0.0285
NP_441052.1_2 Reverse -238 -248 4.69992 0.149
NP_442219.1_8 Reverse -234 -253 7.49067 0.267
NP_442219.1_9 Reverse -233 -242 17.7976 0.00718
NP_442219.1_9 Forward -240 -231 8.25953 0.0681
NP_440436.1_4 Reverse -233 -242 17.2072 0.00233
NP_440436.1_4 Forward -240 -231 9.24241 0.0871
NP_441719.1_4 Forward -240 -233 16.3621 0.0124
NP_441719.1_4 Reverse -233 -240 16.3621 0.0124
NP_441719.1_6 Forward -141 -122 7.4718 0.269
NP_441004.1_1 Reverse -239 -258 -17.8968 0.295
NP_442366.1_3 Reverse -231 -249 16.3421 0.0198
NP_442366.1_3 Forward -242 -224 -5.58572 0.289
NP_442366.1_5 Reverse -229 -239 17.2858 0.0141
NP_440129.1_10 Forward -248 -234 6.98109 0.177
NP_442206.1_10 Reverse -232 -247 6.27308 0.178
NP_440328.1_4 Forward -247 -228 5.11266 0.154
NP_440094.1_2 Reverse -233 -252 -1.86883 0.281
NP_443054.1_2 Forward -243 -229 1.37622 0.247
NP_440508.1_4 Forward -247 -228 11.4058 0.256
NP_441851.1_10 Forward -242 -232 15.8113 0.00552
NP_441851.1_10 Reverse -231 -241 8.53483 0.114
NP_442515.1_1 Forward -242 -228 3.04785 0.125
NP_442515.1_1 Reverse -271 -285 2.06454 0.143
NP_442515.1_1 Reverse -151 -165 -0.393733 0.222
NP_441683.1_7 Reverse -194 -213 -12.0953 0.284
NP_440593.1_3 Reverse -233 -252 -7.37537 0.293
NP_441982.1_6 Forward -156 -147 10.289 0.297
NP_440165.1_5 Reverse -231 -250 -7.57203 0.27
NP_441046.1_9 Forward -256 -237 18.4857 0.167
NP_441349.1_10 Forward -251 -232 10.5209 0.0232
NP_441349.1_10 Reverse -222 -241 8.25926 0.0277
NP_441409.1_6 Forward -247 -228 -7.27704 0.146
NP_441409.1_6 Reverse -226 -245 -8.65367 0.172
NP_440432.1_9 Forward -240 -225 -3.06836 0.179
NP_442450.1_5 Forward -243 -233 9.32148 0.115
NP_442450.1_5 Reverse -230 -240 7.64985 0.13
NP_440588.1_2 Forward -250 -231 14.9458 0.0144
NP_440588.1_2 Reverse -223 -242 -1.18052 0.155
NP_441570.1_1 Reverse -232 -250 -8.04399 0.101
NP_441570.1_1 Reverse -136 -154 -9.91228 0.153
NP_441570.1_1 Forward -241 -223 -17.4838 0.278
NP_441078.1_4 Forward -241 -232 19.6659 0.0007
NP_441078.1_4 Reverse -232 -241 19.6659 0.0007
NP_442729.1_8 Forward -245 -232 8.37742 0.125
NP_441539.1_1 Reverse -53 -67 11.5037 0.285
NP_440526.1_3 Reverse -233 -244 7.92465 0.126
NP_441432.1_8 Reverse -231 -240 16.8143 0.00595
NP_441432.1_8 Forward -242 -233 16.8143 0.00595
NP_442320.1_8 Forward -247 -233 3.44117 0.0617
NP_442320.1_8 Reverse -226 -240 -2.85201 0.1
NP_441732.1_2 Forward -245 -229 2.22182 0.0253
NP_441732.1_2 Reverse -228 -244 1.73016 0.0299
NP_440629.1_6 Forward -247 -228 12.2126 0.289
NP_442797.1_7 Reverse -264 -282 -0.669169 0.284
NP_440199.1_10 Forward -244 -234 7.64985 0.231
NP_440713.1_4 Forward -251 -232 5.70265 0.204
NP_440713.1_9 Reverse -286 -305 16.3224 0.197
NP_442489.1_7 Forward -241 -232 20.1576 0.000695
NP_442489.1_7 Reverse -232 -241 20.1576 0.000695
NP_440559.1_1 Reverse -233 -242 17.4043 0.00658
NP_440559.1_1 Forward -240 -231 8.65285 0.0586
NP_441659.2_8 Forward -241 -231 20.9245 0.000805
NP_441659.2_8 Reverse -232 -242 18.1713 0.00133
NP_442913.1_10 Reverse -223 -242 6.58763 0.0585
NP_442008.1_2 Reverse -229 -248 11.2092 0.128
NP_442346.1_5 Forward -242 -232 16.6963 0.00248
NP_442346.1_5 Reverse -231 -241 16.303 0.00248
NP_442346.1_5 Reverse -237 -247 9.51814 0.118
NP_440545.1_3 Reverse -228 -245 13.0185 0.0189
NP_440545.1_3 Forward -245 -228 -1.43612 0.168
NP_440486.1_6 Reverse -231 -250 14.4541 0.207
NP_440486.1_6 Forward -254 -235 13.7658 0.207
NP_440010.1_4 Reverse -228 -247 -0.984623 0.267
NP_442603.1_7 Reverse -232 -246 17.5018 0.0211
NP_441888.1_7 Forward -271 -257 9.04604 0.168
NP_441888.1_7 Forward -246 -232 3.53951 0.225
NP_441833.1_4 Forward -240 -233 15.9687 0.0124
NP_441833.1_4 Reverse -233 -240 15.9687 0.0124
NP_442162.1_9 Forward -240 -233 16.2637 0.0124
NP_442162.1_9 Reverse -233 -240 16.2637 0.0124
NP_440671.1_4 Forward -247 -233 21.5341 0.00306
NP_442404.1_9 Forward -325 -311 11.897 0.263
NP_442821.1_3 Forward -157 -138 8.55425 0.254
NP_442140.1_3 Forward -240 -230 6.66654 0.159
NP_442140.1_3 Reverse -239 -249 5.97822 0.189
NP_442140.1_3 Reverse -233 -243 4.40493 0.243
NP_441813.1_5 Forward -243 -233 15.9097 0.01
NP_441813.1_5 Reverse -230 -240 8.63316 0.0367
NP_440594.1_5 Reverse -130 -149 4.62021 0.293
NP_440590.1_4 Forward -240 -227 1.29759 0.127
NP_440590.1_4 Reverse -233 -246 -2.93064 0.251
NP_440567.1_1 Reverse -233 -247 10.226 0.0385
NP_440567.1_1 Forward -240 -226 9.43936 0.0442
NP_442497.1_10 Forward -240 -231 17.601 0.00813
NP_442497.1_10 Reverse -233 -242 10.4228 0.0087
NP_440821.1_4 Forward -243 -233 18.2696 0.00448
NP_440821.1_4 Reverse -230 -240 2.24165 0.131
NP_441239.1_9 Reverse -230 -242 11.1504 0.0648
NP_441239.1_9 Forward -243 -231 4.36554 0.253
NP_442568.1_8 Reverse -195 -209 8.75105 0.28
NP_441727.1_3 Reverse -225 -244 15.9291 0.116
NP_441892.1_1 Reverse -223 -240 1.12048 0.157
NP_442399.1_3 Reverse -196 -215 9.11495 0.291
NP_440604.1_6 Reverse -232 -251 -3.3438 0.225
NP_441874.1_1 Forward -251 -237 17.3058 0.165
NP_440876.1_5 Forward -79 -60 4.81767 0.283
NP_440354.1_5 Reverse -229 -248 4.42435 0.212
NP_440391.1_7 Forward -210 -191 5.99684 0.276
NP_440546.1_4 Forward -241 -231 13.5365 0.0459
NP_440546.1_4 Reverse -232 -242 10.046 0.109
NP_441230.1_5 Reverse -227 -246 7.07928 0.166
NP_440462.1_6 Reverse -230 -240 10.5014 0.0396
NP_440462.1_6 Forward -243 -233 7.74818 0.0699
NP_442565.1_6 Reverse -325 -339 15.8309 0.28
NP_440868.1_4 Reverse -228 -240 15.4769 0.0164
NP_440868.1_4 Forward -245 -233 6.1355 0.0878
NP_441879.1_3 Reverse -233 -252 12.5858 0.0606
NP_439948.1_2 Forward -23 -5 15.6627 0.259
NP_442460.1_7 Forward -253 -234 -1.37718 0.292
NP_442358.1_6 Reverse -196 -214 9.45892 0.223
NP_442039.1_4 Forward -240 -233 15.1821 0.0124
NP_442039.1_4 Reverse -233 -240 15.1821 0.0124
NP_442837.1_3 Forward -240 -233 15.7721 0.0124
NP_442837.1_3 Reverse -233 -240 15.7721 0.0124
NP_442053.1_1 Forward -241 -232 18.3876 0.0007
NP_442053.1_1 Reverse -232 -241 18.3876 0.0007
NP_440505.1_3 Forward -243 -233 16.303 0.00696
NP_440505.1_3 Reverse -230 -240 8.04317 0.147
NP_441252.1_6 Forward -141 -134 11.6422 0.288
NP_441203.1_1 Reverse -233 -252 -20.0601 0.297
NP_441408.2_7 Reverse -230 -249 -4.13045 0.279
NP_440914.1_1 Reverse -232 -242 17.5935 0.000537
NP_440914.1_1 Forward -241 -231 16.3248 0.00196
NP_441011.1_8 Forward -240 -231 16.6177 0.00602
NP_441011.1_8 Reverse -233 -242 8.25953 0.144
NP_442101.1_10 Reverse -224 -243 -4.91709 0.153
NP_442533.1_6 Forward -241 -232 17.2076 0.00137
NP_442533.1_6 Reverse -232 -241 17.2076 0.00137
NP_443016.1_1 Forward -286 -267 -0.983855 0.219
NP_441482.1_7 Forward -247 -233 8.25939 0.0181
NP_439944.1_9 Reverse -233 -243 19.0562 0.00329
NP_439944.1_9 Forward -240 -230 9.12481 0.1
NP_441028.1_6 Forward -77 -67 4.7978 0.277
NP_440116.1_5 Reverse -229 -246 5.15205 0.176
NP_441527.1_4 Reverse -196 -215 -1.86252 0.15
NP_441527.1_4 Reverse -195 -214 -10.1703 0.266
NP_441527.1_4 Reverse -323 -342 -12.5576 0.291
NP_441527.1_7 Forward -215 -196 8.06178 0.284
NP_440115.1_6 Forward -244 -234 9.41981 0.115
NP_440115.1_6 Reverse -229 -239 6.37155 0.186
NP_440115.1_6 Forward -91 -81 5.97822 0.206
NP_440007.1_9 Forward -245 -231 10.6193 0.163
NP_441972.1_5 Forward -252 -233 -8.06369 0.258
NP_441106.1_1 Reverse -231 -240 18.486 0.0028
NP_441106.1_1 Forward -242 -233 9.63616 0.0311
NP_439903.1_6 Reverse -229 -248 3.34192 0.21
NP_441286.1_1 Reverse -231 -243 11.937 0.0108
NP_441286.1_1 Forward -242 -230 5.93884 0.0258
NP_440670.1_8 Forward -241 -232 18.3876 0.000699
NP_440670.1_8 Reverse -232 -241 18.3876 0.000699
NP_440886.1_7 Reverse -231 -241 8.04271 0.0805
NP_440886.1_7 Forward -242 -232 7.94438 0.0805
NP_440513.1_6 Reverse -222 -241 12.1917 0.222
NP_442295.1_4 Forward -297 -278 19.1457 0.276
NP_441808.1_8 Reverse -232 -251 6.88262 0.283
NP_440907.2_8 Forward -240 -230 15.9091 0.0161
NP_441021.1_1 Reverse -233 -252 -6.58872 0.18
NP_441021.1_1 Forward -137 -118 -10.817 0.248
NP_440841.1_4 Forward -243 -224 0.58944 0.119
NP_441463.1_3 Forward -251 -232 -8.94866 0.276
NP_441463.1_3 Reverse -222 -241 -9.24366 0.278
NP_441463.1_6 Reverse -230 -244 6.80246 0.267
NP_441626.1_2 Forward -240 -233 15.7721 0.0124
NP_441626.1_2 Reverse -233 -240 15.7721 0.0124
NP_442794.1_1 Forward -245 -233 19.7052 0.00523
NP_442794.1_1 Forward -251 -239 5.93884 0.198
NP_442615.1_1 Reverse -223 -241 7.4923 0.0317
NP_442615.1_1 Forward -250 -232 -1.45582 0.128
NP_441962.1_4 Reverse -233 -252 -14.2585 0.285
NP_440387.1_1 Reverse -232 -248 14.3165 0.00649
NP_442020.1_1 Reverse -248 -267 -0.689632 0.278
NP_441488.1_8 Forward -252 -238 7.57046 0.241
NP_441836.1_1 Forward -252 -233 19.9732 0.0206
NP_441836.1_2 Reverse -316 -335 -2.75381 0.231
NP_440634.1_4 Forward -255 -236 7.47261 0.257
NP_441993.1_1 Reverse -226 -245 0.484826 0.298
NP_440114.1_10 Forward -241 -227 16.9125 0.0141
NP_441510.2_7 Forward -247 -233 10.9137 0.28
NP_440287.1_5 Forward -134 -115 9.14342 0.286
NP_440766.1_4 Forward -245 -231 7.86607 0.0871
NP_440457.1_1 Forward -245 -233 8.29878 0.101
NP_440457.1_1 Forward -96 -84 -0.846001 0.278
NP_440798.1_6 Forward -240 -227 21.9471 0.0101
NP_442297.1_4 Forward -357 -338 12.0434 0.291
NP_441332.1_3 Forward -138 -119 11.7992 0.173
NP_442509.1_9 Reverse -232 -242 8.14104 0.192
NP_442509.1_9 Forward -241 -231 8.04271 0.192
NP_442936.1_10 Reverse -207 -221 11.0822 0.23
NP_440554.1_4 Forward -240 -230 8.82982 0.0646
NP_440554.1_4 Reverse -233 -243 7.05986 0.106
NP_441885.1_5 Reverse -232 -242 20.9245 0.000538
NP_441885.1_5 Forward -241 -231 11.3864 0.00668
NP_442341.1_7 Reverse -231 -245 7.66941 0.0994
NP_442341.1_9 Reverse -230 -244 19.8618 0.00907
NP_442395.2_4 Reverse -231 -250 2.45694 0.223
NP_443000.1_7 Forward -243 -233 17.0896 0.00865
NP_443000.1_7 Reverse -230 -240 10.6981 0.0345
NP_440507.2_3 Forward -250 -231 7.17681 0.286
NP_441842.1_10 Reverse -225 -239 16.0275 0.0347
NP_440275.1_3 Reverse -230 -240 9.02648 0.0563
NP_440275.1_3 Forward -243 -233 8.1415 0.0602
NP_440091.1_1 Forward -245 -233 -0.452677 0.273
NP_441902.1_3 Reverse -68 -78 13.8563 0.226
NP_440679.1_10 Forward -372 -353 -18.6834 0.279
NP_441122.1_1 Forward -208 -193 4.40479 0.28
NP_442495.1_6 Reverse -260 -279 15.5357 0.286
NP_440149.1_8 Reverse -232 -251 -2.75381 0.175
NP_441105.1_3 Forward -364 -345 -0.000545616 0.131
NP_441105.1_3 Reverse -221 -240 -1.18052 0.147
NP_441105.1_3 Forward -286 -267 -2.65548 0.165
NP_441105.1_3 Forward -252 -233 -4.52377 0.201
NP_441105.1_3 Forward -258 -239 -6.98204 0.243
NP_441105.1_3 Reverse -227 -246 -7.27704 0.25
NP_440216.1_1 Forward -241 -227 16.2242 0.00307
NP_440216.1_1 Reverse -232 -246 -10.4235 0.145
NP_440172.1_1 Forward -241 -231 17.5813 0.00421
NP_440172.1_1 Reverse -232 -242 15.0247 0.00945
NP_440249.1_2 Reverse -369 -379 15.0242 0.268
NP_442015.1_10 Forward -245 -232 18.8988 0.00492
NP_442015.1_10 Reverse -228 -241 2.87088 0.187
NP_441226.1_7 Forward -240 -233 14.4934 0.0123
NP_441226.1_7 Reverse -233 -240 14.4934 0.0123
NP_441111.1_7 Forward -240 -232 18.7023 0.00294
NP_441111.1_7 Reverse -233 -241 18.7023 0.00294
NP_442379.1_10 Forward -248 -231 5.54538 0.129
NP_441766.1_2 Forward -241 -232 17.5026 0.00297
NP_441766.1_2 Reverse -232 -241 17.5026 0.00297
NP_442417.1_5 Reverse -232 -246 11.8976 0.0981
NP_440416.1_9 Forward -248 -229 -4.91709 0.0783
NP_440416.1_9 Reverse -237 -256 -16.0285 0.206
NP_443052.1_8 Reverse -222 -241 -8.65367 0.177
NP_440591.1_9 Forward -248 -230 10.5406 0.121
NP_440261.1_5 Forward -240 -227 -2.73398 0.0924
NP_440261.1_5 Reverse -233 -246 -10.5021 0.201
NP_440261.1_7 Reverse -348 -367 -6.49039 0.28
NP_440988.1_10 Forward -243 -229 8.09365 0.205
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGCGCGTTTAAGCAGAACATGCAATTTTTGATGAACAATATGGCTCCAGGGAGTGCATTATTGCTTTCTGACCTTGATTACCACCAAACTTCTCGGTGTTTACAGCTCCTCAAGCAGCTTGCTGATGCCACTCCGGGAATTACTACGGTCTTTGACCATGGCGATCGCCTACTGAAATATGAAAATAGCTTTTCTTTGCCATTTTCCATACGCAGACATCTCCTTACTGGTCAAAATGGTTTGATTCCCAAAAAATGGATTCGGCAATTTTCCCTCTGCTTGCTCAAGCAATAAATCCATAAGGGGAGGGGGAGCTATCCATTTTCTCCTCTATAGAAAAACTGTTTTCCACTCAATTGCTTTAATGCAAAGGTGGTAAGTAAGCAAATAAACAGACACT

CDS

ATGACTGATTTCAAAGCATTGATTGAATCTAAGCTTTCTAGTCTCCTTGGTAAGGAAATCAAGGTAACAGACAAAGCCAAAGAATGCCTACAGCGATTAGCAGAAAGCGAGCAGAATTTTTACTCTTGGCATTTAAAATTATTAAGTATCATTTTTGATGTATCTCCAGAAATTTGGGACATTCTTAAAGAAGTAGATGAAGGTTTCAATAATTTTAATTATGCAGTGCTTGATGCCCAGGTGAGGGATTATTTTGTTAAAAATGAATCTACTCCCACGGTTATTTGTGATCAAATCAGCGATTTTGATGATTTCCTAGCTACCCTATTTTTTAAGGCAGCAAATACCGGTGGCCTGGGCGTTGTTTACACCTCTCCTCCCCCTAGTAAAGCGGAAATCATTCAAGATACTATAACCATTGACCATTTGGTGGGGATGCTATTTTATGTGCTTTACGCTGGCTACTATGAAAGTGATTTGGCCGTGGCTCTGTTAATTATGAATAATTTTGACATTGCCTTCGGACGGAATAATCGCCGCTATTTAGATGAGCTAGAAAACATTATGACAAAAACTGAATTACGGTCTTAA

Protein

No sequence available