Your browser is old and dusty. Try Google Chrome!

Details for slr7096

ORF slr7096
Accession NP_942384.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442711.1_1 Reverse -322 -336 14.8476 0.12
NP_442711.1_1 Forward -331 -317 12.0943 0.222
NP_441061.1_2 Forward -330 -316 1.27789 0.192
NP_441061.1_2 Forward -274 -260 0.0979218 0.218
NP_441061.1_2 Forward -138 -124 -1.18038 0.252
NP_440795.1_7 Forward -330 -323 14.6904 0.0123
NP_440795.1_7 Reverse -323 -330 14.6904 0.0123
NP_440795.1_7 Reverse -125 -132 11.3472 0.0978
NP_441418.1_6 Reverse -322 -341 -11.2103 0.0462
NP_441418.1_6 Reverse -66 -85 -29.3032 0.221
NP_441418.1_6 Forward -331 -312 -29.7948 0.238
NP_440897.1_6 Forward -331 -312 3.04693 0.154
NP_440897.1_6 Forward -133 -114 -1.57461 0.193
NP_441453.1_4 Reverse -322 -330 16.539 0.00633
NP_441453.1_4 Forward -331 -323 16.539 0.00633
NP_441453.1_4 Reverse -124 -132 7.19758 0.0757
NP_441453.1_4 Forward -133 -125 4.93597 0.224
NP_441453.1_7 Reverse -376 -383 14.1988 0.175
NP_442151.1_6 Forward -133 -119 15.2409 0.0251
NP_442151.1_6 Forward -331 -317 12.4876 0.0722
NP_441818.1_1 Forward -132 -121 11.8579 0.155
NP_440226.1_1 Reverse -322 -341 10.4225 0.0622
NP_441465.1_8 Reverse -255 -273 5.32902 0.29
NP_440259.1_4 Reverse -166 -180 13.167 0.226
NP_442623.1_1 Forward -297 -278 -9.047 0.232
NP_442655.1_1 Reverse -317 -336 0.0977854 0.24
NP_442173.1_1 Forward -330 -322 15.4574 0.00633
NP_442173.1_1 Reverse -323 -331 15.4574 0.00633
NP_442173.1_1 Forward -132 -124 5.62429 0.206
NP_442173.1_1 Reverse -125 -133 4.73931 0.258
NP_442752.1_4 Forward -331 -324 13.8055 0.0199
NP_442752.1_4 Reverse -322 -329 13.8055 0.0199
NP_442752.1_4 Reverse -124 -131 10.8555 0.0846
NP_442752.1_4 Reverse -110 -117 5.44732 0.202
NP_442752.1_4 Forward -275 -268 4.26735 0.293
NP_443027.1_4 Reverse -320 -330 13.943 0.0452
NP_443027.1_4 Forward -333 -323 13.2547 0.0521
NP_442975.1_10 Reverse -318 -332 21.6317 0.000774
NP_441675.1_4 Forward -31 -12 12.4875 0.177
NP_440784.1_7 Forward -330 -323 15.9687 0.0123
NP_440784.1_7 Reverse -323 -330 15.9687 0.0123
NP_440784.1_7 Forward -132 -125 12.4288 0.0475
NP_440784.1_7 Reverse -125 -132 6.23397 0.241
NP_442909.1_7 Reverse -267 -281 5.70218 0.27
NP_440878.1_9 Reverse -312 -331 -2.0655 0.258
NP_442062.1_8 Forward -331 -321 19.4496 0.000558
NP_442062.1_8 Reverse -322 -332 10.3048 0.0493
NP_442062.1_8 Forward -133 -123 4.79825 0.198
NP_442062.1_8 Reverse -110 -120 2.83163 0.293
NP_440761.1_4 Reverse -317 -336 -13.7669 0.257
NP_441859.1_3 Reverse -321 -340 9.04509 0.131
NP_441859.1_3 Forward -332 -313 1.96529 0.269
NP_441802.1_1 Forward -290 -271 9.63589 0.205
NP_440304.1_4 Reverse -122 -132 17.2863 0.0113
NP_440304.1_4 Forward -333 -323 10.8948 0.051
NP_440304.1_4 Reverse -320 -330 9.91146 0.051
NP_442242.1_4 Forward -330 -323 14.3954 0.0124
NP_442242.1_4 Reverse -323 -330 14.3954 0.0124
NP_440044.1_8 Forward -330 -311 6.68596 0.0881
NP_441208.1_9 Forward -334 -320 8.16106 0.219
NP_441208.1_9 Reverse -319 -333 5.99778 0.254
NP_440132.1_1 Reverse -122 -140 9.26226 0.244
NP_442110.1_7 Forward -331 -317 10.226 0.0684
NP_442110.1_7 Reverse -322 -336 3.44117 0.21
NP_440856.1_4 Forward -338 -319 15.5357 0.0346
NP_441083.1_5 Forward -331 -321 11.3864 0.0159
NP_441083.1_5 Reverse -322 -332 11.2881 0.0159
NP_441083.1_5 Reverse -266 -276 0.275027 0.237
NP_441083.1_5 Forward -133 -123 0.176696 0.241
NP_442827.1_8 Reverse -131 -150 2.55527 0.157
NP_441738.1_2 Forward -329 -322 15.28 0.0102
NP_441738.1_2 Reverse -324 -331 15.28 0.0102
NP_441738.1_2 Forward -117 -110 10.2652 0.101
NP_441558.1_5 Forward -333 -314 4.916 0.267
NP_440209.1_1 Reverse -322 -330 18.1123 0.00295
NP_440209.1_1 Forward -331 -323 18.1123 0.00295
NP_440209.1_1 Reverse -124 -132 8.37755 0.0576
NP_442889.1_8 Forward -327 -313 4.42388 0.267
NP_442889.1_8 Reverse -319 -333 3.73557 0.273
NP_441713.1_1 Reverse -316 -335 -6.98204 0.125
NP_441770.1_10 Forward -333 -314 15.1424 0.213
NP_441716.1_1 Reverse -322 -336 7.86607 0.156
NP_440644.1_3 Forward -156 -137 2.65439 0.224
NP_442111.1_4 Reverse -321 -335 13.4709 0.0383
NP_442111.1_4 Forward -332 -318 9.83269 0.0575
NP_442111.1_4 Reverse -123 -137 6.48943 0.123
NP_442111.1_4 Forward -134 -120 6.3911 0.127
NP_441215.1_1 Reverse -308 -327 5.60432 0.285
NP_440343.1_9 Reverse -376 -395 8.45592 0.255
NP_440906.1_5 Forward -330 -323 15.8704 0.0124
NP_440906.1_5 Reverse -323 -330 15.8704 0.0124
NP_440906.1_5 Reverse -125 -132 6.23397 0.234
NP_440906.1_5 Forward -132 -125 6.0373 0.262
NP_440747.1_10 Forward -334 -322 17.1486 0.000663
NP_440747.1_10 Reverse -319 -331 -2.02597 0.0196
NP_440747.1_10 Forward -278 -266 -4.28759 0.0903
NP_440747.1_10 Forward -136 -124 -4.38592 0.0974
NP_441130.1_7 Reverse -310 -324 14.8469 0.287
NP_441130.1_10 Reverse -320 -334 10.0294 0.117
NP_441130.1_10 Forward -333 -319 8.94771 0.131
NP_441854.1_10 Reverse -320 -339 0.884433 0.282
NP_441486.1_1 Reverse -263 -277 1.96621 0.0939
NP_441486.1_1 Forward -136 -122 -0.885388 0.164
NP_441486.1_1 Reverse -319 -333 -3.34366 0.178
NP_442634.1_4 Reverse -320 -334 6.58777 0.0489
NP_442634.1_4 Forward -333 -319 5.80112 0.051
NP_442634.1_4 Reverse -122 -136 4.81781 0.0721
NP_441265.1_3 Reverse -316 -330 1.67122 0.2
NP_441014.1_10 Forward -276 -257 -2.45958 0.276
NP_442848.1_1 Reverse -260 -274 0.982901 0.255
NP_442848.1_1 Reverse -316 -330 -3.24533 0.263
NP_441012.1_4 Forward -79 -66 7.09911 0.272
NP_443018.1_3 Forward -330 -323 14.8871 0.0123
NP_443018.1_3 Reverse -323 -330 14.8871 0.0123
NP_443018.1_3 Reverse -125 -132 13.8055 0.024
NP_443018.1_3 Forward -132 -125 13.6088 0.0352
NP_441316.1_7 Reverse -122 -137 12.8613 0.0486
NP_441316.1_7 Reverse -320 -335 4.20813 0.135
NP_441634.1_8 Forward -333 -319 15.1426 0.0248
NP_440376.1_1 Forward -331 -322 19.4693 0.000692
NP_440376.1_1 Reverse -322 -331 19.4693 0.000692
NP_440376.1_1 Reverse -124 -133 6.48957 0.0963
NP_440376.1_1 Forward -133 -124 -0.196935 0.285
NP_441857.1_5 Reverse -315 -333 12.9005 0.175
NP_441002.1_5 Reverse -347 -366 16.3224 0.135
NP_441588.1_4 Reverse -268 -278 7.35486 0.178
NP_441588.1_4 Forward -329 -319 6.96153 0.178
NP_442730.1_8 Forward -141 -122 2.35861 0.292
NP_442687.1_7 Reverse -321 -331 15.8113 0.0125
NP_442687.1_7 Forward -332 -322 9.02648 0.0994
NP_441077.1_6 Forward -105 -89 6.75455 0.235
NP_441013.1_2 Reverse -317 -335 -4.79907 0.299
NP_442296.1_9 Reverse -316 -335 -2.0655 0.219
NP_442658.1_1 Reverse -320 -330 18.7607 0.00222
NP_442658.1_1 Forward -333 -323 14.2375 0.0237
NP_442658.1_1 Reverse -122 -132 13.9425 0.0293
NP_442658.1_1 Forward -121 -111 4.7978 0.297
NP_442782.1_2 Reverse -322 -336 1.47456 0.281
NP_442544.1_6 Forward -338 -319 -8.45701 0.298
NP_441414.1_9 Forward -331 -312 -5.70374 0.178
NP_441414.1_9 Forward -275 -256 -6.09707 0.187
NP_440720.1_1 Reverse -311 -330 7.57094 0.195
NP_440720.1_1 Reverse -113 -132 2.3594 0.263
NP_443061.1_4 Reverse -255 -274 6.78429 0.205
NP_441958.1_5 Forward -332 -322 21.2195 0.000805
NP_441958.1_5 Reverse -321 -331 12.2714 0.00183
NP_441958.1_5 Reverse -123 -133 1.65166 0.0872
NP_441958.1_5 Forward -134 -124 1.55333 0.095
NP_442685.1_1 Forward -181 -162 18.1213 0.275
NP_440203.1_5 Forward -130 -120 8.63269 0.29
NP_440984.1_7 Reverse -317 -331 10.6193 0.122
NP_439990.1_5 Forward -336 -323 10.7374 0.128
NP_442376.1_2 Reverse -317 -336 -12.6852 0.286
NP_442911.1_2 Reverse -312 -331 7.17762 0.0263
NP_442911.1_2 Forward -341 -322 5.01433 0.0356
NP_440153.1_5 Forward -330 -316 3.93283 0.199
NP_440153.1_5 Reverse -323 -337 2.06454 0.239
NP_440153.1_8 Forward -394 -381 -3.12731 0.285
NP_440858.1_1 Reverse -26 -45 -0.4922 0.248
NP_440993.1_2 Forward -336 -320 13.2349 0.0656
NP_440993.1_2 Reverse -317 -333 3.89344 0.256
NP_440993.1_3 Forward -341 -322 6.68515 0.148
NP_440138.1_6 Forward -155 -136 3.24359 0.246
NP_441099.1_5 Forward -79 -60 -5.80207 0.154
NP_441099.1_5 Forward -341 -322 -8.55534 0.197
NP_442002.1_9 Reverse -321 -328 10.7572 0.185
NP_440809.1_9 Forward -340 -322 -7.84733 0.225
NP_441294.1_7 Reverse -318 -332 13.0902 0.0747
NP_442438.1_10 Reverse -317 -331 17.7975 0.0179
NP_441000.1_6 Forward -332 -318 -3.34366 0.221
NP_441000.1_6 Reverse -321 -335 -4.03198 0.225
NP_441674.1_6 Forward -393 -374 3.6377 0.264
NP_440147.1_4 Forward -333 -320 18.4072 0.00407
NP_440147.1_4 Reverse -320 -333 10.4424 0.0355
NP_440147.1_4 Forward -135 -122 1.49425 0.226
NP_441550.1_8 Forward -333 -323 15.8108 0.0132
NP_441550.1_8 Reverse -320 -330 10.501 0.066
NP_441550.1_8 Forward -277 -267 8.92768 0.112
NP_441550.1_8 Forward -135 -125 8.92768 0.112
NP_441550.1_8 Reverse -122 -132 5.68278 0.236
NP_441916.1_7 Reverse -322 -332 18.9579 0.00144
NP_441916.1_7 Forward -331 -321 18.4663 0.00144
NP_441916.1_7 Reverse -124 -134 6.8632 0.0816
NP_441916.1_10 Reverse -122 -141 2.94938 0.236
NP_440206.1_4 Forward -143 -124 -0.29631 0.29
NP_441041.1_4 Reverse -66 -85 4.12936 0.06
NP_441041.1_4 Reverse -124 -143 -0.885524 0.0986
NP_441041.1_7 Reverse -319 -331 19.5648 0.00277
NP_441041.1_7 Forward -334 -322 13.3454 0.0485
NP_440016.1_9 Forward -337 -318 9.0459 0.278
NP_441725.1_4 Forward -336 -322 22.7134 0.00544
NP_441725.1_5 Forward -132 -122 18.4663 0.014
NP_441725.1_5 Forward -330 -320 9.02648 0.0553
NP_441725.1_5 Reverse -323 -333 1.94665 0.115
NP_439966.1_7 Reverse -320 -330 17.4824 0.00636
NP_439966.1_7 Forward -333 -323 14.3359 0.0203
NP_439966.1_7 Reverse -264 -274 8.82935 0.13
NP_439966.1_9 Reverse -320 -329 10.7178 0.0863
NP_442941.1_3 Reverse -323 -333 19.2529 0.00262
NP_442941.1_3 Forward -330 -320 2.53664 0.14
NP_442941.1_3 Forward -132 -122 1.55333 0.15
NP_440289.1_2 Reverse -319 -332 12.9006 0.0132
NP_440289.1_2 Forward -334 -321 -3.52063 0.267
NP_440260.1_8 Forward -142 -124 -5.68405 0.276
NP_441678.1_9 Forward -286 -267 -3.44213 0.288
NP_442281.1_1 Reverse -317 -331 17.6985 0.00542
NP_442281.1_1 Forward -336 -322 17.2068 0.00633
NP_442281.1_1 Forward -138 -124 7.27547 0.104
NP_441079.1_7 Forward -364 -345 -0.984623 0.2
NP_441079.1_7 Forward -58 -39 -5.99948 0.269
NP_442012.1_1 Forward -337 -318 7.66927 0.108
NP_441457.1_7 Forward -333 -314 -1.18052 0.293
NP_442982.1_5 Forward -341 -322 -3.44213 0.298
NP_443030.1_4 Reverse -117 -136 -0.295539 0.222
NP_441644.1_6 Reverse -322 -332 19.0557 0.000803
NP_441644.1_6 Reverse -124 -134 14.9258 0.00847
NP_441644.1_6 Forward -331 -321 10.1076 0.0628
NP_441644.1_6 Forward -133 -123 4.60114 0.233
NP_443049.1_6 Reverse -123 -133 11.7385 0.24
NP_441071.1_3 Forward -121 -102 5.2102 0.282
NP_442215.1_2 Forward -214 -198 0.943514 0.144
NP_442215.1_2 Reverse -320 -336 -3.38305 0.214
NP_442215.1_2 Forward -135 -119 -3.67804 0.22
NP_440253.1_2 Forward -331 -313 7.88563 0.0643
NP_440253.1_2 Reverse -322 -340 2.67408 0.133
NP_440929.1_8 Forward -331 -322 19.2726 0.000701
NP_440929.1_8 Reverse -322 -331 19.2726 0.000701
NP_440929.1_8 Reverse -124 -133 7.66954 0.0624
NP_440929.1_8 Forward -133 -124 7.57121 0.0706
NP_440929.1_8 Forward -275 -266 6.39124 0.0992
NP_440929.1_8 Reverse -266 -275 5.40793 0.138
NP_442933.1_10 Forward -331 -322 17.601 0.00325
NP_442933.1_10 Reverse -322 -331 17.601 0.00325
NP_442933.1_10 Reverse -124 -133 5.70292 0.165
NP_441751.2_8 Reverse -323 -337 6.58777 0.0348
NP_442554.1_8 Reverse -323 -333 17.2863 0.00543
NP_442554.1_8 Forward -330 -320 16.008 0.0065
NP_442554.1_8 Forward -132 -122 13.7464 0.0153
NP_442554.1_8 Reverse -125 -135 11.9764 0.0312
NP_441762.1_7 Forward -332 -320 12.527 0.0142
NP_441762.1_7 Reverse -321 -333 2.30059 0.0676
NP_442142.1_4 Forward -334 -321 15.4566 0.0264
NP_442142.1_4 Reverse -319 -332 14.4733 0.0311
NP_442292.1_1 Reverse -323 -332 17.5026 0.00435
NP_442292.1_1 Forward -330 -321 9.63616 0.0183
NP_442292.1_1 Reverse -125 -134 7.17789 0.0777
NP_442292.1_1 Forward -132 -123 6.5879 0.101
NP_442292.1_1 Reverse -267 -276 -0.786921 0.287
NP_442476.1_6 Forward -330 -316 7.57108 0.112
NP_442476.1_6 Reverse -323 -337 1.17956 0.228
NP_442381.1_8 Reverse -319 -338 -3.83545 0.126
NP_443009.1_5 Forward -332 -321 19.626 0.00102
NP_443009.1_5 Reverse -321 -332 7.82632 0.118
NP_443009.1_5 Forward -120 -109 7.43299 0.129
NP_443009.1_5 Reverse -123 -134 6.05637 0.177
NP_443009.1_5 Forward -134 -123 5.36805 0.206
NP_442301.1_2 Forward -124 -105 5.30853 0.265
NP_441715.1_4 Reverse -323 -333 16.7946 0.0106
NP_441715.1_4 Forward -330 -320 9.32148 0.097
NP_441198.1_8 Reverse -122 -132 10.7322 0.247
NP_441198.1_8 Forward -135 -125 10.7322 0.247
NP_441468.1_1 Forward -330 -323 15.8704 0.0124
NP_441468.1_1 Reverse -323 -330 15.8704 0.0124
NP_441468.1_1 Reverse -125 -132 13.8055 0.0242
NP_441468.1_1 Forward -132 -125 6.0373 0.223
NP_441020.2_6 Reverse -320 -337 10.6586 0.139
NP_441015.1_10 Forward -336 -317 -6.1954 0.243
NP_441673.1_1 Forward -331 -322 20.8459 0.000698
NP_441673.1_1 Reverse -322 -331 20.8459 0.000698
NP_441673.1_1 Reverse -124 -133 1.37636 0.114
NP_441673.1_1 Forward -133 -124 1.1797 0.163
NP_440265.1_7 Reverse -124 -138 15.3386 0.23
NP_441826.1_2 Reverse -316 -330 13.9626 0.0213
NP_441826.1_2 Forward -337 -323 -4.81863 0.3
NP_441826.1_2 Forward -139 -125 -4.81863 0.3
NP_441330.1_1 Forward -336 -317 -12.2919 0.183
NP_442490.1_9 Reverse -112 -131 -2.16383 0.206
NP_442868.1_6 Forward -333 -323 10.4031 0.038
NP_442868.1_6 Reverse -320 -330 8.53483 0.0555
NP_442719.1_2 Forward -94 -76 -9.42131 0.264
NP_442808.1_1 Reverse -321 -331 18.4657 0.00201
NP_442808.1_1 Forward -332 -322 8.73102 0.0481
NP_440145.1_3 Forward -341 -322 1.96607 0.122
NP_440145.1_3 Forward -143 -124 -0.000545616 0.138
NP_442542.1_2 Reverse -320 -333 10.344 0.126
NP_442050.1_5 Forward -333 -323 15.9091 0.0091
NP_442050.1_5 Reverse -320 -330 8.23937 0.234
NP_442342.1_9 Reverse -320 -336 2.41848 0.29
NP_440558.1_2 Forward -142 -123 1.47442 0.181
NP_440558.1_2 Forward -340 -321 -3.73712 0.238
NP_441878.1_6 Reverse -123 -133 11.4848 0.0176
NP_441878.1_6 Forward -332 -322 10.5014 0.0176
NP_441878.1_6 Reverse -321 -331 10.4031 0.0176
NP_441878.1_6 Forward -134 -124 -0.314959 0.174
NP_441036.1_8 Reverse -321 -331 17.7779 0.000554
NP_441036.1_8 Forward -332 -322 15.713 0.00724
NP_441557.1_5 Forward -331 -322 19.9609 0.000699
NP_441557.1_5 Reverse -322 -331 19.9609 0.000699
NP_441557.1_5 Forward -133 -124 7.57121 0.049
NP_441557.1_5 Reverse -124 -133 1.08137 0.0794
NP_441445.1_1 Reverse -51 -70 1.37609 0.257
NP_442066.2_4 Forward -331 -312 -0.688862 0.18
NP_442066.2_9 Reverse -318 -331 8.37742 0.185
NP_441308.1_8 Reverse -320 -330 9.22315 0.226
NP_440101.1_3 Reverse -317 -336 0.58944 0.297
NP_442183.1_1 Forward -331 -317 11.406 0.0702
NP_442183.1_1 Reverse -322 -336 9.43936 0.098
NP_442183.1_1 Forward -275 -261 7.17775 0.147
NP_442397.1_1 Forward -219 -205 15.1737 0.257
NP_441467.1_10 Forward -228 -214 5.01447 0.294
NP_440540.1_8 Reverse -316 -335 7.37428 0.289
NP_442170.1_5 Reverse -124 -143 -3.24547 0.269
NP_442347.1_2 Forward -330 -321 11.1111 0.056
NP_442347.1_2 Reverse -323 -332 3.34298 0.284
NP_441037.1_4 Reverse -320 -330 16.2838 0.0168
NP_441037.1_4 Reverse -122 -132 8.38973 0.237
NP_441037.1_4 Forward -333 -323 7.22024 0.237
NP_442594.1_8 Reverse -108 -127 2.85105 0.293
NP_441633.1_3 Forward -333 -320 13.3923 0.018
NP_441633.1_3 Reverse -320 -333 -3.81562 0.177
NP_441633.1_3 Forward -135 -122 -4.01229 0.179
NP_440136.1_2 Forward -330 -323 15.9687 0.0123
NP_440136.1_2 Reverse -323 -330 15.9687 0.0123
NP_440136.1_2 Reverse -125 -132 6.52896 0.116
NP_440136.1_2 Forward -132 -125 6.13563 0.193
NP_442998.1_5 Reverse -35 -45 9.32148 0.243
NP_442998.1_10 Forward -329 -322 15.5754 0.0102
NP_442998.1_10 Reverse -324 -331 15.5754 0.0102
NP_442998.1_10 Reverse -268 -275 6.13563 0.181
NP_442998.1_10 Forward -131 -124 6.13563 0.181
NP_440899.1_5 Forward -129 -110 6.39097 0.242
NP_440299.1_1 Reverse -318 -331 11.4251 0.0489
NP_440299.1_1 Forward -335 -322 11.1301 0.0518
NP_440299.1_1 Forward -137 -124 10.4418 0.0573
NP_441799.1_1 Forward -335 -321 10.3237 0.0756
NP_441799.1_1 Reverse -318 -332 3.44058 0.298
NP_440977.1_4 Forward -248 -229 -9.53865 0.194
NP_441007.1_10 Reverse -317 -330 3.46087 0.182
NP_441007.1_10 Forward -336 -323 1.00259 0.209
NP_442201.1_10 Reverse -311 -330 -13.9635 0.28
NP_440256.1_1 Forward -334 -315 18.879 0.00424
NP_440256.1_1 Reverse -319 -338 -3.04881 0.126
NP_441559.1_8 Forward -336 -322 11.0127 0.0574
NP_441559.1_8 Forward -80 -66 -3.73699 0.209
NP_441559.1_8 Reverse -317 -331 -6.29359 0.276
NP_440915.1_6 Reverse -318 -332 24.9757 0.000297
NP_440915.1_6 Forward -335 -321 10.6193 0.0301
NP_440915.1_6 Reverse -120 -134 4.42448 0.0953
NP_442866.1_1 Reverse -317 -336 -0.983855 0.202
NP_440026.1_4 Reverse -107 -126 12.0942 0.239
NP_440695.1_5 Reverse -66 -85 -0.787193 0.284
NP_442386.1_9 Reverse -321 -330 15.7322 0.0144
NP_442386.1_9 Forward -332 -323 6.39082 0.219
NP_441340.1_5 Forward -330 -323 15.6737 0.0124
NP_441340.1_5 Reverse -323 -330 15.6737 0.0124
NP_441340.1_5 Forward -132 -125 13.5105 0.0314
NP_441340.1_5 Reverse -125 -132 6.23397 0.132
NP_441340.1_5 Forward -274 -267 3.97235 0.274
NP_442240.1_2 Reverse -323 -342 -20.3551 0.295
NP_440161.1_3 Reverse -320 -339 8.65258 0.268
NP_440586.1_8 Forward -330 -323 13.2151 0.026
NP_440586.1_8 Reverse -323 -330 13.2151 0.026
NP_440586.1_8 Forward -132 -125 11.3468 0.0736
NP_440586.1_8 Reverse -125 -132 9.47853 0.146
NP_442251.1_6 Forward -330 -323 15.2804 0.0124
NP_442251.1_6 Reverse -323 -330 15.2804 0.0124
NP_441262.1_3 Reverse -322 -329 14.7888 0.0223
NP_441262.1_3 Forward -331 -324 14.7888 0.0223
NP_441262.1_3 Forward -275 -268 5.25066 0.215
NP_441262.1_3 Reverse -124 -131 5.25066 0.215
NP_443051.1_1 Forward -332 -323 19.5676 0.00335
NP_443051.1_1 Reverse -321 -330 10.4228 0.00754
NP_443051.1_1 Reverse -123 -132 8.35786 0.0371
NP_443051.1_1 Forward -134 -125 7.66954 0.0571
NP_439937.1_8 Reverse -320 -339 -3.3438 0.268
NP_439937.1_9 Forward -332 -315 1.21811 0.0948
NP_439937.1_9 Reverse -321 -338 -8.61494 0.176
NP_440439.1_1 Forward -334 -321 18.1122 0.0105
NP_440439.1_1 Reverse -319 -332 9.36073 0.0465
NP_440439.1_1 Reverse -107 -120 4.05085 0.107
NP_440372.1_2 Forward -330 -323 16.3621 0.0124
NP_440372.1_2 Reverse -323 -330 16.3621 0.0124
NP_440372.1_2 Reverse -125 -132 6.62729 0.151
NP_440372.1_2 Forward -132 -125 6.52896 0.188
NP_440372.1_2 Forward -274 -267 4.26735 0.221
NP_440316.1_10 Reverse -123 -133 7.25653 0.251
NP_441803.1_2 Forward -336 -317 17.5024 0.0309
NP_439977.1_5 Reverse -316 -335 5.70265 0.146
NP_439977.1_5 Forward -337 -318 4.916 0.15
NP_439977.1_5 Forward -139 -120 -0.0988766 0.217
NP_441572.1_7 Reverse -316 -335 15.2408 0.026
NP_441572.1_7 Reverse -118 -137 -5.60541 0.265
NP_440267.1_2 Forward -336 -322 12.487 0.125
NP_442384.1_10 Reverse -322 -335 18.8988 0.00338
NP_442384.1_10 Reverse -124 -137 4.93583 0.142
NP_442384.1_10 Forward -331 -318 2.2809 0.23
NP_442114.1_4 Forward -331 -320 12.1534 0.107
NP_441877.1_7 Forward -336 -317 7.07848 0.218
NP_442790.1_4 Reverse -313 -332 -8.26035 0.166
NP_442262.1_10 Forward -330 -323 14.1988 0.0123
NP_442262.1_10 Reverse -323 -330 14.1988 0.0123
NP_442262.1_10 Reverse -125 -132 13.0188 0.0314
NP_442262.1_10 Forward -132 -125 11.6422 0.092
NP_441689.1_5 Forward -333 -323 8.3377 0.132
NP_440344.1_6 Forward -326 -312 20.1574 0.128
NP_440344.1_10 Reverse -315 -332 12.3302 0.006
NP_440344.1_10 Forward -338 -321 0.628827 0.0349
NP_440531.1_6 Reverse -258 -277 -2.45882 0.252
NP_440562.1_5 Reverse -149 -168 5.50599 0.261
NP_441965.1_3 Reverse -312 -331 1.47442 0.221
NP_441965.1_10 Reverse -319 -335 10.1866 0.107
NP_440297.1_9 Forward -132 -122 19.3512 0.0359
NP_440297.1_9 Forward -330 -320 -0.216628 0.282
NP_440297.1_9 Reverse -323 -333 -0.216628 0.282
NP_440297.1_9 Reverse -125 -135 -0.216628 0.282
NP_441896.1_3 Reverse -313 -332 0.196116 0.23
NP_440894.1_10 Reverse -317 -336 8.25926 0.179
NP_440894.1_10 Reverse -364 -383 4.32602 0.254
NP_440999.1_9 Reverse -318 -332 21.1407 0.0083
NP_440999.1_9 Forward -335 -321 1.17956 0.169
NP_440999.1_9 Forward -137 -123 -2.45868 0.27
NP_440888.1_2 Forward -331 -317 20.9434 0.000502
NP_440888.1_2 Reverse -322 -336 13.2736 0.0307
NP_439969.1_3 Reverse -317 -336 8.35759 0.127
NP_442948.1_2 Reverse -321 -340 11.7008 0.128
NP_442948.1_2 Forward -332 -313 7.07928 0.229
NP_442277.1_4 Reverse -313 -332 17.8948 0.0257
NP_442033.1_10 Reverse -320 -339 -0.39387 0.119
NP_441543.1_2 Forward -330 -321 18.486 0.00236
NP_441543.1_2 Reverse -323 -332 15.9293 0.00518
NP_441543.1_2 Forward -132 -123 7.07956 0.131
NP_442845.1_2 Reverse -118 -132 4.22782 0.264
NP_442845.1_2 Reverse -316 -330 3.44117 0.29
NP_441319.1_5 Forward -330 -311 9.0459 0.271
NP_441918.1_7 Reverse -265 -284 -1.27885 0.297
NP_441469.1_8 Reverse -321 -330 16.126 0.00797
NP_441469.1_8 Reverse -123 -132 12.1928 0.123
NP_441469.1_8 Forward -332 -323 6.5879 0.227
NP_441469.1_8 Forward -134 -125 5.70292 0.257
NP_443064.1_6 Reverse -322 -332 10.8217 0.13
NP_442578.1_7 Forward -330 -323 14.5921 0.026
NP_442578.1_7 Reverse -323 -330 14.5921 0.026
NP_440071.1_4 Forward -115 -96 12.1925 0.265
NP_441462.1_2 Reverse -322 -332 20.2362 0.000805
NP_441462.1_2 Forward -331 -321 11.5831 0.00406
NP_441462.1_2 Reverse -124 -134 1.65166 0.0831
NP_441462.1_2 Forward -133 -123 0.471689 0.148
NP_441621.1_7 Reverse -320 -334 14.0609 0.0266
NP_441621.1_7 Forward -333 -319 -3.34366 0.188
NP_443062.1_1 Reverse -322 -340 9.32598 0.136
NP_443062.1_1 Reverse -124 -142 8.35091 0.155
NP_443062.1_1 Forward -331 -313 6.01073 0.211
NP_443062.1_6 Forward -339 -320 7.17762 0.173
NP_440519.1_3 Forward -217 -198 8.75091 0.282
NP_442204.1_1 Forward -335 -324 21.1015 0.0035
NP_442204.1_1 Reverse -120 -131 1.33697 0.274
NP_442204.1_5 Reverse -312 -331 22.8122 0.0231
NP_440544.1_2 Forward -399 -380 7.7676 0.222
NP_440516.1_8 Forward -331 -322 16.9127 0.00442
NP_440516.1_8 Reverse -322 -331 16.9127 0.00442
NP_440516.1_8 Forward -275 -266 -0.000272808 0.156
NP_440516.1_8 Reverse -124 -133 -0.196935 0.185
NP_442428.1_5 Forward -330 -323 15.8704 0.0124
NP_442428.1_5 Reverse -323 -330 15.8704 0.0124
NP_442428.1_5 Reverse -125 -132 14.1988 0.0242
NP_442428.1_5 Forward -132 -125 6.0373 0.212
NP_442120.1_10 Reverse -316 -335 -13.5702 0.286
NP_440673.1_3 Forward -329 -322 12.4288 0.0426
NP_440673.1_3 Reverse -324 -331 12.4288 0.0426
NP_440673.1_3 Forward -131 -124 11.6422 0.0724
NP_440673.1_7 Reverse -311 -330 5.50599 0.178
NP_440865.1_9 Reverse -316 -335 -7.37537 0.244
NP_441052.1_2 Forward -331 -321 10.5014 0.0285
NP_441052.1_2 Reverse -322 -332 10.4031 0.0285
NP_442219.1_9 Forward -330 -321 8.35786 0.0681
NP_442219.1_9 Reverse -323 -332 8.25953 0.0681
NP_442219.1_9 Forward -74 -65 2.85133 0.218
NP_440436.1_4 Forward -330 -321 18.1905 0.00233
NP_440436.1_4 Forward -132 -123 12.979 0.0276
NP_440436.1_4 Reverse -323 -332 9.24241 0.0871
NP_441884.1_8 Reverse -321 -340 -11.0136 0.268
NP_441884.1_9 Reverse -319 -338 -14.5535 0.138
NP_440314.1_3 Reverse -88 -104 16.8731 0.0811
NP_440314.1_9 Forward -132 -113 -7.37537 0.24
NP_440314.1_9 Reverse -323 -342 -9.83364 0.278
NP_441086.1_3 Reverse -178 -197 6.71318 0.276
NP_441719.1_2 Reverse -14 -28 13.3484 0.286
NP_441719.1_4 Forward -330 -323 16.3621 0.0124
NP_441719.1_4 Reverse -323 -330 16.3621 0.0124
NP_441719.1_4 Reverse -125 -132 6.62729 0.151
NP_441719.1_4 Forward -132 -125 6.52896 0.188
NP_441733.1_10 Reverse -319 -332 10.5407 0.106
NP_441733.1_10 Forward -334 -321 5.82081 0.203
NP_441004.1_1 Reverse -60 -79 -13.8652 0.262
NP_441004.1_1 Reverse -118 -137 -15.6352 0.276
NP_441004.1_1 Reverse -316 -335 -18.1918 0.298
NP_442813.1_4 Reverse -314 -333 -5.70374 0.299
NP_442366.1_3 Forward -332 -314 0.412472 0.172
NP_442366.1_3 Reverse -321 -339 -1.06249 0.204
NP_442366.1_3 Reverse -195 -213 -4.11075 0.264
NP_442366.1_3 Reverse -123 -141 -5.58572 0.289
NP_440129.1_10 Forward -338 -324 5.01447 0.185
NP_441115.1_4 Forward -332 -314 21.7494 0.00196
NP_441115.1_4 Reverse -321 -339 10.6381 0.17
NP_441115.1_4 Forward -134 -116 8.6715 0.24
NP_442694.1_4 Forward -379 -370 12.2911 0.253
NP_442206.1_10 Reverse -322 -337 12.2713 0.0889
NP_442206.1_10 Reverse -124 -139 10.2063 0.135
NP_442206.1_10 Forward -275 -260 1.74985 0.219
NP_440328.1_4 Reverse -316 -335 0.196116 0.258
NP_443054.1_2 Forward -333 -319 19.7641 0.0121
NP_441851.1_10 Reverse -321 -331 16.008 0.00552
NP_441851.1_10 Reverse -123 -133 15.8113 0.00552
NP_441851.1_10 Forward -332 -322 8.53483 0.114
NP_442011.1_1 Forward -397 -378 -1.08219 0.268
NP_440593.1_3 Reverse -317 -336 -5.99873 0.268
NP_440165.1_5 Reverse -321 -340 0.687771 0.143
NP_441349.1_10 Reverse -312 -331 1.86774 0.0795
NP_441349.1_10 Forward -341 -322 -7.4737 0.251
NP_441409.1_6 Reverse -118 -137 -7.57203 0.153
NP_441409.1_6 Forward -337 -318 -8.94866 0.178
NP_440389.1_5 Forward -289 -270 13.1865 0.261
NP_440432.1_9 Forward -330 -315 -2.38005 0.17
NP_440432.1_9 Reverse -323 -338 -4.54333 0.211
NP_439960.1_6 Forward -337 -318 7.47261 0.28
NP_439960.1_10 Forward -338 -320 4.05072 0.163
NP_440474.1_8 Reverse -140 -154 12.782 0.0806
NP_440474.1_8 Forward -330 -316 8.45543 0.186
NP_440877.1_1 Forward -188 -169 16.5191 0.128
NP_440431.1_3 Reverse -321 -340 -4.22878 0.178
NP_442450.1_5 Reverse -122 -132 9.41981 0.115
NP_440588.1_2 Forward -340 -321 3.93269 0.0929
NP_440588.1_2 Reverse -313 -332 -2.55715 0.167
NP_440588.1_2 Forward -142 -123 -3.44213 0.186
NP_440040.1_8 Forward -190 -171 7.4002 0.203
NP_442006.1_2 Forward -35 -18 -16.0874 0.238
NP_441003.1_9 Forward -142 -123 4.42435 0.281
NP_441570.1_1 Forward -275 -257 2.28076 0.0252
NP_441570.1_1 Reverse -322 -340 -17.5821 0.283
NP_441078.1_4 Forward -331 -322 19.6659 0.0007
NP_441078.1_4 Reverse -322 -331 19.6659 0.0007
NP_441078.1_4 Reverse -124 -133 7.66954 0.052
NP_441078.1_4 Forward -133 -124 0.491382 0.188
NP_442729.1_8 Reverse -318 -331 8.47575 0.125
NP_442729.1_8 Reverse -120 -133 5.62415 0.238
NP_442348.1_2 Reverse -110 -119 15.7327 0.119
NP_442443.1_1 Forward -274 -255 -1.18052 0.231
NP_442443.1_4 Forward -291 -281 13.6475 0.233
NP_440526.1_3 Forward -330 -319 11.7595 0.0646
NP_440526.1_3 Forward -132 -121 1.6315 0.267
NP_441432.1_8 Forward -332 -323 16.8143 0.00595
NP_441432.1_8 Reverse -321 -330 8.25953 0.0755
NP_441432.1_8 Reverse -123 -132 5.60459 0.147
NP_441432.1_8 Forward -276 -267 4.71961 0.197
NP_442320.1_8 Reverse -316 -330 24.2873 0.00275
NP_442320.1_8 Forward -337 -323 -2.95034 0.1
NP_442320.1_8 Reverse -118 -132 -3.147 0.11
NP_441732.1_2 Forward -335 -319 3.20513 0.0141
NP_441732.1_2 Forward -137 -121 -17.7394 0.292
NP_442540.1_5 Forward -336 -317 12.585 0.233
NP_442797.1_6 Reverse -377 -396 8.32199 0.265
NP_442489.1_7 Forward -331 -322 20.1576 0.000695
NP_442489.1_7 Reverse -322 -331 20.1576 0.000695
NP_442489.1_7 Reverse -124 -133 8.1612 0.0294
NP_442489.1_7 Forward -133 -124 0.491382 0.178
NP_440941.1_1 Forward -379 -369 17.0896 0.223
NP_440386.1_3 Reverse -335 -354 -4.32711 0.221
NP_442079.1_7 Reverse -323 -342 -0.000545616 0.287
NP_440559.1_1 Forward -330 -321 8.75118 0.0586
NP_440559.1_1 Reverse -323 -332 8.65285 0.0586
NP_440559.1_1 Forward -132 -123 7.66954 0.0999
NP_440559.1_1 Forward -274 -265 4.22796 0.292
NP_441659.2_8 Reverse -322 -332 20.9245 0.000805
NP_441659.2_8 Forward -331 -321 11.9764 0.0147
NP_441659.2_8 Reverse -124 -134 7.84651 0.054
NP_441659.2_8 Forward -133 -123 7.74818 0.0566
NP_442913.1_10 Reverse -313 -332 -1.86883 0.178
NP_440708.1_6 Reverse -92 -111 -8.06369 0.255
NP_440708.1_6 Reverse -371 -390 -9.83364 0.274
NP_442776.1_1 Forward -390 -371 9.3409 0.181
NP_442776.1_2 Reverse -111 -130 8.75091 0.258
NP_440779.1_5 Forward -331 -314 -5.76269 0.152
NP_442346.1_5 Forward -332 -322 16.303 0.00248
NP_442346.1_5 Reverse -123 -133 15.9097 0.00378
NP_442346.1_5 Reverse -321 -331 9.02648 0.118
NP_442346.1_5 Forward -134 -124 5.68323 0.234
NP_440545.1_3 Forward -137 -120 8.49531 0.0444
NP_440545.1_3 Reverse -318 -335 8.39697 0.0444
NP_440545.1_3 Forward -335 -318 8.00365 0.0471
NP_440545.1_3 Reverse -120 -137 -2.51776 0.187
NP_440555.1_1 Forward -144 -125 2.3594 0.294
NP_440555.1_7 Reverse -64 -83 15.1424 0.267
NP_441126.1_6 Forward -291 -277 16.0332 0.248
NP_440459.1_2 Forward -333 -316 14.7885 0.119
NP_440459.1_7 Reverse -320 -334 17.3641 0.0994
NP_442603.1_7 Reverse -322 -336 7.27547 0.211
NP_442603.1_7 Forward -133 -119 6.0955 0.259
NP_441585.1_5 Forward -386 -367 6.29183 0.211
NP_441888.1_7 Forward -336 -322 13.3726 0.0743
NP_441888.1_7 Reverse -317 -331 2.5562 0.225
NP_441888.1_7 Forward -138 -124 1.67122 0.241
NP_440449.1_6 Reverse -314 -332 23.4289 0.00876
NP_441502.1_3 Forward -333 -314 9.24257 0.212
NP_441833.1_4 Forward -330 -323 15.9687 0.0124
NP_441833.1_4 Reverse -323 -330 15.9687 0.0124
NP_441833.1_4 Reverse -125 -132 6.23397 0.163
NP_441833.1_4 Forward -132 -125 6.13563 0.198
NP_442162.1_9 Forward -330 -323 16.2637 0.0124
NP_442162.1_9 Reverse -323 -330 16.2637 0.0124
NP_442162.1_9 Reverse -125 -132 6.62729 0.142
NP_442162.1_9 Forward -132 -125 6.43063 0.208
NP_442162.1_9 Reverse -267 -274 3.4807 0.246
NP_442162.1_9 Forward -274 -267 3.38237 0.276
NP_440671.1_4 Forward -337 -323 9.14437 0.184
NP_440671.1_4 Reverse -316 -330 8.06273 0.204
NP_440671.1_4 Reverse -118 -132 6.88276 0.233
NP_442073.1_8 Forward -143 -124 8.4551 0.267
NP_442199.1_5 Forward -339 -320 9.63589 0.0601
NP_442140.1_3 Forward -330 -320 17.4829 0.0159
NP_442140.1_3 Reverse -125 -135 6.66654 0.159
NP_442140.1_3 Reverse -323 -333 4.69992 0.238
NP_440875.1_9 Forward -329 -319 17.619 0.0104
NP_440875.1_9 Reverse -324 -334 16.5483 0.0145
NP_441813.1_5 Forward -333 -323 18.1713 0.00743
NP_441813.1_5 Reverse -320 -330 10.0098 0.0208
NP_441813.1_5 Reverse -122 -132 6.37155 0.0947
NP_441813.1_5 Reverse -264 -274 2.53664 0.184
NP_442028.1_1 Reverse -303 -316 7.60564 0.292
NP_440590.1_4 Forward -330 -317 21.7504 0.00377
NP_440590.1_4 Reverse -323 -336 -2.63565 0.247
NP_440590.1_4 Forward -132 -119 -5.38892 0.277
NP_440567.1_1 Forward -330 -316 18.8791 0.0136
NP_440567.1_1 Reverse -323 -337 6.58777 0.0816
NP_442497.1_10 Reverse -323 -332 17.601 0.00813
NP_442497.1_10 Forward -330 -321 10.4228 0.0087
NP_442497.1_10 Forward -132 -123 10.0295 0.0222
NP_442497.1_10 Reverse -125 -134 5.99792 0.095
NP_440821.1_4 Reverse -320 -330 18.7612 0.00422
NP_440821.1_4 Reverse -122 -132 10.1081 0.0188
NP_440821.1_4 Forward -333 -323 2.24165 0.131
NP_441239.1_9 Reverse -320 -332 16.0669 0.0175
NP_441239.1_9 Forward -333 -321 15.5753 0.0186
NP_441239.1_9 Forward -135 -123 15.2803 0.0217
NP_441239.1_9 Reverse -122 -134 7.11881 0.169
NP_441009.1_7 Forward -276 -257 23.9922 0.0242
NP_440400.1_1 Forward -142 -123 -2.36125 0.285
NP_442044.1_1 Reverse -124 -143 -7.4737 0.224
NP_442270.1_9 Forward -80 -61 -9.14533 0.228
NP_442643.1_1 Reverse -316 -335 -10.522 0.231
NP_441017.1_8 Reverse -107 -122 11.583 0.188
NP_442138.1_10 Reverse -322 -341 -0.688862 0.16
NP_440546.1_4 Reverse -322 -332 13.5365 0.0459
NP_440546.1_4 Forward -331 -321 11.8882 0.0679
NP_441509.1_2 Reverse -371 -389 11.1305 0.245
NP_441230.1_5 Reverse -317 -336 3.6377 0.194
NP_440462.1_6 Forward -333 -323 18.7612 0.00454
NP_440462.1_6 Reverse -320 -330 17.9746 0.00578
NP_442611.1_1 Forward -153 -134 -3.04881 0.297
NP_440868.1_4 Forward -335 -323 8.00379 0.0602
NP_440868.1_4 Reverse -318 -330 2.98891 0.142
NP_440868.1_4 Forward -279 -267 1.12062 0.192
NP_442499.1_3 Reverse -123 -141 3.95239 0.289
NP_442479.1_2 Forward -379 -360 11.7992 0.19
NP_442402.1_2 Reverse -10 -24 11.7987 0.272
NP_442402.1_4 Forward -227 -208 -10.2277 0.298
NP_442402.1_10 Forward -44 -34 13.1559 0.204
NP_442402.1_10 Reverse -312 -322 11.6809 0.241
NP_441848.1_4 Reverse -336 -352 7.64616 0.288
NP_441084.1_6 Forward -333 -319 12.4467 0.16
NP_440696.1_6 Reverse -112 -131 9.14423 0.229
NP_442039.1_4 Forward -330 -323 15.1821 0.0124
NP_442039.1_4 Reverse -323 -330 15.1821 0.0124
NP_442039.1_4 Forward -274 -267 9.47889 0.145
NP_442039.1_4 Reverse -125 -132 6.3323 0.289
NP_442837.1_3 Forward -330 -323 15.7721 0.0124
NP_442837.1_3 Reverse -323 -330 15.7721 0.0124
NP_442837.1_3 Reverse -125 -132 6.0373 0.25
NP_442837.1_3 Forward -132 -125 5.93897 0.265
NP_442053.1_1 Forward -331 -322 18.3876 0.0007
NP_442053.1_1 Reverse -322 -331 18.3876 0.0007
NP_442053.1_1 Reverse -266 -275 5.99792 0.153
NP_440505.1_3 Forward -333 -323 17.188 0.00332
NP_440505.1_3 Reverse -320 -330 14.1397 0.0235
NP_440505.1_3 Reverse -108 -118 10.3048 0.112
NP_441102.1_1 Reverse -323 -342 13.2741 0.108
NP_441203.1_1 Forward -132 -113 -2.45882 0.0655
NP_441203.1_1 Forward -330 -311 -18.7818 0.297
NP_442532.1_7 Reverse -124 -138 3.44117 0.197
NP_440914.1_1 Reverse -322 -332 16.3248 0.00196
NP_440914.1_1 Reverse -124 -134 12.9091 0.0435
NP_440914.1_1 Forward -119 -109 10.9573 0.116
NP_440914.1_1 Forward -331 -321 8.6151 0.186
NP_441011.1_8 Forward -330 -321 16.9127 0.00602
NP_441011.1_8 Reverse -323 -332 16.6177 0.00602
NP_441011.1_8 Reverse -125 -134 5.40793 0.263
NP_442101.1_10 Forward -141 -122 -11.3086 0.263
NP_442533.1_6 Forward -331 -322 17.2076 0.00137
NP_442533.1_6 Reverse -322 -331 17.2076 0.00137
NP_442533.1_6 Forward -133 -124 7.66954 0.0897
NP_442533.1_6 Reverse -124 -133 6.8829 0.101
NP_442533.1_6 Reverse -266 -275 1.76968 0.289
NP_440263.1_3 Reverse -316 -335 4.12936 0.243
NP_441219.1_4 Reverse -106 -125 7.07928 0.217
NP_441482.1_7 Forward -337 -323 14.4542 0.0118
NP_441482.1_7 Reverse -118 -132 -1.5737 0.0755
NP_439944.1_9 Forward -330 -320 10.4031 0.0887
NP_439944.1_9 Reverse -323 -333 9.12481 0.1
NP_439944.1_9 Forward -132 -122 7.74818 0.131
NP_441697.1_5 Reverse -231 -250 -3.96334 0.22
NP_440116.1_5 Reverse -319 -336 3.67709 0.225
NP_440116.1_8 Reverse -323 -342 -6.58872 0.211
NP_441527.1_4 Forward -33 -14 -10.0748 0.264
NP_440115.1_6 Forward -334 -324 14.0414 0.0615
NP_440007.1_9 Reverse -120 -134 15.1426 0.163
NP_440007.1_9 Forward -335 -321 2.06454 0.281
NP_441680.1_4 Forward -333 -314 -1.47551 0.262
NP_441347.1_5 Forward -337 -323 9.43874 0.269
NP_441602.1_3 Forward -336 -317 -0.0988766 0.219
NP_441602.1_3 Reverse -317 -336 -5.50708 0.288
NP_441972.1_5 Forward -330 -311 -5.31042 0.218
NP_441972.1_5 Forward -342 -323 -9.63698 0.292
NP_441106.1_1 Forward -332 -323 18.486 0.0028
NP_441106.1_1 Reverse -321 -330 18.191 0.0028
NP_441106.1_1 Reverse -123 -132 6.5879 0.0893
NP_439903.1_6 Forward -142 -123 5.89851 0.176
NP_442588.1_6 Forward -387 -368 4.12936 0.202
NP_442306.1_10 Forward -336 -317 -19.0768 0.197
NP_441286.1_1 Forward -332 -320 5.34885 0.0259
NP_441286.1_1 Forward -134 -122 3.38223 0.0467
NP_441286.1_1 Reverse -321 -333 -3.59927 0.145
NP_441286.1_1 Forward -276 -264 -6.74586 0.278
NP_440670.1_8 Forward -331 -322 18.3876 0.000699
NP_440670.1_8 Reverse -322 -331 18.3876 0.000699
NP_440670.1_8 Reverse -124 -133 6.78456 0.099
NP_440670.1_8 Forward -275 -266 6.48957 0.118
NP_440670.1_8 Forward -133 -124 5.3096 0.167
NP_440670.1_8 Reverse -266 -275 3.14632 0.296
NP_441479.1_1 Reverse -319 -338 9.43923 0.216
NP_440886.1_7 Reverse -321 -331 17.7774 0.0011
NP_440886.1_7 Forward -332 -322 8.04271 0.0805
NP_442072.1_9 Forward -332 -314 -3.42244 0.0355
NP_442072.1_9 Reverse -321 -339 -22.4003 0.234
NP_442072.1_9 Reverse -123 -141 -22.4003 0.234
NP_440907.2_8 Forward -330 -320 17.4824 0.00685
NP_440907.2_8 Reverse -323 -333 9.616 0.103
NP_440907.2_8 Reverse -125 -135 4.30615 0.269
NP_441021.1_1 Forward -205 -186 -6.1954 0.177
NP_441021.1_1 Forward -132 -113 -8.752 0.2
NP_441463.1_3 Forward -365 -346 -2.75381 0.16
NP_441463.1_3 Forward -341 -322 -9.83364 0.286
NP_442842.1_10 Reverse -169 -188 8.81407 0.207
NP_441626.1_2 Forward -330 -323 15.7721 0.0124
NP_441626.1_2 Reverse -323 -330 15.7721 0.0124
NP_441626.1_2 Forward -166 -159 7.6106 0.119
NP_441626.1_2 Reverse -125 -132 6.52896 0.137
NP_441626.1_2 Forward -132 -125 5.93897 0.231
NP_439958.1_2 Forward -58 -44 10.816 0.297
NP_442238.1_1 Reverse -124 -143 2.55606 0.215
NP_440107.1_5 Forward -338 -319 -6.29373 0.243
NP_442794.1_1 Forward -335 -323 10.5604 0.0721
NP_442794.1_1 Reverse -120 -132 4.8572 0.244
NP_442615.1_1 Reverse -313 -331 11.0322 0.0188
NP_442615.1_1 Forward -340 -322 -7.15901 0.278
NP_441962.1_4 Forward -336 -317 -10.0303 0.223
NP_441962.1_4 Reverse -317 -336 -10.3253 0.226
NP_441962.1_4 Reverse -119 -138 -15.0452 0.297
NP_440387.1_1 Reverse -124 -140 5.56507 0.0315
NP_440387.1_1 Reverse -322 -338 -0.334789 0.137
NP_441431.1_2 Forward -334 -320 13.1753 0.0952
NP_441431.1_2 Reverse -319 -333 9.24208 0.19
NP_441488.1_7 Forward -337 -318 7.66927 0.124
NP_441993.1_1 Reverse -316 -335 12.3746 0.101
NP_441174.1_2 Forward -334 -320 19.8624 0.00567
NP_440114.1_10 Forward -331 -317 6.88276 0.253
NP_441853.1_5 Reverse -106 -125 0.0977854 0.287
NP_442323.1_7 Forward -336 -317 6.29183 0.195
NP_442323.1_7 Forward -138 -119 3.63691 0.238
NP_441272.1_4 Reverse -313 -332 7.57094 0.189
NP_440766.1_4 Reverse -318 -332 8.35772 0.0871
NP_440766.1_4 Forward -335 -321 7.76774 0.0871
NP_442743.1_1 Forward -79 -60 4.52188 0.292
NP_442743.1_4 Forward -330 -311 0.0977854 0.174
NP_442743.1_8 Reverse -39 -58 8.15482 0.267
NP_439910.1_2 Reverse -314 -331 -21.9873 0.202
NP_440502.1_7 Forward -28 -9 12.2908 0.291
NP_440457.1_1 Reverse -120 -132 14.297 0.0736
NP_440457.1_1 Forward -335 -323 7.70879 0.101
NP_440457.1_1 Reverse -318 -330 5.34885 0.141
NP_440457.1_1 Reverse -68 -80 3.57889 0.191
NP_440798.1_6 Forward -330 -317 3.85419 0.147
NP_441801.1_4 Reverse -373 -383 11.0914 0.231
NP_442509.1_9 Forward -331 -321 16.2041 0.00739
NP_442509.1_9 Reverse -322 -332 8.04271 0.192
NP_440524.1_2 Forward -131 -112 1.67108 0.26
NP_442936.1_10 Forward -19 -5 8.97675 0.269
NP_442514.1_5 Forward -77 -58 -6.29447 0.265
NP_440554.1_4 Reverse -323 -333 17.9746 0.0131
NP_440554.1_4 Forward -330 -320 13.943 0.0218
NP_440554.1_4 Forward -132 -122 4.0116 0.205
NP_441885.1_5 Forward -331 -321 11.4848 0.00668
NP_441885.1_5 Reverse -322 -332 11.3864 0.00668
NP_441885.1_5 Forward -275 -265 -0.0199663 0.186
NP_440478.1_10 Reverse -320 -334 14.5526 0.107
NP_442341.1_7 Forward -332 -318 13.5693 0.0338
NP_442341.1_7 Reverse -321 -335 1.67122 0.282
NP_442341.1_9 Forward -135 -121 9.53707 0.151
NP_441756.1_5 Reverse -318 -337 -3.04881 0.287
NP_442395.2_4 Reverse -321 -340 11.5033 0.0907
NP_442395.2_4 Forward -332 -313 1.96529 0.229
NP_443000.1_7 Forward -333 -323 20.3345 0.00223
NP_443000.1_7 Reverse -320 -330 2.04498 0.226
NP_441842.1_10 Reverse -315 -329 18.5841 0.0173
NP_440275.1_3 Reverse -320 -330 17.9746 0.0082
NP_440275.1_3 Forward -333 -323 16.1063 0.0155
NP_440091.1_1 Reverse -318 -330 12.6253 0.0353
NP_443060.1_1 Reverse -377 -396 8.75009 0.276
NP_441359.1_5 Forward -334 -315 18.289 0.0475
NP_440175.1_10 Forward -143 -124 11.6025 0.219
NP_441105.1_3 Forward -342 -323 18.584 0.00932
NP_441105.1_3 Reverse -311 -330 -1.67217 0.151
NP_440216.1_1 Forward -331 -317 8.25939 0.0061
NP_440216.1_1 Reverse -322 -336 7.27608 0.00942
NP_440216.1_6 Reverse -315 -331 15.2015 0.0619
NP_440216.1_9 Forward -204 -195 11.3078 0.269
NP_440172.1_1 Reverse -322 -332 17.5813 0.00421
NP_440172.1_1 Forward -331 -321 8.73149 0.0586
NP_440172.1_1 Reverse -124 -134 8.23984 0.0653
NP_442015.1_10 Forward -335 -322 13.4906 0.0354
NP_442015.1_10 Forward -137 -124 4.64084 0.166
NP_442015.1_10 Reverse -318 -331 3.95252 0.178
NP_442015.1_10 Reverse -120 -133 -1.16069 0.297
NP_441226.1_7 Forward -330 -323 14.4934 0.0123
NP_441226.1_7 Reverse -323 -330 14.4934 0.0123
NP_441226.1_7 Forward -132 -125 14.1984 0.024
NP_441111.1_7 Forward -330 -322 18.7023 0.00294
NP_441111.1_7 Reverse -323 -331 18.7023 0.00294
NP_441111.1_7 Forward -132 -124 8.86921 0.0589
NP_441111.1_7 Reverse -267 -275 -0.570565 0.233
NP_441766.1_2 Forward -331 -322 17.5026 0.00297
NP_441766.1_2 Reverse -322 -331 17.5026 0.00297
NP_441766.1_2 Forward -133 -124 6.39124 0.0993
NP_441766.1_2 Reverse -266 -275 3.24465 0.227
NP_442417.1_5 Reverse -322 -336 16.2242 0.0423
NP_442417.1_5 Forward -388 -374 6.88276 0.201
NP_442417.1_5 Reverse -124 -138 5.89945 0.244
NP_440416.1_9 Reverse -315 -334 -5.40875 0.0797
NP_440416.1_9 Forward -338 -319 -14.8485 0.18
NP_443052.1_8 Reverse -312 -331 -2.55715 0.0911
NP_440591.1_9 Reverse -315 -333 4.44404 0.279
NP_440261.1_5 Forward -330 -317 -1.06236 0.0655
NP_440261.1_5 Reverse -323 -336 -2.73398 0.0924
NP_440261.1_5 Forward -132 -119 -12.3704 0.284
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATTTGGAGATGCCGCAACCCAGGGAGTTTGGGCCTTAATCAATAACGAGATTTCTACTCAAATTACCCAGGCGATCGCCGCTGGAAAACAGATTATTTATGATGCTACTAATGCCGAAAAAGCTTGGCGCTCGGAATTATTGGGCAGCTTAAAAAAATTGGATGACTTGAAGATTATTGGTTGGTATTTACAAACGCCATTGGAAGTTTGCTACCAAAGGAATAAAAATAGACTGCGACAGGTTCCCGAAGATGTGATTGAGACCTATGCCATCGCCCTAGAACAATCCCCTCCCAGCAAAGATGAAGGATTTACTGAACTCCACCGCATTCCCTATAACCAACTAGAAAACATTGATTTTTCACAGCTAAGAAGTCAGTGGAAAAACTAATTTCTAACA

CDS

GTGAGATATAAAAATAATTGTCGAATCAATAGAATTGGAAAAGACAAAATGACTACTTGCATCAACAATAGCTTGTTCACCATTGAGCCCTACTGGGTCGGCCGCACTTGGGCCTTTGATGCCCCTAATTTGGGAGTCATGGCAGAACCCTTTGTGGCGGGCACCAATATTGTTTTAACCCAATTAGCTAAGACACGCTTGGGCATTGAACCTAGTGACGGAGCTAAGTTTCAGTTGATTTTTAGTGCCCAGAAATTTCCAGGTTTGCACTTGAGCTTTCGCCGCCAGGAACCCGAATTTGATGGTTACTGGTATATCAGTGAAAGCCAAGATTGGGCCTGGTTTTCCTCTGCGATGACGAGCTTTTTTAGCAATGGACACCCCGAAGAACTTCATCTACAGGTTTTAAGATAA

Protein

No sequence available