Your browser is old and dusty. Try Google Chrome!

Details for slr7060

ORF slr7060
Accession NP_942348.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_442100.1_1 Reverse -78 -97 9.69201 0.229
NP_440815.1_2 Forward -352 -338 10.2254 0.265
NP_440897.1_9 Forward -293 -275 12.6047 0.223
NP_441623.1_6 Reverse -352 -371 12.7825 0.252
NP_441818.1_9 Reverse -211 -230 -9.14533 0.287
NP_443027.1_4 Reverse -209 -219 6.37155 0.283
NP_441812.1_1 Forward -257 -243 15.1419 0.201
NP_440110.1_8 Forward -222 -203 -1.86883 0.252
NP_441492.1_1 Forward -21 -2 14.0608 0.148
NP_439918.1_3 Reverse -242 -261 3.73603 0.266
NP_442276.1_1 Forward -171 -152 10.4217 0.247
NP_441109.1_3 Forward -167 -148 8.55343 0.267
NP_441434.1_8 Forward -39 -20 12.0647 0.169
NP_440209.1_1 Reverse -357 -365 5.13263 0.17
NP_442889.1_8 Forward -369 -355 16.7152 0.0238
NP_441770.1_4 Forward -365 -346 -7.86702 0.238
NP_442570.1_3 Reverse -204 -223 -7.4737 0.27
NP_442570.1_3 Reverse -333 -352 -8.55534 0.288
NP_441327.1_1 Reverse -248 -267 12.0943 0.184
NP_441163.1_4 Forward -226 -207 20.5686 0.154
NP_440343.1_9 Reverse -273 -292 9.73422 0.248
NP_441486.1_1 Reverse -354 -368 -5.90027 0.266
NP_441265.1_3 Forward -226 -212 2.75286 0.186
NP_443018.1_3 Forward -365 -358 11.3472 0.0846
NP_443018.1_3 Reverse -358 -365 4.16902 0.278
NP_442485.1_3 Reverse -346 -365 -4.6221 0.285
NP_441846.1_10 Forward -318 -299 -17.7985 0.256
NP_441846.1_10 Reverse -206 -225 -23.01 0.275
NP_442770.1_10 Forward -255 -241 16.8182 0.287
NP_440533.1_6 Reverse -135 -154 8.94757 0.276
NP_440887.1_4 Forward -145 -126 16.5299 0.173
NP_439959.1_3 Reverse -214 -233 8.84924 0.286
NP_442937.1_5 Reverse -352 -371 10.9142 0.151
NP_441317.1_4 Reverse -10 -24 14.143 0.161
NP_442486.1_4 Forward -242 -223 10.2259 0.226
NP_439905.1_1 Forward -110 -97 7.19745 0.264
NP_441097.1_2 Reverse -141 -158 12.3302 0.172
NP_442690.1_1 Reverse -40 -59 -13.0786 0.254
NP_442911.1_2 Forward -376 -357 -7.57203 0.214
NP_442911.1_2 Reverse -91 -110 -9.24366 0.252
NP_442064.1_10 Forward -49 -30 16.9124 0.127
NP_443055.1_6 Reverse -349 -367 0.116744 0.249
NP_442431.1_10 Reverse -208 -226 11.2289 0.102
NP_441752.1_6 Forward -239 -220 -0.885524 0.279
NP_441916.1_7 Reverse -357 -367 1.55333 0.282
NP_440345.1_3 Forward -267 -253 12.2346 0.247
NP_441547.1_1 Reverse -95 -114 2.45773 0.279
NP_440703.1_9 Forward -73 -60 4.54195 0.296
NP_441725.1_5 Reverse -358 -368 0.668351 0.156
NP_440289.1_2 Forward -377 -364 -4.40561 0.288
NP_442281.1_1 Reverse -352 -366 4.42388 0.195
NP_441644.1_1 Forward -393 -374 9.83255 0.282
NP_442029.1_6 Forward -119 -100 6.58763 0.238
NP_442933.1_3 Reverse -249 -268 14.3711 0.28
NP_442933.1_6 Reverse -8 -27 13.1297 0.287
NP_442926.1_3 Forward -121 -102 4.71934 0.25
NP_442554.1_8 Forward -365 -355 4.79825 0.173
NP_442554.1_8 Reverse -102 -112 2.7333 0.259
NP_442292.1_1 Forward -365 -356 5.80125 0.129
NP_441448.1_1 Forward -368 -349 6.19431 0.251
NP_441468.1_1 Reverse -358 -365 3.97235 0.277
NP_441015.1_10 Forward -399 -380 -10.522 0.284
NP_441731.1_1 Forward -58 -40 17.5725 0.229
NP_442719.1_2 Reverse -189 -207 4.34495 0.154
NP_442719.1_2 Reverse -44 -62 -11.4863 0.292
NP_442342.1_8 Reverse -42 -61 15.4374 0.181
NP_440558.1_2 Forward -375 -356 12.1925 0.0806
NP_442789.1_5 Reverse -346 -365 3.83436 0.215
NP_441518.1_3 Reverse -347 -366 3.14605 0.0556
NP_441878.1_6 Forward -367 -357 -0.314959 0.174
NP_441557.1_8 Forward -319 -309 12.8609 0.235
NP_441590.1_4 Reverse -381 -400 3.04693 0.29
NP_440440.1_1 Forward -224 -205 7.76679 0.258
NP_441574.1_1 Reverse -89 -108 -5.80207 0.268
NP_441633.1_3 Reverse -386 -399 -6.86388 0.277
NP_442764.1_6 Forward -364 -346 1.19912 0.288
NP_442590.1_9 Forward -367 -348 10.0292 0.23
NP_441728.2_5 Reverse -334 -353 15.5357 0.184
NP_442998.1_5 Reverse -223 -233 14.533 0.149
NP_442998.1_5 Reverse -347 -357 11.8781 0.176
NP_440299.1_1 Forward -370 -357 12.9 0.0333
NP_442961.1_4 Reverse -57 -76 5.99764 0.227
NP_441362.1_2 Reverse -248 -267 7.37522 0.243
NP_442967.1_10 Forward -248 -234 15.1214 0.281
NP_440306.1_8 Forward -43 -24 -3.63955 0.293
NP_441340.1_5 Forward -365 -358 4.07068 0.239
NP_442327.1_3 Reverse -5 -24 5.1084 0.28
NP_440211.1_4 Reverse -120 -130 16.303 0.215
NP_440586.1_8 Forward -365 -358 12.8218 0.0395
NP_441138.1_5 Reverse -334 -347 9.89744 0.238
NP_441138.1_5 Reverse -12 -25 3.21301 0.297
NP_442114.1_8 Forward -26 -12 3.63724 0.287
NP_441877.1_5 Reverse -50 -69 3.24438 0.237
NP_442262.1_10 Forward -365 -358 10.3639 0.153
NP_440531.1_8 Forward -399 -380 5.70265 0.249
NP_440297.1_9 Reverse -358 -368 9.22315 0.0917
NP_440894.1_7 Reverse -188 -207 14.1583 0.163
NP_441268.1_5 Forward -25 -11 21.5341 0.0393
NP_441543.1_2 Forward -365 -356 12.7828 0.0321
NP_441543.1_3 Reverse -370 -384 9.93039 0.226
NP_440544.1_5 Forward -264 -257 14.5681 0.264
NP_440516.1_6 Forward -110 -96 9.43874 0.238
NP_442428.1_5 Reverse -358 -365 4.36568 0.271
NP_440783.1_5 Reverse -206 -225 3.93269 0.15
NP_442120.1_10 Forward -240 -221 -16.3235 0.3
NP_440673.1_2 Reverse -347 -366 8.341 0.273
NP_441052.1_2 Forward -366 -356 4.99491 0.135
NP_440436.1_4 Forward -365 -356 4.7192 0.244
NP_442577.1_9 Forward -355 -341 10.8154 0.271
NP_441004.1_1 Reverse -135 -154 -16.6185 0.286
NP_441004.1_2 Reverse -302 -321 -4.32711 0.29
NP_442308.1_3 Reverse -210 -229 10.1275 0.297
NP_441851.1_10 Reverse -356 -366 4.3066 0.277
NP_441668.1_4 Forward -62 -43 -2.16383 0.288
NP_442515.1_1 Reverse -120 -134 0.0979218 0.203
NP_442515.1_1 Forward -301 -287 -0.688726 0.231
NP_441396.1_5 Forward -389 -380 8.35786 0.224
NP_441683.1_7 Reverse -274 -293 -11.8986 0.284
NP_440432.1_9 Forward -365 -350 -2.28172 0.169
NP_442843.1_1 Reverse -220 -239 -10.4236 0.278
NP_441124.1_5 Reverse -35 -45 10.8118 0.283
NP_442006.1_2 Reverse -348 -365 -16.5791 0.256
NP_442038.1_1 Reverse -251 -270 0.687771 0.278
NP_440526.1_3 Forward -365 -354 1.04151 0.267
NP_441432.1_8 Reverse -356 -365 4.22796 0.235
NP_441432.1_9 Reverse -4 -17 11.1192 0.235
NP_441432.1_9 Reverse -3 -16 9.08315 0.282
NP_440760.1_1 Reverse -357 -376 -10.4236 0.084
NP_441805.1_1 Forward -74 -55 -4.6221 0.25
NP_442751.1_1 Reverse -289 -308 16.632 0.222
NP_442010.1_1 Forward -268 -250 12.998 0.22
NP_442489.1_7 Reverse -357 -366 5.3096 0.0708
NP_440565.1_7 Reverse -208 -227 0.58944 0.249
NP_441706.1_1 Forward -194 -175 -3.24547 0.252
NP_440559.1_1 Forward -365 -356 4.71961 0.217
NP_441040.1_2 Reverse -355 -374 -16.3235 0.295
NP_441968.1_1 Forward -21 -13 15.162 0.257
NP_442346.1_5 Reverse -356 -366 4.79825 0.272
NP_440352.1_5 Forward -29 -10 9.73562 0.289
NP_441629.1_3 Reverse -371 -390 -4.32786 0.29
NP_440459.1_2 Forward -76 -59 7.31533 0.296
NP_441948.1_4 Reverse -204 -222 -2.83245 0.177
NP_441609.1_1 Forward -46 -27 -0.787193 0.242
NP_440821.1_4 Forward -368 -358 -0.314959 0.251
NP_441508.1_4 Forward -345 -331 13.476 0.297
NP_441017.1_6 Forward -370 -356 14.5519 0.144
NP_441526.1_6 Reverse -208 -227 5.60432 0.265
NP_442052.1_7 Reverse -209 -223 14.2576 0.22
NP_440546.1_6 Reverse -218 -237 7.66927 0.268
NP_440532.1_6 Forward -264 -245 9.93088 0.286
NP_442479.1_9 Forward -132 -113 -10.1286 0.266
NP_440638.2_3 Forward -256 -237 14.4541 0.153
NP_441084.1_6 Forward -368 -354 9.24716 0.29
NP_442039.1_7 Reverse -117 -127 10.9931 0.257
NP_442039.1_10 Reverse -379 -397 11.5231 0.284
NP_442829.1_2 Forward -331 -315 8.04446 0.287
NP_441926.1_3 Reverse -157 -173 4.48343 0.186
NP_441701.1_3 Reverse -147 -164 6.72535 0.275
NP_440914.1_7 Reverse -11 -30 6.73176 0.283
NP_442533.1_1 Reverse -208 -227 0.392778 0.136
NP_442533.1_1 Forward -383 -364 -15.1435 0.252
NP_441219.1_6 Reverse -48 -66 9.26226 0.276
NP_441482.1_7 Forward -372 -358 -2.26202 0.0962
NP_441697.1_5 Forward -48 -29 -8.54695 0.263
NP_440903.1_2 Reverse -256 -266 16.303 0.247
NP_441602.1_3 Forward -399 -380 -5.40875 0.285
NP_442306.1_10 Forward -115 -96 -19.4701 0.197
NP_441286.1_1 Reverse -356 -368 -4.77924 0.175
NP_441705.1_3 Forward -67 -48 -2.36049 0.284
NP_441705.1_3 Forward -211 -192 -2.55715 0.284
NP_441001.1_10 Reverse -91 -110 4.22769 0.295
NP_440083.1_1 Forward -99 -80 3.6377 0.265
NP_440083.1_1 Forward -139 -120 2.65439 0.265
NP_442213.1_5 Reverse -64 -83 8.16093 0.166
NP_442264.1_2 Forward -376 -359 6.52869 0.254
NP_441463.1_6 Forward -112 -98 5.35296 0.291
NP_441993.1_1 Forward -320 -301 2.62889 0.256
NP_442352.1_10 Reverse -47 -65 2.87075 0.246
NP_441237.1_9 Forward -365 -355 12.4681 0.12
NP_442743.1_8 Reverse -3 -22 7.77039 0.267
NP_442867.1_8 Reverse -298 -317 9.93088 0.214
NP_440457.1_1 Forward -370 -358 3.87389 0.182
NP_440457.1_1 Reverse -207 -219 3.18557 0.202
NP_440987.1_4 Reverse -248 -267 13.5691 0.143
NP_440081.1_4 Reverse -32 -51 17.1891 0.183
NP_442514.1_5 Reverse -298 -317 -6.58946 0.269
NP_442862.1_3 Reverse -218 -235 10.1669 0.216
NP_442862.1_3 Reverse -263 -280 5.84037 0.267
NP_441428.1_8 Reverse -93 -112 7.37428 0.206
NP_441173.1_9 Forward -43 -35 11.8187 0.222
NP_441173.1_9 Forward -127 -119 9.85212 0.275
NP_440507.2_3 Reverse -362 -381 9.04509 0.236
NP_441307.1_4 Forward -396 -377 14.2574 0.122
NP_442354.1_2 Forward -389 -370 2.75272 0.299
NP_440679.1_10 Reverse -204 -223 -20.2567 0.283
NP_442638.1_3 Reverse -26 -45 11.7928 0.298
NP_442495.1_5 Reverse -208 -227 8.06259 0.291
NP_441105.1_3 Reverse -352 -371 -7.57203 0.255
NP_440416.1_9 Forward -167 -148 -19.5684 0.276
NP_442116.1_6 Reverse -249 -266 20.9649 0.0788
NP_442116.1_6 Forward -59 -42 9.79232 0.227
NP_442116.1_6 Reverse -42 -59 9.60133 0.227
NP_440988.1_5 Reverse -110 -129 14.128 0.235
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGCGGCGTTTATTGGTGGAGGGTTACGGAGCTAGTGCCATCGACAATTTGGCCAAATCAAAAACCAATCAAGAACTAGAAGCCTTACTCCAGGGCGGGGTGGTACTAACCCTAACTCCTGCTAATCCAGCCCTTAATTTTCTCCAAGAAATTCAACAAAGGTCAGCTAAATCTGCCCCGGCTCCATCCCAGTCCAGGAAAGTTGGAAAAGCTGATGATTCTAATTTAGAAAAAACCGCATTACCAACCCCTTCTGTTTGGACAAGGTTAGTGATTTTGCCAGGTTTAGAAGTCCATGTCCGCAACGATTTTTTGTTACCCAGTACCCACCAAGAGCAAGAGAATCTTTGGCAAAGAATTTTACAAAGTCTTTCATCAATCAAGAAAAAAAGGTTTAATCA

CDS

ATGAATACGCCCCAAGTTAGTTTTATTCCCCTCAAAAATGCAGTTTGTTCCGAACGGGCAGTCACTCTAGATTTAATTATTCGGATTACTCCCCCTTCTCCACCGGCAATGGATCAGCCCCGACCAAGTTTAAACTTAGGGTTTGTGATTGATCGTTCTGGTTCTATGGAAGGCCATAACAAAATTACCTATGCCCGCCAAGCAGTGTGCTATGCCATTGACCAACTGTCCCCCGGCGATCACCTGAGTGTAACCATTTTTGATGACCAGGTACAAACCCTAATCCCTAGTACTTTAGTTAAGGATAAAGCCCAGTTCAAACGCTTAGTGCAGGGTATAAATCCTGGGGGCTGTACCGATTTACATGGCGGTTGGCTACAGGGAGGCATTCAAGTTAGTCAAAATTTGAGTGCTGAATTAAATCGCATCATTTTATTGTCCGATGGCTTAGCCAATCGAGGGGAAACTAACCCCGATATCATTGCCACCGATGTCCATGGTTTAGCCCAACGGGGAGCTAGTACTACGACCCTTGGTTTAGGGGATGACTACAACGAAGATTTGTTAGAAGCCATGGCCCGTAGTGGGGACGGTAATTATTACTACGTTGCCGATGCGGAACAATTACCGACTATTTTTGAGCGGGAATTGCAAGGTCTGGCCGCTACCTATGGCAATGGAGTTACTTTGACTGCCACTTCCCAGGCTGGCGTGCAGGTGTTGGATTTGTTGAATGATTTTGAGTTAGACAATCAAGGACGTTACCAACTACCTAATTTAATTTACGGTGACTCCATTGATGTGGTGGTACGGCTAAAAGTCCCAGCCATCAAAGAGGAACAAATCCTTGGTACGGTAACGTTGAGTTGGTTGGATGGGGAAAGGCAGAAACAGACCTTGATGGTGAATCTCCAACTGCCCGTATTGACCAAAGTAGAATTTGAAGCCCTACCGTCCAACCAAGAAGTGCAACAGCAGGTGGCTTTGATGATGTCCGCCCGGGCCAAAAAAGAAGCCATGGAACGGGTGGATCGGGGAGACTACGGGGGAGCCGGTCAGGTATTGCAGGAAGCCAGGGCAGAAATTGTCGGTGCTAATTTGCCCATGTCTGCCCCGGAAGCGGCGGCATTGGAGGATCTGGAACAAAAGTTAAATCAGCGAGAGTATAAGTCCTACCGAAAGATGGCCAGCGCTCAGAATTATCGGCGCAATTATCAACGTTCTGCTGGTCATTCCGATTTGCGCTATGCCTTCCAAAAGGGGCCTCGGTTGGGGGATATTACCAAGGAAAAAGCGGAAGCCATTGTTAATTCTACGGATCGTAATTTATCCAATAGTGGTGCTTTATCCAGAGCCATTCATCAAGCAGCAGGGCCAGAATTGTTGCAGGCTTGCCAGGATTTACAGGGATGTACGGTGGGAGGAGCCAAACTCACGCCTGGTTTTAATCTCCGGGCTAATTGGGTTATTCACACCGTTGCGCCTAAGTGGAAAGGAGGAAACCAAGGGGAAGAAGAATTACTGGTTAGTTGTTACCAAAACTGTTTGCAATTAGCGGTTTCCCAGAGCATTCGTAGTCTGGCTTTTCCGGCGATCGCCTGTGGGGCCATGGGTTTTCCCCCGGAAATAGCGGCCCGCATTGCGCTAGAAACCGTTAGTAATTTTCTCCTCTCCAACATGGCGATCGGCTCTGTGGCTTTTATTTGTGCTGATAAGGAAACTTTGCAGTATTACCAAGAGGCATTTCAACGGGTCGTCGCTTGGTAA

Protein

No sequence available