Your browser is old and dusty. Try Google Chrome!

Details for slr7054

ORF slr7054
Accession NP_942342.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -51 -65 7.27608 0.104
NP_440557.1_1 Reverse -333 -352 -1.7705 0.277
NP_442291.1_5 Forward -155 -139 -3.48138 0.242
NP_440897.1_9 Reverse -57 -75 14.0797 0.215
NP_441453.1_4 Reverse -50 -58 7.29591 0.0589
NP_441453.1_4 Forward -59 -51 6.70593 0.121
NP_441453.1_7 Forward -140 -133 14.1988 0.175
NP_442151.1_6 Reverse -56 -70 5.1128 0.294
NP_440561.1_4 Reverse -54 -73 15.3503 0.198
NP_440226.1_1 Forward -341 -322 5.80098 0.145
NP_440150.1_2 Reverse -121 -140 6.29183 0.261
NP_442173.1_1 Forward -58 -50 7.59091 0.163
NP_442173.1_1 Reverse -51 -59 5.82095 0.2
NP_442752.1_4 Forward -59 -52 13.8055 0.0199
NP_442752.1_4 Forward -274 -267 6.52896 0.154
NP_443027.1_4 Forward -61 -51 10.9931 0.109
NP_443027.1_4 Reverse -48 -58 7.05986 0.248
NP_439997.1_6 Forward -211 -192 8.84924 0.249
NP_442975.1_10 Reverse -46 -60 9.14375 0.0771
NP_440784.1_7 Reverse -51 -58 6.23397 0.241
NP_440784.1_7 Forward -58 -51 6.13563 0.241
NP_441054.1_4 Forward -69 -51 -0.275845 0.181
NP_442062.1_8 Reverse -50 -60 7.25653 0.104
NP_441900.1_2 Reverse -296 -314 -3.71814 0.288
NP_441859.1_3 Forward -60 -41 8.35677 0.139
NP_441859.1_3 Forward -72 -53 4.22689 0.228
NP_442242.1_4 Forward -58 -51 12.4288 0.0393
NP_442242.1_4 Forward -340 -333 9.57722 0.227
NP_440044.1_8 Forward -58 -39 -1.27885 0.241
NP_439902.1_4 Reverse -93 -112 17.8957 0.294
NP_441352.1_2 Reverse -43 -62 1.57275 0.247
NP_441200.1_4 Reverse -132 -151 13.3725 0.156
NP_441208.1_9 Forward -40 -26 5.60446 0.267
NP_442276.1_2 Forward -390 -371 2.45773 0.299
NP_440014.1_3 Reverse -98 -112 21.4412 0.00748
NP_440856.1_4 Reverse -43 -62 -5.60541 0.294
NP_440856.1_7 Forward -353 -334 -7.17871 0.249
NP_442827.1_8 Forward -67 -48 5.2102 0.123
NP_441434.1_7 Reverse -52 -66 1.96621 0.288
NP_441738.1_2 Reverse -52 -59 15.28 0.0102
NP_441558.1_5 Reverse -48 -67 5.01433 0.265
NP_440209.1_1 Forward -59 -51 14.8674 0.012
NP_442889.1_8 Reverse -352 -366 5.21053 0.235
NP_440447.1_5 Forward -141 -131 12.4681 0.291
NP_440447.1_5 Reverse -130 -140 11.4848 0.291
NP_441770.1_5 Reverse -42 -61 23.4022 0.0181
NP_441716.1_1 Forward -347 -333 4.22782 0.256
NP_442111.1_3 Reverse -208 -221 17.2503 0.144
NP_440906.1_5 Forward -58 -51 12.0355 0.0724
NP_440906.1_5 Reverse -51 -58 12.0355 0.0724
NP_440906.1_5 Forward -340 -333 9.47889 0.116
NP_440906.1_9 Reverse -348 -367 16.9115 0.149
NP_441130.1_10 Forward -61 -47 8.75105 0.133
NP_441486.1_1 Reverse -329 -343 -1.08205 0.167
NP_440944.1_2 Forward -71 -52 22.6156 0.00517
NP_441012.1_4 Reverse -379 -392 6.1158 0.286
NP_443018.1_3 Forward -58 -51 5.34899 0.212
NP_443018.1_3 Reverse -51 -58 5.34899 0.212
NP_440376.1_1 Reverse -50 -59 -0.000272808 0.285
NP_440376.1_1 Forward -59 -50 -0.0986038 0.285
NP_442687.1_7 Forward -60 -50 13.2547 0.0562
NP_442589.1_5 Reverse -201 -220 13.9625 0.265
NP_442485.1_3 Forward -103 -84 4.03102 0.192
NP_441846.1_10 Reverse -193 -212 -21.7317 0.256
NP_440642.1_10 Reverse -61 -75 1.86729 0.287
NP_442296.1_5 Forward -362 -343 1.37609 0.284
NP_441763.1_5 Forward -99 -80 -6.39206 0.274
NP_442658.1_1 Reverse -48 -58 11.6809 0.0768
NP_442658.1_1 Forward -61 -51 6.0761 0.238
NP_442782.1_2 Forward -358 -344 1.76955 0.281
NP_442782.1_2 Forward -59 -45 1.37622 0.281
NP_442782.1_2 Forward -71 -57 0.982901 0.282
NP_442205.1_9 Reverse -44 -60 -2.00642 0.266
NP_442205.1_9 Forward -65 -49 -2.20308 0.268
NP_440607.1_10 Reverse -237 -256 18.7798 0.285
NP_442937.1_5 Forward -120 -101 8.35759 0.225
NP_441958.1_5 Reverse -49 -59 1.74999 0.0765
NP_441958.1_5 Forward -60 -50 1.455 0.0956
NP_441127.1_1 Reverse -200 -214 8.94771 0.284
NP_439905.1_2 Reverse -57 -71 19.9608 0.159
NP_439905.1_3 Reverse -340 -359 12.4875 0.222
NP_439990.1_5 Forward -140 -127 6.80412 0.221
NP_440200.1_4 Forward -79 -60 20.8456 0.06
NP_443055.1_6 Reverse -92 -110 0.805058 0.239
NP_440388.1_7 Forward -323 -304 8.55425 0.129
NP_442002.1_9 Forward -60 -53 10.7572 0.185
NP_441646.1_1 Forward -161 -142 -0.688862 0.271
NP_442438.1_10 Forward -159 -145 3.34284 0.163
NP_442438.1_10 Forward -346 -332 0.491246 0.225
NP_442438.1_10 Reverse -147 -161 -0.590395 0.269
NP_442771.1_1 Reverse -48 -66 -0.7675 0.119
NP_440147.1_4 Forward -61 -48 0.707601 0.247
NP_440147.1_4 Forward -103 -90 0.412608 0.255
NP_441550.1_8 Forward -103 -93 5.48612 0.247
NP_441916.1_7 Reverse -50 -60 9.61647 0.0333
NP_441916.1_7 Forward -59 -49 7.05986 0.0779
NP_440465.1_4 Forward -60 -41 10.2259 0.269
NP_441041.1_7 Reverse -47 -59 13.5398 0.0485
NP_440016.1_7 Reverse -298 -317 18.289 0.25
NP_442396.1_5 Forward -63 -50 7.98409 0.169
NP_442004.1_6 Reverse -382 -396 9.43936 0.14
NP_441725.1_5 Reverse -51 -61 1.55333 0.133
NP_439966.1_7 Forward -61 -51 8.63269 0.132
NP_439966.1_9 Forward -61 -52 0.983037 0.253
NP_442941.1_3 Reverse -51 -61 1.74999 0.147
NP_442281.1_1 Reverse -45 -59 5.21053 0.166
NP_440498.1_1 Forward -68 -50 -2.0458 0.235
NP_441644.1_6 Forward -59 -49 5.28945 0.199
NP_442933.1_10 Forward -59 -50 13.9627 0.0192
NP_442933.1_10 Forward -341 -332 10.3245 0.0525
NP_442933.1_10 Reverse -50 -59 8.1612 0.0885
NP_440576.1_10 Reverse -342 -361 19.1731 0.174
NP_441751.2_8 Reverse -51 -65 -3.54032 0.15
NP_442554.1_8 Reverse -51 -61 4.10993 0.198
NP_441762.1_7 Reverse -49 -61 -4.9759 0.185
NP_441762.1_7 Forward -60 -48 -5.56589 0.217
NP_442142.1_4 Reverse -47 -60 7.59019 0.135
NP_442142.1_4 Reverse -329 -342 6.21356 0.17
NP_442292.1_1 Reverse -51 -60 -0.0986038 0.239
NP_443009.1_2 Forward -229 -210 3.44104 0.216
NP_443009.1_5 Reverse -49 -60 12.6445 0.0456
NP_443009.1_5 Reverse -144 -155 4.28642 0.254
NP_441715.1_4 Reverse -51 -61 6.56821 0.138
NP_441715.1_4 Reverse -333 -343 5.28991 0.216
NP_441448.1_1 Forward -143 -124 8.94757 0.198
NP_441448.1_1 Forward -303 -284 3.53937 0.296
NP_441198.1_8 Reverse -48 -58 10.3415 0.28
NP_441468.1_1 Reverse -51 -58 6.13563 0.209
NP_441468.1_1 Forward -58 -51 6.0373 0.223
NP_441020.2_6 Forward -254 -237 9.77361 0.162
NP_441673.1_1 Reverse -50 -59 1.37636 0.114
NP_441673.1_1 Forward -59 -50 1.1797 0.163
NP_442490.1_9 Forward -71 -52 15.2408 0.0517
NP_442490.1_9 Forward -353 -334 -5.70374 0.273
NP_441612.1_2 Reverse -322 -332 8.83972 0.21
NP_441612.1_2 Reverse -360 -370 6.70984 0.277
NP_441612.1_2 Forward -92 -82 6.61303 0.283
NP_442227.1_2 Forward -148 -129 -3.3438 0.29
NP_442808.1_1 Reverse -56 -66 4.10949 0.207
NP_442542.1_2 Reverse -220 -233 5.62415 0.257
NP_442113.1_10 Forward -154 -135 2.55606 0.169
NP_442050.1_5 Reverse -48 -58 6.96107 0.27
NP_440558.1_2 Reverse -59 -78 4.81767 0.148
NP_441878.1_6 Reverse -221 -231 -7.68978 0.255
NP_441036.1_8 Reverse -49 -59 13.8447 0.0353
NP_441557.1_5 Forward -59 -50 8.84951 0.0343
NP_441557.1_5 Reverse -50 -59 0.786375 0.106
NP_441557.1_9 Reverse -37 -51 18.1908 0.264
NP_442183.1_1 Reverse -50 -64 9.63603 0.0954
NP_442397.1_9 Reverse -50 -69 3.53937 0.264
NP_440979.1_3 Forward -153 -135 11.6222 0.234
NP_441574.1_1 Forward -71 -52 -0.983855 0.211
NP_441549.1_7 Reverse -316 -335 12.6833 0.251
NP_442888.1_6 Reverse -211 -230 3.34271 0.244
NP_441037.1_4 Reverse -220 -230 12.288 0.109
NP_441037.1_4 Forward -61 -51 5.95329 0.289
NP_442594.1_8 Reverse -191 -210 2.16274 0.295
NP_440690.1_5 Forward -367 -348 16.2241 0.206
NP_440136.1_2 Reverse -51 -58 6.23397 0.171
NP_440136.1_2 Forward -58 -51 6.13563 0.193
NP_442590.1_10 Reverse -50 -69 3.04771 0.297
NP_442998.1_5 Reverse -208 -218 9.51814 0.238
NP_442998.1_10 Reverse -52 -59 15.5754 0.0102
NP_440731.1_2 Forward -71 -52 3.83436 0.295
NP_440899.1_8 Reverse -300 -319 -11.3086 0.299
NP_440299.1_1 Forward -63 -50 7.09854 0.121
NP_440299.1_1 Forward -345 -332 3.16532 0.256
NP_441799.1_1 Reverse -46 -60 3.53891 0.295
NP_441007.1_10 Forward -64 -51 1.10092 0.209
NP_441007.1_10 Reverse -217 -230 -0.37404 0.277
NP_442334.1_2 Forward -111 -94 -6.54933 0.263
NP_442961.1_4 Forward -217 -198 3.6377 0.288
NP_440087.1_1 Reverse -136 -155 -5.40875 0.249
NP_440915.1_6 Forward -163 -149 0.294584 0.17
NP_440702.1_2 Forward -337 -318 -1.86883 0.257
NP_441494.1_6 Forward -297 -284 6.60746 0.28
NP_442993.1_1 Forward -59 -43 -0.236458 0.071
NP_442993.1_1 Reverse -50 -66 -1.41643 0.0906
NP_442386.1_9 Forward -60 -51 5.89917 0.233
NP_441340.1_5 Forward -58 -51 6.13563 0.175
NP_441340.1_5 Reverse -51 -58 5.93897 0.198
NP_440059.1_2 Forward -220 -201 8.16011 0.221
NP_441254.1_3 Reverse -200 -219 13.2741 0.174
NP_442950.1_1 Reverse -203 -222 -6.09707 0.3
NP_440586.1_8 Forward -58 -51 11.4451 0.0645
NP_442251.1_6 Reverse -51 -58 12.0355 0.0627
NP_442251.1_6 Reverse -333 -340 10.4622 0.12
NP_440684.1_9 Forward -65 -51 15.1426 0.0988
NP_441262.1_3 Forward -59 -52 14.7888 0.0223
NP_440027.1_8 Forward -362 -343 6.48849 0.27
NP_443051.1_1 Forward -60 -51 0.786375 0.125
NP_443051.1_1 Reverse -49 -58 0.491382 0.151
NP_439937.1_9 Reverse -281 -298 -13.3348 0.285
NP_440408.1_7 Forward -72 -53 7.96426 0.284
NP_440439.1_1 Reverse -142 -155 3.06754 0.121
NP_440439.1_1 Forward -62 -49 -0.865694 0.241
NP_440439.1_1 Reverse -379 -392 -1.45568 0.269
NP_440439.1_1 Reverse -147 -160 -2.04567 0.293
NP_439943.1_1 Forward -65 -46 -11.3086 0.29
NP_440372.1_2 Forward -58 -51 6.72562 0.0929
NP_440372.1_2 Reverse -51 -58 6.62729 0.151
NP_440770.1_3 Forward -135 -121 15.5359 0.245
NP_440139.1_1 Reverse -326 -345 6.1935 0.143
NP_440139.1_1 Forward -237 -218 2.55527 0.229
NP_442384.1_10 Reverse -50 -63 10.2457 0.0465
NP_442114.1_4 Reverse -50 -61 7.1385 0.295
NP_441604.1_9 Reverse -87 -106 13.2741 0.254
NP_442790.1_4 Forward -68 -49 -12.1936 0.242
NP_440163.1_10 Forward -62 -52 14.238 0.102
NP_440531.1_6 Reverse -90 -109 0.884433 0.185
NP_440531.1_6 Forward -200 -181 -2.95047 0.26
NP_440189.1_2 Reverse -42 -61 7.96426 0.25
NP_441965.1_10 Forward -394 -378 5.76173 0.197
NP_440297.1_9 Reverse -51 -61 -0.41329 0.283
NP_442280.1_10 Forward -32 -14 6.03883 0.28
NP_440700.1_8 Forward -107 -93 11.701 0.28
NP_440888.1_2 Forward -202 -188 5.60385 0.272
NP_441543.1_2 Reverse -51 -60 8.75118 0.0968
NP_441543.1_5 Forward -142 -123 -2.75381 0.287
NP_442845.1_2 Forward -397 -383 8.55439 0.193
NP_442845.1_2 Reverse -44 -58 4.62115 0.256
NP_441319.1_8 Reverse -103 -121 8.37728 0.233
NP_441469.1_8 Forward -60 -51 6.29291 0.227
NP_442578.1_7 Forward -58 -51 5.93897 0.183
NP_441462.1_2 Forward -59 -49 9.81313 0.0143
NP_441929.1_6 Reverse -15 -34 5.01433 0.294
NP_443062.1_1 Forward -59 -41 7.96088 0.163
NP_443062.1_6 Reverse -214 -233 4.916 0.213
NP_441410.1_4 Forward -373 -354 7.66846 0.297
NP_440516.1_8 Forward -59 -50 8.1612 0.0417
NP_442428.1_5 Reverse -51 -58 6.13563 0.209
NP_442428.1_5 Forward -58 -51 6.0373 0.212
NP_440673.1_3 Reverse -52 -59 12.4288 0.0426
NP_440673.1_3 Forward -9 -2 7.51227 0.252
NP_440718.1_2 Reverse -112 -131 13.1758 0.221
NP_440865.1_9 Reverse -44 -63 -8.94866 0.273
NP_440436.1_4 Reverse -51 -60 14.9456 0.0103
NP_440436.1_4 Forward -211 -202 6.39082 0.162
NP_440436.1_4 Forward -58 -49 4.7192 0.244
NP_440436.1_4 Reverse -333 -342 4.12922 0.288
NP_442864.1_4 Reverse -81 -99 16.3421 0.166
NP_442577.1_9 Reverse -352 -366 13.2736 0.222
NP_441719.1_4 Forward -58 -51 6.72562 0.093
NP_441719.1_4 Reverse -51 -58 6.62729 0.151
NP_441733.1_10 Reverse -47 -60 6.50913 0.184
NP_441004.1_1 Forward -71 -52 -15.2418 0.273
NP_442366.1_3 Forward -60 -42 11.3272 0.0376
NP_440864.1_9 Forward -290 -271 -5.21209 0.231
NP_441851.1_10 Forward -60 -50 7.45319 0.14
NP_442515.1_1 Forward -108 -94 -3.93365 0.298
NP_441982.1_6 Forward -310 -301 11.3395 0.288
NP_440463.1_8 Forward -151 -132 8.95209 0.252
NP_442689.1_8 Forward -131 -114 -4.09106 0.26
NP_440940.1_7 Reverse -322 -340 13.1947 0.0831
NP_440940.1_7 Reverse -99 -117 5.81991 0.225
NP_441349.1_10 Reverse -88 -107 -5.70374 0.21
NP_441349.1_10 Reverse -278 -297 -9.34199 0.289
NP_442843.1_1 Reverse -204 -223 -11.8003 0.293
NP_440474.1_8 Reverse -51 -65 8.16044 0.189
NP_440195.1_4 Forward -71 -52 12.4875 0.127
NP_442006.1_2 Reverse -132 -149 -7.23765 0.171
NP_442006.1_2 Reverse -193 -210 -16.9724 0.267
NP_440078.1_4 Forward -369 -350 11.4058 0.237
NP_441078.1_4 Reverse -50 -59 0.196389 0.205
NP_441078.1_4 Forward -59 -50 -0.000272808 0.205
NP_442443.1_1 Reverse -342 -361 5.211 0.157
NP_440526.1_3 Forward -230 -219 8.12131 0.126
NP_440526.1_3 Forward -58 -47 0.746521 0.271
NP_441432.1_8 Reverse -1 -10 5.21127 0.185
NP_442320.1_8 Reverse -44 -58 -2.65535 0.0926
NP_442320.1_8 Forward -65 -51 -3.147 0.11
NP_442797.1_6 Reverse -93 -112 9.58243 0.243
NP_442968.1_8 Forward -149 -130 19.5673 0.116
NP_441072.1_2 Reverse -39 -58 5.40766 0.296
NP_440713.1_4 Reverse -63 -82 1.86774 0.277
NP_440713.1_4 Reverse -132 -151 1.27776 0.289
NP_442489.1_7 Reverse -50 -59 0.884706 0.145
NP_442489.1_7 Forward -59 -50 0.491382 0.178
NP_440565.1_7 Reverse -40 -59 -2.0655 0.291
NP_440559.1_1 Reverse -51 -60 5.50626 0.14
NP_441659.2_8 Forward -59 -49 7.94484 0.052
NP_441659.2_8 Reverse -50 -60 0.176696 0.271
NP_442346.1_5 Reverse -221 -231 11.5831 0.0634
NP_442346.1_5 Forward -60 -50 7.15819 0.178
NP_442346.1_5 Reverse -49 -59 4.40493 0.29
NP_441856.1_3 Forward -92 -73 -2.75381 0.27
NP_440831.1_3 Reverse -344 -363 7.26084 0.26
NP_440010.1_4 Reverse -46 -65 4.12856 0.22
NP_441050.1_5 Reverse -218 -236 -0.275845 0.256
NP_441833.1_4 Reverse -51 -58 14.1004 0.0258
NP_441833.1_4 Forward -58 -51 6.13563 0.198
NP_441895.1_2 Reverse -188 -207 -26.9432 0.275
NP_442162.1_9 Reverse -51 -58 6.62729 0.142
NP_442162.1_9 Forward -58 -51 6.52896 0.178
NP_440671.1_4 Forward -347 -333 8.65272 0.193
NP_441915.1_4 Forward -212 -193 6.29183 0.293
NP_442140.1_3 Forward -58 -48 6.17489 0.184
NP_442723.1_1 Forward -218 -199 7.07848 0.276
NP_442021.1_3 Forward -65 -46 -6.78538 0.261
NP_441813.1_5 Forward -61 -51 7.35486 0.0762
NP_440590.1_4 Reverse -51 -64 -1.06236 0.21
NP_440590.1_4 Forward -91 -78 -2.53732 0.245
NP_440567.1_1 Reverse -51 -65 3.44117 0.143
NP_440567.1_1 Forward -58 -44 0.0979218 0.256
NP_440567.1_6 Reverse -51 -70 7.17762 0.228
NP_442497.1_10 Forward -58 -49 5.89959 0.109
NP_442497.1_10 Reverse -51 -60 0.688044 0.141
NP_440821.1_4 Forward -61 -51 9.22315 0.0334
NP_440927.1_9 Reverse -203 -222 11.7008 0.271
NP_441239.1_9 Forward -211 -199 8.00379 0.145
NP_441239.1_9 Reverse -48 -60 6.62715 0.182
NP_440706.1_1 Reverse -46 -65 -5.50708 0.278
NP_441892.1_1 Reverse -41 -58 -1.14113 0.198
NP_440833.1_6 Reverse -362 -376 12.2903 0.198
NP_441617.1_6 Forward -66 -47 -6.78538 0.288
NP_440546.1_4 Forward -59 -49 13.1486 0.0572
NP_440546.1_4 Reverse -222 -232 8.6886 0.176
NP_441230.1_5 Reverse -45 -64 6.78429 0.17
NP_440462.1_6 Reverse -48 -58 9.22315 0.049
NP_440462.1_6 Forward -61 -51 5.78156 0.138
NP_442565.1_4 Reverse -122 -141 -8.06369 0.257
NP_440868.1_4 Forward -63 -51 1.02229 0.193
NP_441848.1_7 Forward -222 -203 -0.787962 0.244
NP_441084.1_6 Reverse -48 -62 11.4772 0.201
NP_442696.1_6 Reverse -119 -138 -13.0786 0.261
NP_442837.1_3 Forward -390 -383 6.43063 0.212
NP_442837.1_3 Reverse -51 -58 6.13563 0.25
NP_442837.1_3 Forward -58 -51 5.93897 0.265
NP_440505.1_3 Forward -61 -51 12.5664 0.0482
NP_442360.1_2 Reverse -103 -116 18.2099 0.229
NP_440914.1_1 Reverse -109 -119 6.27291 0.288
NP_441011.1_8 Forward -58 -49 8.1612 0.147
NP_441011.1_8 Reverse -51 -60 7.17789 0.179
NP_441011.1_8 Forward -340 -331 5.70292 0.237
NP_442533.1_6 Forward -59 -50 5.3096 0.145
NP_442232.1_3 Reverse -42 -61 -12.4886 0.282
NP_441482.1_7 Forward -65 -51 -11.4068 0.262
NP_439944.1_9 Forward -58 -48 14.1397 0.0439
NP_440007.1_9 Forward -69 -55 0.687908 0.292
NP_441347.1_5 Reverse -376 -390 10.8154 0.269
NP_442492.1_2 Forward -59 -40 4.32602 0.213
NP_442716.1_5 Forward -208 -189 16.5802 0.222
NP_441602.1_3 Forward -64 -45 -1.7705 0.231
NP_441106.1_1 Reverse -49 -58 14.2577 0.0252
NP_441106.1_1 Forward -60 -51 8.35786 0.0585
NP_441106.1_1 Reverse -331 -340 4.22796 0.231
NP_441106.1_1 Reverse -144 -153 2.65466 0.269
NP_439903.1_6 Reverse -47 -66 11.0117 0.0958
NP_441286.1_1 Forward -60 -48 -6.64753 0.271
NP_440670.1_8 Reverse -50 -59 6.98123 0.0882
NP_439955.1_10 Reverse -96 -115 14.2566 0.258
NP_440886.1_7 Forward -60 -50 4.50281 0.232
NP_441753.1_10 Forward -356 -337 1.17943 0.274
NP_440907.2_8 Forward -58 -48 6.66608 0.157
NP_441021.1_1 Reverse -51 -70 -4.42544 0.17
NP_441021.1_1 Reverse -344 -363 -11.6036 0.27
NP_441463.1_3 Forward -96 -77 -9.83364 0.286
NP_441626.1_2 Forward -58 -51 6.0373 0.212
NP_441626.1_2 Reverse -51 -58 6.0373 0.212
NP_442365.1_5 Reverse -170 -189 6.4893 0.279
NP_442615.1_1 Reverse -41 -59 11.8189 0.0163
NP_442615.1_1 Forward -68 -50 -6.86402 0.266
NP_441962.1_4 Forward -106 -87 -14.4552 0.288
NP_440387.1_1 Reverse -50 -66 3.89344 0.0503
NP_441488.1_8 Reverse -171 -185 6.98048 0.283
NP_440814.1_4 Reverse -213 -232 -4.03212 0.16
NP_440467.1_3 Forward -70 -51 12.4282 0.24
NP_440114.1_10 Reverse -50 -64 10.1277 0.153
NP_440114.1_10 Forward -59 -45 9.04604 0.186
NP_440293.1_3 Forward -300 -281 -5.9004 0.285
NP_439988.1_3 Forward -390 -376 3.73617 0.298
NP_442743.1_1 Forward -212 -193 6.09517 0.268
NP_442743.1_4 Forward -117 -98 -8.06369 0.287
NP_442867.1_8 Forward -148 -129 22.7139 0.0275
NP_442867.1_8 Reverse -268 -287 3.83436 0.297
NP_441801.1_4 Reverse -128 -138 12.4681 0.201
NP_440142.1_7 Reverse -194 -213 20.944 0.0331
NP_441332.1_6 Reverse -387 -397 11.0659 0.277
NP_440473.1_1 Reverse -102 -121 13.6676 0.187
NP_442509.1_9 Reverse -50 -60 6.56775 0.263
NP_440554.1_4 Forward -58 -48 7.64985 0.101
NP_440554.1_4 Reverse -51 -61 5.09324 0.162
NP_441885.1_5 Forward -59 -49 0.57002 0.137
NP_442228.1_10 Forward -84 -65 11.5042 0.255
NP_440478.1_9 Reverse -65 -84 9.53756 0.255
NP_442395.2_4 Forward -359 -340 4.52188 0.182
NP_440275.1_3 Reverse -48 -58 7.25653 0.0823
NP_440091.1_1 Reverse -328 -340 17.5419 0.0147
NP_440091.1_1 Reverse -46 -58 11.2487 0.0429
NP_441397.1_8 Reverse -206 -219 15.9134 0.142
NP_439962.1_4 Forward -149 -130 -8.752 0.298
NP_440804.1_4 Reverse -211 -220 15.1427 0.267
NP_440149.1_8 Reverse -50 -69 -6.78538 0.261
NP_441105.1_3 Reverse -39 -58 1.37609 0.114
NP_441105.1_3 Forward -112 -93 -8.26035 0.269
NP_441105.1_3 Reverse -51 -70 -8.85033 0.279
NP_441105.1_3 Forward -352 -333 -9.14533 0.284
NP_441105.1_3 Forward -369 -350 -9.93197 0.298
NP_442373.1_2 Forward -398 -379 -11.4069 0.296
NP_440172.1_1 Forward -59 -49 10.0098 0.0572
NP_440172.1_1 Reverse -2 -12 4.0116 0.208
NP_440172.1_1 Forward -178 -168 3.91327 0.213
NP_441111.1_7 Reverse -51 -59 8.96754 0.0463
NP_441766.1_2 Forward -59 -50 8.06287 0.0691
NP_441766.1_9 Forward -211 -192 2.0644 0.246
NP_440416.1_1 Forward -59 -40 -7.37537 0.203
NP_440416.1_9 Forward -161 -142 -15.2418 0.187
NP_443052.1_8 Reverse -40 -59 -7.76869 0.164
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGCTGGGTAGGGGCTCCCTTGGACCTAGTGTAGTTTTGCTCGGGCAGTAGCAGGGCCACAGTGATCGTTGTTCTTCTTAGAGGGGGGAGCTACTGGAAAACAGGTCGGGAGCAGTGCTCCTACTCCGGGGAGGCTAGTAGATGCTGGAGGAGCTCTACTTTACGCATCGAACCATAGCCCCTAATTTTTGCCCTCCTCGCCCTTTGCTTGAGTTCTCTGATGGTCAATTGCTTTAAACAGAGGCTCTGCGCTCCTCTGCCTCCCTGGGGAGCTTTGCTTGAATGTGTTCGTTGGGCAGGAGCCATCAGTAGGATGACCACTGCTAGGTAGGCAAGGGTTACGGCGATCGTTTCTTCCAACATAGCTATTCTCCTCCTTGGTTATATAAAATTGATTGCCT

CDS

GTGTATATACATTTGAAGAGGGGGCTTACTTTCCCTTGCTTCGGTCACATTCGCGGTTCTGCACCAATGGCTAATTCTGACTTCACCCTTGCTACCTTTCGCATCCAAGCCTCTCAGTGGGATTCTTTTAAGCAGTGGGCTAAGGATAGGGGTAATTCTGCTAGCGGTGAGCTGCAACATTTCATTGCCCGGGTAGTGCAGGGCGATTATGTGGATCCCCCCGCACTGCCTGAGGGGTTAACTACCCGTGCTGAGCTTGATGAGACGGTAGCAGCGTTGGAGGAGCGTTTAATGGCTGAGATAAAGTCCCTGCAGGTGCGTTTAGATAGGCATCAGTTACCAGATGGGGCGGGGCAGTCCACGGCTTCGCCAAAGGAGGAAAAATTAACCACTACCGAGTTAGCGGAGCTTCTGAAACGGGCAGGGATATGGAAAAGTAAAAGGACTCTGCAGGAATATGCCCAGGAGAATCGTTATCCCGACGACTTACCGTGGAGGGCTCACAAGTCCGGTGGGAAGTGGTACTGGTCTGAACTTCCAGCTAAGGGAGGGGCAGGTCTCCTCAGCCCCTGA

Protein

No sequence available