Your browser is old and dusty. Try Google Chrome!

Details for slr7041

ORF slr7041
Accession NP_942329.1
Symbol
Category Other
Definition probable growth inhibitor, PemK-like protein
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -194 -180 -0.590395 0.234
NP_441343.1_5 Reverse -68 -87 10.7175 0.212
NP_441453.1_4 Reverse -6 -14 5.32929 0.147
NP_441453.1_7 Forward -100 -93 12.9205 0.23
NP_441453.1_8 Forward -400 -383 11.1502 0.217
NP_441623.1_1 Reverse -123 -141 -3.6191 0.262
NP_441818.1_9 Forward -38 -19 -7.76869 0.273
NP_442169.1_1 Forward -151 -132 6.58763 0.26
NP_442173.1_1 Reverse -7 -15 8.86921 0.0882
NP_442752.1_4 Forward -15 -8 4.46401 0.269
NP_442975.1_10 Reverse -236 -250 2.16228 0.283
NP_441250.1_3 Reverse -73 -92 2.0644 0.28
NP_442062.1_8 Forward -171 -161 8.33817 0.0769
NP_441995.1_4 Forward -366 -348 10.9331 0.282
NP_441995.1_6 Reverse -43 -62 16.3224 0.259
NP_440304.1_4 Forward -17 -7 6.27322 0.167
NP_439918.1_2 Forward -295 -276 -3.24547 0.251
NP_441200.1_4 Forward -188 -169 12.3892 0.172
NP_441208.1_9 Reverse -3 -17 12.1926 0.141
NP_441208.1_9 Forward -385 -371 5.60446 0.267
NP_442196.1_10 Forward -141 -122 9.73422 0.28
NP_441083.1_5 Forward -15 -5 7.25653 0.0608
NP_441083.1_5 Reverse -6 -16 0.57002 0.223
NP_442765.1_4 Forward -217 -198 14.5524 0.244
NP_440178.1_7 Forward -201 -182 -22.8133 0.279
NP_440053.1_2 Forward -33 -14 10.2259 0.291
NP_442111.1_4 Reverse -5 -19 6.58777 0.12
NP_440343.1_3 Reverse -281 -299 9.35981 0.184
NP_440747.1_10 Reverse -3 -15 -3.99259 0.0763
NP_442848.1_5 Reverse -237 -255 -3.22577 0.29
NP_440376.1_1 Forward -15 -6 13.4711 0.016
NP_440376.1_1 Reverse -6 -15 0.491382 0.273
NP_442730.1_8 Forward -191 -172 6.48849 0.228
NP_442687.1_7 Forward -16 -6 4.50326 0.245
NP_440609.1_6 Reverse -381 -400 15.5357 0.286
NP_440642.1_10 Reverse -236 -250 2.35894 0.277
NP_441682.1_6 Forward -41 -22 12.1925 0.291
NP_442782.1_2 Forward -182 -168 1.47456 0.281
NP_440607.1_8 Forward -155 -136 4.22769 0.209
NP_441317.1_4 Reverse -329 -343 9.84592 0.29
NP_441958.1_5 Forward -16 -6 9.41981 0.0219
NP_441958.1_5 Reverse -5 -15 1.25834 0.108
NP_441097.1_2 Forward -157 -140 4.6604 0.278
NP_443055.1_6 Forward -62 -44 3.26332 0.199
NP_442853.1_6 Reverse -165 -184 21.8214 0.053
NP_441646.1_1 Forward -207 -188 0.294447 0.252
NP_440147.1_4 Forward -185 -172 9.2624 0.0423
NP_440147.1_4 Reverse -4 -17 2.77255 0.202
NP_441550.1_8 Reverse -4 -14 7.35439 0.164
NP_441550.1_8 Forward -17 -7 6.66608 0.198
NP_441550.1_8 Forward -185 -175 5.09279 0.267
NP_441916.1_7 Forward -15 -5 5.68323 0.124
NP_441041.1_4 Reverse -174 -193 3.04771 0.0679
NP_441041.1_4 Forward -159 -140 -12.8819 0.276
NP_441041.1_7 Reverse -3 -15 6.05711 0.226
NP_441041.1_7 Reverse -50 -62 5.95994 0.231
NP_440016.1_9 Reverse -138 -157 10.7175 0.259
NP_439966.1_7 Reverse -285 -295 5.68278 0.214
NP_441514.1_6 Reverse -96 -103 14.2971 0.248
NP_442281.1_1 Reverse -169 -183 2.75226 0.257
NP_442281.1_1 Reverse -1 -15 1.86729 0.285
NP_441087.1_6 Reverse -121 -139 0.608397 0.258
NP_441644.1_1 Forward -159 -140 12.8808 0.15
NP_441644.1_6 Reverse -6 -16 16.1058 0.0048
NP_441644.1_6 Reverse -174 -184 3.22451 0.293
NP_442215.1_2 Forward -17 -1 -5.64466 0.254
NP_442029.1_6 Forward -188 -169 14.6508 0.108
NP_442029.1_10 Forward -186 -167 10.0292 0.211
NP_440929.1_8 Reverse -6 -15 7.47288 0.0713
NP_440929.1_8 Forward -195 -186 0.786375 0.299
NP_440929.1_9 Reverse -2 -16 12.9793 0.279
NP_442933.1_2 Reverse -261 -279 7.06839 0.268
NP_441751.2_8 Reverse -7 -21 -2.65535 0.133
NP_442554.1_8 Forward -14 -4 2.33998 0.274
NP_442301.1_2 Reverse -120 -139 5.89851 0.263
NP_441715.1_5 Reverse -244 -254 18.3674 0.219
NP_441198.1_5 Reverse -8 -21 11.9167 0.245
NP_441020.2_6 Forward -134 -117 8.20031 0.205
NP_441015.1_10 Reverse -175 -194 -8.94866 0.278
NP_441015.1_10 Forward -26 -7 -11.5053 0.298
NP_441673.1_1 Forward -15 -6 1.57302 0.0764
NP_441673.1_1 Reverse -6 -15 1.57302 0.0764
NP_442719.1_2 Forward -81 -63 2.77167 0.162
NP_442808.1_1 Reverse -137 -147 2.5362 0.263
NP_440871.1_2 Forward -228 -209 11.7992 0.289
NP_440145.1_3 Forward -25 -6 -1.08219 0.146
NP_440630.1_3 Forward -141 -122 1.76941 0.287
NP_440162.1_2 Reverse -215 -234 12.1925 0.249
NP_441878.1_6 Reverse -5 -15 1.55333 0.0937
NP_441557.1_2 Forward -59 -41 16.2438 0.253
NP_441557.1_5 Forward -15 -6 0.688044 0.128
NP_441557.1_5 Reverse -6 -15 0.688044 0.128
NP_440101.1_3 Reverse -80 -99 2.16274 0.259
NP_442183.1_1 Forward -24 -10 4.62115 0.254
NP_442183.1_9 Forward -175 -165 9.41981 0.296
NP_440440.1_2 Reverse -121 -140 13.2733 0.282
NP_441549.1_1 Forward -104 -85 13.8633 0.281
NP_442347.1_2 Reverse -282 -291 3.7363 0.284
NP_442347.1_2 Reverse -175 -184 2.85133 0.299
NP_441633.1_3 Reverse -236 -249 -5.58558 0.236
NP_441633.1_3 Reverse -83 -96 -5.78224 0.236
NP_442590.1_10 Reverse -174 -193 10.5209 0.181
NP_442998.1_10 Reverse -8 -15 6.13563 0.181
NP_440299.1_1 Forward -80 -67 3.65697 0.237
NP_440299.1_1 Forward -187 -174 2.08368 0.299
NP_441799.1_1 Reverse -31 -45 6.98048 0.155
NP_440256.1_1 Forward -186 -167 -6.88371 0.223
NP_440087.1_1 Forward -24 -5 -2.0655 0.197
NP_441559.1_8 Reverse -92 -106 -7.76856 0.299
NP_440915.1_6 Forward -19 -5 8.55439 0.0533
NP_441296.1_7 Forward -105 -86 13.9625 0.267
NP_440733.1_2 Forward -343 -325 11.079 0.293
NP_440717.1_3 Forward -194 -180 8.94708 0.25
NP_440134.1_2 Reverse -363 -382 9.63589 0.227
NP_442866.1_1 Forward -20 -1 -5.31042 0.24
NP_440748.1_5 Forward -187 -168 -0.0988766 0.253
NP_440748.1_5 Forward -198 -179 -0.4922 0.26
NP_440748.1_5 Reverse -165 -184 -3.54046 0.298
NP_441199.1_6 Reverse -2 -21 11.1109 0.0685
NP_442993.1_1 Reverse -97 -113 -9.47957 0.186
NP_441340.1_5 Forward -14 -7 3.97235 0.274
NP_442484.1_2 Forward -194 -175 4.32602 0.187
NP_440327.1_6 Forward -183 -164 2.55606 0.294
NP_439976.1_4 Forward -66 -47 7.4718 0.278
NP_440586.1_1 Forward -157 -138 -3.83545 0.273
NP_441262.1_3 Forward -15 -8 5.25066 0.215
NP_443051.1_1 Forward -16 -7 7.07956 0.0616
NP_443051.1_1 Reverse -5 -14 -1.18024 0.297
NP_439937.1_9 Forward -358 -341 -11.4665 0.256
NP_443039.1_3 Forward -382 -363 5.11266 0.286
NP_440408.1_7 Reverse -367 -386 8.35759 0.281
NP_440408.1_7 Reverse -180 -199 8.35759 0.281
NP_440439.1_1 Forward -18 -5 1.00259 0.164
NP_439943.1_4 Reverse -174 -193 8.55425 0.256
NP_440372.1_2 Forward -14 -7 4.26735 0.221
NP_440171.1_3 Forward -234 -215 1.96607 0.29
NP_441789.1_7 Reverse -116 -135 -3.04956 0.268
NP_442887.1_5 Forward -197 -178 -3.54046 0.264
NP_442384.1_10 Reverse -174 -187 11.9173 0.0319
NP_441980.1_9 Forward -22 -3 14.2574 0.298
NP_441631.1_4 Reverse -181 -200 14.7491 0.17
NP_442790.1_4 Forward -24 -5 -15.5368 0.294
NP_440531.1_8 Forward -141 -122 1.67108 0.298
NP_442693.1_6 Forward -189 -170 4.42435 0.278
NP_442280.1_10 Forward -193 -175 17.0451 0.0964
NP_441896.1_3 Forward -148 -129 6.78429 0.1
NP_441103.1_9 Reverse -119 -129 12.7825 0.284
NP_442553.1_4 Forward -232 -213 11.9958 0.179
NP_440834.1_2 Forward -110 -91 11.2084 0.275
NP_440888.1_2 Forward -106 -92 7.57046 0.19
NP_440888.1_2 Reverse -6 -20 5.99717 0.254
NP_442807.1_10 Forward -152 -138 14.4542 0.224
NP_441917.1_2 Reverse -177 -195 4.54237 0.288
NP_442845.1_2 Forward -21 -7 4.62115 0.256
NP_440710.1_1 Forward -23 -5 -8.92897 0.287
NP_441462.1_2 Forward -15 -5 16.893 0.00406
NP_441462.1_2 Reverse -6 -16 0.963343 0.109
NP_441621.1_7 Forward -220 -206 -6.49025 0.295
NP_443062.1_1 Reverse -174 -192 5.91323 0.215
NP_440939.1_5 Forward -150 -134 10.5799 0.273
NP_440349.1_3 Reverse -145 -164 9.53674 0.299
NP_440519.1_3 Forward -105 -86 12.5858 0.167
NP_440519.1_8 Forward -153 -137 4.48343 0.223
NP_442204.1_1 Reverse -170 -181 1.04198 0.281
NP_440516.1_8 Forward -15 -6 7.37455 0.0648
NP_440516.1_8 Reverse -6 -15 5.40793 0.114
NP_441867.1_2 Reverse -43 -62 -17.5035 0.291
NP_440673.1_3 Reverse -8 -15 9.67555 0.179
NP_440314.1_9 Reverse -7 -26 1.76941 0.0872
NP_441719.1_6 Reverse -119 -138 7.07848 0.269
NP_441004.1_1 Forward -144 -125 -13.4719 0.257
NP_441004.1_1 Forward -165 -146 -15.2418 0.273
NP_441004.1_1 Forward -99 -80 -17.1101 0.289
NP_441004.1_3 Forward -156 -137 3.24438 0.262
NP_441004.1_4 Forward -249 -239 7.84651 0.286
NP_441004.1_5 Forward -97 -83 12.1926 0.24
NP_442813.1_4 Forward -102 -83 0.58944 0.197
NP_442813.1_4 Reverse -215 -234 -5.11376 0.299
NP_442366.1_5 Forward -186 -176 10.5993 0.251
NP_440296.1_6 Forward -334 -316 10.8881 0.295
NP_441683.1_7 Reverse -52 -71 -11.9969 0.284
NP_441046.1_2 Reverse -62 -81 1.76941 0.255
NP_442843.1_1 Reverse -45 -64 -4.81876 0.239
NP_440474.1_8 Reverse -7 -21 4.71887 0.268
NP_441477.1_10 Forward -130 -112 3.75572 0.211
NP_440588.1_3 Forward -327 -308 9.0459 0.291
NP_442006.1_2 Reverse -91 -108 -17.7591 0.282
NP_441078.1_4 Reverse -6 -15 0.393051 0.205
NP_441078.1_4 Forward -15 -6 0.393051 0.205
NP_442729.1_5 Reverse -179 -189 14.6313 0.214
NP_440707.1_9 Forward -155 -136 6.09597 0.235
NP_442443.1_1 Forward -155 -136 -4.22878 0.268
NP_441432.1_8 Forward -16 -7 4.52295 0.206
NP_441432.1_8 Forward -184 -175 3.14632 0.259
NP_441432.1_9 Reverse -213 -226 12.9614 0.189
NP_441432.1_9 Forward -79 -66 10.3436 0.252
NP_441732.1_2 Reverse -2 -18 -16.9527 0.223
NP_442003.1_4 Reverse -175 -194 11.2092 0.278
NP_441057.1_4 Forward -63 -45 -1.25915 0.272
NP_440281.1_8 Reverse -37 -56 11.6025 0.196
NP_440713.1_4 Reverse -176 -195 4.62101 0.226
NP_442489.1_7 Reverse -6 -15 1.08137 0.109
NP_442489.1_7 Forward -15 -6 0.884706 0.145
NP_440559.1_1 Forward -14 -5 5.01461 0.161
NP_441659.2_8 Reverse -6 -16 8.33817 0.0443
NP_441659.2_8 Forward -15 -5 6.8632 0.0663
NP_441800.1_10 Forward -94 -75 3.6377 0.252
NP_440545.1_3 Forward -19 -2 -1.0428 0.162
NP_440545.1_3 Forward -222 -205 -2.3211 0.183
NP_440545.1_3 Reverse -2 -19 -4.77938 0.232
NP_440831.1_3 Forward -141 -122 6.29006 0.275
NP_441629.1_3 Reverse -137 -156 2.16195 0.218
NP_440486.1_6 Reverse -185 -204 6.09597 0.283
NP_441126.1_8 Forward -252 -239 12.409 0.291
NP_442934.1_8 Forward -29 -10 7.27595 0.266
NP_440459.1_2 Reverse -36 -53 8.10198 0.27
NP_440847.1_3 Reverse -140 -154 11.602 0.261
NP_442603.1_7 Forward -15 -1 5.89884 0.269
NP_442828.1_7 Forward -142 -123 -4.6221 0.276
NP_441358.1_4 Reverse -300 -319 21.0414 0.0652
NP_441895.1_2 Forward -235 -216 -17.6018 0.234
NP_441895.1_2 Forward -188 -169 -26.7466 0.247
NP_441895.1_10 Forward -145 -126 -27.7299 0.29
NP_442162.1_9 Reverse -7 -14 3.4807 0.246
NP_442162.1_9 Forward -14 -7 3.38237 0.276
NP_440671.1_4 Forward -159 -145 6.98109 0.23
NP_441341.1_6 Forward -392 -373 8.84924 0.253
NP_440590.1_4 Forward -14 -1 -5.38892 0.277
NP_442497.1_10 Forward -14 -5 0.589713 0.153
NP_440227.1_2 Forward -271 -255 11.9566 0.271
NP_441239.1_9 Reverse -83 -95 4.36554 0.253
NP_441951.1_9 Reverse -7 -26 4.62101 0.254
NP_440604.1_6 Forward -153 -134 -2.0655 0.214
NP_442193.1_1 Forward -311 -293 7.88563 0.28
NP_442270.1_6 Forward -157 -139 15.1621 0.279
NP_441698.1_3 Reverse -160 -174 17.0102 0.288
NP_442643.1_3 Forward -188 -169 -6.78538 0.262
NP_442216.1_4 Reverse -212 -220 8.08217 0.255
NP_440546.1_4 Forward -393 -383 8.39772 0.192
NP_440401.1_9 Reverse -166 -173 12.6251 0.287
NP_441474.1_1 Reverse -164 -183 4.03023 0.221
NP_442402.1_4 Forward -360 -341 -1.8696 0.194
NP_442402.1_4 Reverse -272 -291 -2.16459 0.195
NP_442402.1_4 Reverse -214 -233 -6.98278 0.268
NP_442402.1_10 Reverse -18 -28 14.5325 0.18
NP_440653.1_10 Forward -322 -303 5.99764 0.218
NP_442679.1_1 Forward -233 -214 -2.36049 0.24
NP_442053.1_1 Reverse -6 -15 7.27622 0.103
NP_440505.1_3 Forward -17 -7 4.3066 0.3
NP_442533.1_1 Forward -305 -286 -9.83364 0.229
NP_442533.1_1 Forward -156 -137 -11.8986 0.236
NP_442533.1_1 Forward -32 -13 -16.9135 0.277
NP_442533.1_6 Reverse -6 -15 11.6028 0.0409
NP_442533.1_6 Forward -183 -174 3.14632 0.224
NP_441028.1_6 Forward -362 -352 3.51951 0.292
NP_440116.1_5 Reverse -3 -20 6.43035 0.167
NP_440115.1_6 Forward -18 -8 5.09324 0.271
NP_441972.1_3 Forward -150 -131 16.5191 0.146
NP_441972.1_5 Reverse -86 -105 -2.16383 0.178
NP_441106.1_1 Forward -16 -7 5.99792 0.111
NP_442588.1_1 Forward -156 -137 6.88262 0.259
NP_442588.1_2 Reverse -120 -139 21.3373 0.0542
NP_440670.1_8 Forward -15 -6 8.55452 0.066
NP_440670.1_8 Reverse -6 -15 6.39124 0.121
NP_442614.1_2 Forward -15 -1 7.66941 0.268
NP_442072.1_9 Reverse -5 -23 -12.0756 0.0812
NP_442072.1_9 Forward -219 -201 -15.6155 0.184
NP_441427.1_5 Forward -62 -43 11.9958 0.275
NP_440028.1_6 Forward -158 -140 14.2771 0.218
NP_440907.2_8 Reverse -7 -17 7.94438 0.117
NP_439967.1_1 Reverse -85 -103 11.7205 0.236
NP_440962.1_6 Forward -287 -270 13.5094 0.252
NP_442893.1_3 Forward -356 -337 17.8948 0.12
NP_441626.1_2 Forward -14 -7 9.08556 0.1
NP_442365.1_7 Reverse -2 -21 -2.65548 0.202
NP_441962.1_9 Reverse -168 -187 12.4875 0.191
NP_440387.1_1 Reverse -6 -22 15.0048 0.00592
NP_441431.1_2 Forward -193 -179 10.3237 0.162
NP_441488.1_8 Forward -188 -174 10.9137 0.146
NP_441206.1_4 Reverse -297 -316 8.84924 0.0296
NP_441510.2_7 Reverse -174 -188 11.7987 0.28
NP_440457.1_1 Forward -19 -7 0.727295 0.25
NP_440554.1_4 Reverse -7 -17 3.02829 0.244
NP_441885.1_5 Forward -15 -5 -0.41329 0.197
NP_441173.1_9 Reverse -135 -143 11.0321 0.228
NP_440119.1_1 Reverse -141 -157 9.20332 0.14
NP_442395.2_4 Reverse -168 -187 5.50519 0.161
NP_440191.1_4 Reverse -214 -224 14.6025 0.266
NP_440423.1_6 Reverse -45 -64 -15.6352 0.229
NP_440275.1_3 Forward -17 -7 15.123 0.0182
NP_441307.1_4 Forward -309 -290 6.68596 0.177
NP_441662.1_3 Reverse -321 -340 8.52366 0.264
NP_440679.1_10 Forward -51 -32 -5.21209 0.161
NP_442373.1_2 Forward -156 -137 -1.7705 0.198
NP_440216.1_1 Reverse -6 -20 -5.40861 0.129
NP_440172.1_1 Reverse -6 -16 5.19158 0.149
NP_442015.1_10 Reverse -2 -15 8.77074 0.0605
NP_442015.1_10 Reverse -93 -106 3.26421 0.184
NP_442015.1_10 Reverse -170 -183 -1.16069 0.297
NP_441226.1_7 Reverse -7 -14 8.88855 0.165
NP_440198.1_2 Reverse -83 -102 14.2289 0.281
NP_441111.1_7 Forward -14 -6 -0.570565 0.233
NP_441111.1_7 Reverse -7 -15 -0.570565 0.233
NP_442379.1_10 Forward -22 -5 1.02215 0.223
NP_441766.1_2 Reverse -6 -15 10.7178 0.0222
NP_440416.1_9 Forward -190 -171 -4.03212 0.076
NP_440416.1_9 Forward -101 -82 -10.4236 0.141
NP_443052.1_9 Reverse -125 -144 -4.52377 0.258
NP_443052.1_9 Reverse -137 -156 -5.11376 0.265
NP_442154.1_1 Forward -155 -137 4.05072 0.0591
NP_441579.1_8 Reverse -169 -188 22.8114 0.0308
NP_440261.1_5 Forward -14 -1 -12.3704 0.284
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AACCAACGGGCATAGGTTTCTGTTTGCCGGATTTCAATCATCCCCCTATTGTATCCCAAAAGATACAAATTGCTTAATGTATTTGAAGCGGGCATTAATCTGAGGGGGCTTGGGATTAGAATTGAGTAATTATATTTTGTATAACTCAGGAGGGGCTAATGGAAGTCCGGCTCAAAAAGTGGGGAAATAGCATCGGGTTACGCATTCCGCACCCCTTGGCCATCAGTTGGGGGTTTGATGAATCAACGGTGGTGGATTTGGTGGAAACGGAGCAGGGGCTGATGATTCGTAAACGGTCTTCCCCTGGGTCATTGGAGGCACTTTTGACATCTATTCCTGCCGATTTTACCTATCCCGGTGATGTGTCCGATTTTGTGGAGAGTGAGGCGACCGGCCAGGA

CDS

ATGGTTATGACCTCAACCGTCCCGCAATATCCTGAACGGGGGGCGGTAATTCGCTTAAACCTCAATCCCACCCAGGGGCGAGAACAAATGGGAGAGGCGCGGCCATGTCTGGTTTTGAGCCATACTGCCTTTAATAAGGCCCGCAATGGCTTGATCATTGTTTCCCCAATTACGAATACCATTAAGCCAGAAATTCAGACGTTGGTTGTCCTTCCTGATGGTTATCGGGTACAAGGATCGGTTATTGCTGAGCAAATCCGCACTGTGGATTTAAGTTTGCGTTGGTGGCGGGATACGGGAGAAGTCCTTCCCCCTAGTTTTGTGGATCAGGTCTTGGCGGTTCTCCAGCTAATTATTGGATGA

Protein

No sequence available