Your browser is old and dusty. Try Google Chrome!

Details for slr7037

ORF slr7037
Accession NP_942325.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -343 -329 0.786239 0.199
NP_441061.1_2 Forward -349 -335 0.589577 0.205
NP_441418.1_6 Reverse -326 -345 -19.8634 0.0979
NP_441418.1_6 Forward -344 -325 -22.125 0.169
NP_441453.1_1 Forward -342 -324 2.28001 0.299
NP_441453.1_4 Reverse -230 -238 14.8674 0.00947
NP_441453.1_4 Forward -239 -231 6.80426 0.121
NP_441960.1_3 Reverse -196 -215 12.9369 0.291
NP_441818.1_1 Reverse -231 -242 13.5295 0.0731
NP_441818.1_9 Reverse -309 -328 -9.93197 0.291
NP_440226.1_1 Reverse -335 -354 8.75091 0.0823
NP_441630.1_3 Forward -247 -228 -0.0988766 0.285
NP_442173.1_1 Forward -238 -230 13.8841 0.0225
NP_442173.1_1 Reverse -231 -239 12.0158 0.0316
NP_442752.1_4 Forward -239 -232 13.8055 0.0199
NP_442752.1_4 Reverse -335 -342 10.8555 0.0846
NP_442752.1_4 Reverse -247 -254 7.90559 0.144
NP_442752.1_4 Reverse -326 -333 4.26735 0.293
NP_441745.1_3 Forward -341 -322 14.4533 0.253
NP_442975.1_10 Reverse -226 -240 2.45727 0.274
NP_440784.1_7 Forward -238 -231 6.23397 0.241
NP_440784.1_7 Reverse -231 -238 6.13563 0.241
NP_442062.1_8 Forward -239 -229 9.7148 0.0559
NP_442062.1_8 Reverse -230 -240 5.38824 0.172
NP_441859.1_3 Reverse -325 -344 5.11187 0.206
NP_440304.1_4 Forward -241 -231 9.22315 0.06
NP_440304.1_4 Reverse -333 -343 7.55152 0.109
NP_440908.1_8 Forward -341 -322 19.9598 0.132
NP_441208.1_9 Reverse -193 -207 6.58777 0.241
NP_442196.1_10 Forward -29 -10 11.2092 0.225
NP_440370.1_10 Reverse -326 -345 6.78429 0.283
NP_442742.1_9 Forward -75 -56 -11.8003 0.269
NP_440518.1_3 Forward -313 -294 12.585 0.196
NP_442110.1_7 Reverse -230 -244 3.24451 0.213
NP_441925.1_4 Forward -337 -318 -10.916 0.243
NP_441925.1_4 Forward -334 -315 -17.1108 0.288
NP_441083.1_5 Reverse -230 -240 8.82982 0.03
NP_441083.1_5 Forward -335 -325 -0.806614 0.28
NP_441083.1_5 Forward -239 -229 -1.00328 0.289
NP_441083.1_5 Forward -344 -334 -1.10161 0.295
NP_442827.1_8 Forward -247 -228 0.0970122 0.215
NP_441738.1_2 Reverse -232 -239 15.28 0.0102
NP_441558.1_5 Reverse -333 -352 4.22769 0.286
NP_440209.1_1 Forward -239 -231 8.57422 0.0425
NP_440209.1_1 Forward -344 -336 2.08437 0.286
NP_442136.1_4 Reverse -328 -347 21.2381 0.0628
NP_441713.1_1 Reverse -329 -348 -14.3569 0.259
NP_440178.1_7 Reverse -229 -248 -15.7335 0.163
NP_439953.1_2 Forward -114 -96 14.0805 0.197
NP_440906.1_5 Forward -238 -231 6.23397 0.234
NP_440906.1_5 Reverse -231 -238 6.13563 0.241
NP_441130.1_10 Forward -337 -323 6.3911 0.19
NP_441486.1_1 Reverse -227 -241 0.88457 0.124
NP_441486.1_1 Forward -242 -228 -4.81863 0.209
NP_440403.1_10 Reverse -326 -345 1.57275 0.288
NP_440057.1_8 Forward -208 -189 11.7008 0.298
NP_441014.1_8 Forward -252 -233 -2.45882 0.232
NP_442848.1_1 Forward -245 -231 -2.65535 0.263
NP_443018.1_3 Reverse -231 -238 11.7405 0.0655
NP_443018.1_3 Reverse -336 -343 11.5438 0.0752
NP_443018.1_3 Forward -238 -231 5.44732 0.193
NP_440376.1_1 Forward -239 -230 5.89959 0.116
NP_440376.1_1 Reverse -230 -239 -0.0986038 0.285
NP_440376.1_1 Forward -129 -120 -0.786921 0.293
NP_441857.1_5 Reverse -223 -241 8.57394 0.185
NP_442687.1_7 Forward -240 -230 15.3197 0.0173
NP_442485.1_3 Reverse -324 -343 16.6174 0.0539
NP_441846.1_10 Reverse -325 -344 -23.01 0.275
NP_440667.1_7 Forward -316 -297 17.0099 0.183
NP_441763.1_10 Forward -337 -318 4.91521 0.297
NP_442658.1_1 Reverse -228 -238 8.23937 0.199
NP_442658.1_1 Forward -241 -231 5.09279 0.284
NP_442782.1_2 Reverse -335 -349 0.0979218 0.296
NP_441414.1_9 Reverse -326 -345 -8.35868 0.234
NP_441414.1_9 Forward -335 -316 -8.752 0.245
NP_441958.1_1 Reverse -110 -129 13.6054 0.27
NP_441958.1_5 Forward -240 -230 16.9913 0.00183
NP_440203.1_5 Forward -341 -331 15.4175 0.0886
NP_442690.1_1 Reverse -55 -74 -16.8151 0.291
NP_440993.1_2 Reverse -225 -241 2.8118 0.262
NP_440993.1_3 Forward -345 -326 -0.197979 0.261
NP_440602.1_8 Reverse -230 -244 9.83269 0.298
NP_440615.1_2 Forward -190 -171 10.1275 0.155
NP_442002.1_1 Reverse -69 -87 -6.86402 0.249
NP_442002.1_1 Forward -248 -230 -9.81395 0.287
NP_442002.1_9 Forward -240 -233 14.1004 0.074
NP_442002.1_9 Reverse -325 -332 10.7572 0.185
NP_441294.1_7 Reverse -226 -240 8.86667 0.274
NP_441000.1_6 Forward -240 -226 4.22782 0.0964
NP_441000.1_6 Forward -336 -322 -5.80194 0.296
NP_441674.1_10 Forward -254 -236 -1.16082 0.29
NP_440147.1_4 Forward -241 -228 8.27909 0.0533
NP_441550.1_8 Forward -241 -231 14.1392 0.0182
NP_441550.1_8 Reverse -228 -238 4.69947 0.291
NP_441916.1_7 Reverse -230 -240 7.94484 0.0532
NP_441916.1_7 Forward -239 -229 6.66654 0.0875
NP_441916.1_10 Forward -312 -293 4.32602 0.223
NP_441041.1_1 Forward -32 -13 7.37428 0.267
NP_441041.1_4 Reverse -230 -249 -3.44213 0.122
NP_441041.1_7 Reverse -227 -239 8.97244 0.125
NP_441041.1_7 Forward -242 -230 6.34865 0.211
NP_440703.1_9 Forward -245 -232 11.3267 0.192
NP_441725.1_5 Reverse -231 -241 11.1898 0.0247
NP_441725.1_5 Forward -343 -333 8.63316 0.0621
NP_439966.1_7 Forward -346 -336 9.12434 0.119
NP_439966.1_7 Reverse -228 -238 8.23937 0.14
NP_439966.1_7 Forward -337 -327 7.35439 0.15
NP_439966.1_9 Reverse -324 -333 0.983037 0.253
NP_439966.1_9 Reverse -228 -237 0.884706 0.253
NP_442941.1_3 Reverse -231 -241 1.55333 0.15
NP_440289.1_2 Reverse -227 -240 3.75586 0.0741
NP_440289.1_2 Forward -242 -229 -3.12731 0.265
NP_441514.1_1 Forward -123 -113 14.1541 0.28
NP_442281.1_1 Reverse -225 -239 17.6985 0.00542
NP_442281.1_1 Forward -244 -230 6.78381 0.115
NP_442281.1_1 Reverse -330 -344 4.12889 0.206
NP_442847.1_3 Reverse -232 -251 6.98015 0.235
NP_440437.1_1 Forward -245 -226 2.16274 0.139
NP_441644.1_6 Reverse -230 -240 13.0576 0.0244
NP_441644.1_6 Reverse -335 -345 4.01116 0.253
NP_443049.1_6 Reverse -334 -344 17.0085 0.0973
NP_442215.1_2 Reverse -228 -244 4.77842 0.0823
NP_440253.1_2 Forward -239 -221 7.98396 0.064
NP_440253.1_2 Forward -335 -317 0.609134 0.181
NP_440929.1_8 Reverse -230 -239 7.17789 0.0713
NP_440780.1_1 Forward -396 -377 11.2199 0.243
NP_442933.1_10 Reverse -230 -239 8.06287 0.0885
NP_442933.1_10 Forward -239 -230 7.96454 0.0937
NP_440430.1_3 Forward -124 -106 13.1955 0.286
NP_441751.2_8 Forward -343 -329 11.996 0.0213
NP_442554.1_8 Reverse -231 -241 4.99491 0.163
NP_442554.1_8 Forward -238 -228 4.0116 0.2
NP_442554.1_8 Forward -343 -333 3.91327 0.203
NP_441762.1_7 Reverse -325 -337 4.16888 0.0533
NP_441762.1_7 Forward -240 -228 3.77555 0.0676
NP_441762.1_7 Forward -336 -324 -5.56589 0.217
NP_441762.1_7 Reverse -229 -241 -5.86088 0.246
NP_442142.1_4 Reverse -332 -345 7.19687 0.144
NP_442142.1_4 Forward -242 -229 5.23026 0.197
NP_442292.1_1 Reverse -231 -240 -0.295266 0.24
NP_440919.1_1 Forward -244 -225 -6.39206 0.258
NP_443009.1_5 Forward -240 -229 9.79292 0.0884
NP_441468.1_1 Forward -238 -231 6.13563 0.209
NP_441468.1_1 Reverse -231 -238 6.0373 0.223
NP_441468.1_1 Reverse -336 -343 4.07068 0.263
NP_441020.2_6 Reverse -324 -341 11.0519 0.13
NP_441020.2_6 Forward -241 -224 8.49531 0.197
NP_441020.2_6 Reverse -228 -245 6.33202 0.267
NP_441015.1_10 Reverse -324 -343 -0.787193 0.169
NP_441673.1_1 Forward -239 -230 1.27803 0.155
NP_441673.1_1 Reverse -230 -239 1.27803 0.155
NP_441826.1_2 Forward -245 -231 12.4876 0.0272
NP_441826.1_2 Reverse -230 -244 -2.36035 0.271
NP_442227.1_2 Forward -342 -323 4.71934 0.205
NP_442361.1_3 Forward -245 -232 7.98409 0.285
NP_442427.1_8 Forward -376 -357 4.916 0.288
NP_442808.1_1 Reverse -229 -239 10.501 0.0481
NP_442808.1_1 Forward -336 -326 9.81266 0.0481
NP_442808.1_1 Forward -345 -335 5.28945 0.162
NP_442808.1_1 Reverse -283 -293 2.04455 0.279
NP_440031.1_4 Forward -139 -120 14.3549 0.282
NP_442542.1_2 Reverse -228 -241 7.98409 0.167
NP_442113.1_10 Forward -351 -332 -6.29373 0.26
NP_442505.1_4 Forward -133 -114 14.2574 0.249
NP_442342.1_9 Reverse -228 -244 4.18844 0.251
NP_442789.1_4 Reverse -324 -343 1.17943 0.185
NP_442789.1_4 Forward -112 -93 -3.3438 0.25
NP_441878.1_6 Reverse -334 -344 1.74999 0.0642
NP_441878.1_6 Forward -240 -230 0.668351 0.139
NP_441036.1_8 Reverse -229 -239 8.1415 0.176
NP_441557.1_5 Forward -239 -230 8.94785 0.0289
NP_441557.1_5 Reverse -230 -239 0.688044 0.128
NP_441590.1_4 Forward -95 -76 2.35861 0.296
NP_441590.1_4 Reverse -2 -21 1.96529 0.299
NP_442267.1_4 Forward -184 -165 0.786102 0.285
NP_442777.1_1 Reverse -10 -29 4.91521 0.295
NP_440738.1_5 Reverse -102 -121 3.14605 0.27
NP_442183.1_1 Forward -239 -225 7.17775 0.147
NP_442183.1_1 Reverse -326 -340 6.58777 0.168
NP_440540.1_2 Reverse -314 -333 6.78429 0.271
NP_442347.1_2 Forward -334 -325 11.2095 0.056
NP_440151.1_2 Reverse -236 -254 17.8162 0.181
NP_441633.1_3 Forward -337 -324 -6.17557 0.238
NP_440136.1_2 Forward -238 -231 6.23397 0.171
NP_440136.1_2 Reverse -231 -238 6.13563 0.193
NP_442590.1_10 Reverse -230 -249 7.96426 0.216
NP_442998.1_10 Reverse -232 -239 15.5754 0.0102
NP_442998.1_10 Forward -342 -335 6.13563 0.181
NP_442998.1_10 Forward -333 -326 5.93897 0.206
NP_440899.1_2 Reverse -324 -343 12.88 0.112
NP_442333.2_5 Reverse -324 -343 -11.4069 0.246
NP_440256.1_1 Forward -242 -223 0.786102 0.0805
NP_440087.1_1 Reverse -326 -345 -4.91709 0.249
NP_441559.1_8 Forward -183 -169 -6.58858 0.279
NP_442756.1_2 Reverse -339 -358 3.14605 0.296
NP_440915.1_6 Reverse -226 -240 2.45787 0.118
NP_440915.1_6 Forward -16 -2 1.76955 0.131
NP_440915.1_6 Reverse -322 -336 1.08123 0.147
NP_440915.1_6 Forward -243 -229 -3.04867 0.29
NP_442069.1_4 Forward -257 -238 4.62101 0.254
NP_442866.1_1 Reverse -225 -244 -3.73712 0.221
NP_442866.1_1 Forward -349 -330 -5.01543 0.239
NP_441464.1_10 Reverse -312 -326 8.35772 0.284
NP_442993.1_1 Forward -239 -223 -8.20127 0.157
NP_442386.1_9 Reverse -229 -238 12.8806 0.0501
NP_440570.1_7 Reverse -5 -24 16.6174 0.199
NP_441750.1_4 Forward -347 -328 2.16274 0.266
NP_441340.1_5 Forward -238 -231 13.5105 0.0314
NP_441340.1_5 Reverse -231 -238 5.84064 0.208
NP_440168.1_9 Forward -346 -327 -2.26216 0.28
NP_440327.1_6 Forward -29 -10 2.55606 0.294
NP_439976.1_5 Reverse -114 -128 11.5037 0.268
NP_442240.1_2 Reverse -231 -250 -12.5869 0.163
NP_440586.1_1 Reverse -319 -338 -2.95047 0.263
NP_440586.1_8 Reverse -336 -343 10.9535 0.119
NP_440586.1_8 Reverse -231 -238 9.47853 0.146
NP_440586.1_8 Forward -238 -231 5.74197 0.283
NP_441262.1_3 Forward -239 -232 14.7888 0.0223
NP_441262.1_3 Reverse -335 -342 5.25066 0.215
NP_440027.1_3 Reverse -163 -181 2.18168 0.292
NP_440027.1_3 Forward -311 -293 1.88669 0.295
NP_443051.1_1 Forward -240 -231 15.1427 0.00754
NP_443051.1_1 Reverse -334 -343 -1.18024 0.297
NP_440451.1_10 Reverse -231 -250 13.2733 0.188
NP_441232.1_2 Reverse -79 -98 6.88262 0.273
NP_439937.1_8 Reverse -324 -343 12.7825 0.149
NP_439937.1_9 Forward -336 -319 8.10125 0.0715
NP_440439.1_1 Reverse -227 -240 -0.37404 0.215
NP_440439.1_1 Forward -242 -229 -1.35735 0.263
NP_440372.1_2 Forward -238 -231 13.8055 0.0214
NP_440372.1_2 Reverse -231 -238 6.52896 0.188
NP_440372.1_2 Reverse -327 -334 4.07068 0.262
NP_441789.1_7 Forward -106 -87 -3.93454 0.28
NP_440316.1_10 Reverse -334 -344 8.4365 0.239
NP_440139.1_1 Reverse -320 -339 0.392004 0.292
NP_441572.1_7 Reverse -329 -348 -3.44213 0.212
NP_442384.1_10 Reverse -230 -243 7.00078 0.0899
NP_442790.1_4 Reverse -326 -345 -13.8652 0.268
NP_442262.1_10 Reverse -231 -238 13.2155 0.0213
NP_442262.1_10 Reverse -336 -343 11.7405 0.0841
NP_441689.1_5 Forward -241 -231 6.0761 0.197
NP_442244.1_6 Reverse -323 -342 0.491109 0.291
NP_442244.1_9 Forward -96 -77 16.8141 0.137
NP_440163.1_10 Reverse -332 -342 8.63316 0.266
NP_440344.1_10 Reverse -162 -179 -12.1542 0.243
NP_440282.1_10 Reverse -325 -344 -2.95047 0.235
NP_442556.1_10 Reverse -185 -204 12.6504 0.217
NP_440297.1_9 Forward -343 -333 9.51814 0.0917
NP_440297.1_9 Reverse -231 -241 9.22315 0.0917
NP_440999.1_9 Reverse -226 -240 2.35953 0.151
NP_440999.1_9 Forward -339 -325 2.06454 0.154
NP_440888.1_2 Forward -335 -321 12.5853 0.0424
NP_440888.1_2 Reverse -230 -244 8.16044 0.171
NP_442277.1_4 Forward -353 -334 4.32522 0.199
NP_441543.1_2 Forward -238 -229 6.09625 0.153
NP_441551.1_5 Reverse -226 -242 7.03934 0.249
NP_441551.1_5 Forward -348 -332 6.74435 0.258
NP_442315.1_2 Reverse -310 -322 8.59377 0.293
NP_443064.1_6 Forward -256 -246 11.0156 0.13
NP_443064.1_6 Reverse -230 -240 8.88251 0.262
NP_443064.1_7 Reverse -46 -65 17.6155 0.262
NP_442578.1_5 Reverse -8 -27 -0.000545616 0.283
NP_442578.1_7 Forward -238 -231 6.0373 0.18
NP_442578.1_7 Reverse -336 -343 5.15232 0.291
NP_441462.1_2 Forward -239 -229 8.82982 0.03
NP_441462.1_2 Reverse -230 -240 0.57002 0.144
NP_441462.1_2 Reverse -335 -345 -1.10161 0.281
NP_441621.1_7 Reverse -324 -338 7.76774 0.0675
NP_441621.1_7 Forward -337 -323 -3.73699 0.193
NP_443062.1_1 Reverse -230 -248 8.54592 0.152
NP_443062.1_6 Reverse -50 -69 0.491109 0.294
NP_442204.1_1 Reverse -331 -342 0.94365 0.281
NP_442204.1_1 Forward -243 -232 0.451995 0.281
NP_441560.1_6 Reverse -225 -244 13.4708 0.241
NP_442487.1_5 Forward -98 -79 5.50519 0.224
NP_440255.1_5 Forward -196 -182 17.7731 0.211
NP_440255.1_7 Forward -376 -359 7.80699 0.296
NP_440516.1_6 Forward -344 -330 13.077 0.194
NP_440516.1_8 Forward -239 -230 9.4395 0.0183
NP_440516.1_8 Reverse -326 -335 9.24284 0.0264
NP_440516.1_8 Reverse -230 -239 5.11294 0.118
NP_440516.1_8 Reverse -335 -344 0.786375 0.133
NP_442428.1_5 Forward -238 -231 6.13563 0.209
NP_442428.1_5 Reverse -231 -238 6.0373 0.212
NP_442428.1_5 Reverse -336 -343 4.46401 0.267
NP_442859.1_2 Reverse -231 -250 5.50599 0.201
NP_442859.1_2 Reverse -336 -355 5.01433 0.212
NP_442120.1_10 Forward -113 -94 -15.0452 0.289
NP_440673.1_3 Reverse -232 -239 12.4288 0.0426
NP_440673.1_3 Forward -342 -335 11.6422 0.0724
NP_440673.1_3 Forward -333 -326 10.1672 0.149
NP_440436.1_4 Forward -238 -229 7.37413 0.132
NP_440436.1_4 Reverse -231 -240 6.29249 0.164
NP_441884.1_8 Forward -240 -221 3.44104 0.0952
NP_441884.1_9 Reverse -323 -342 -12.9802 0.138
NP_441719.1_4 Forward -238 -231 6.82395 0.0855
NP_441719.1_4 Reverse -231 -238 6.52896 0.188
NP_441719.1_4 Reverse -336 -343 3.77569 0.285
NP_441733.1_10 Forward -242 -229 9.36073 0.119
NP_441733.1_10 Reverse -323 -336 9.06573 0.127
NP_441733.1_10 Reverse -227 -240 6.50913 0.184
NP_442366.1_3 Forward -240 -222 1.69077 0.144
NP_442366.1_3 Forward -143 -125 1.10079 0.158
NP_442873.1_3 Forward -345 -326 6.88182 0.22
NP_440296.1_10 Reverse -332 -351 -12.6852 0.269
NP_442206.1_10 Reverse -326 -341 2.63483 0.201
NP_443054.1_2 Forward -241 -227 4.03116 0.24
NP_441851.1_10 Forward -240 -230 9.02648 0.114
NP_441851.1_10 Reverse -334 -344 4.60159 0.259
NP_440593.1_1 Reverse -272 -291 16.1257 0.298
NP_441409.1_8 Forward -320 -301 7.78774 0.277
NP_440432.1_9 Reverse -231 -246 -4.445 0.209
NP_440432.1_9 Forward -238 -223 -4.54333 0.211
NP_442843.1_1 Forward -343 -324 -7.08038 0.245
NP_441124.1_5 Forward -192 -182 13.9631 0.215
NP_441124.1_5 Reverse -207 -217 9.95241 0.299
NP_440431.1_3 Forward -202 -183 -10.817 0.278
NP_442450.1_5 Forward -241 -231 9.61647 0.115
NP_442450.1_5 Reverse -333 -343 6.17489 0.197
NP_442006.1_2 Reverse -326 -343 -8.22096 0.192
NP_441570.1_1 Reverse -230 -248 -9.0273 0.127
NP_441570.1_1 Reverse -335 -353 -16.0088 0.237
NP_441078.1_4 Reverse -230 -239 0.0980582 0.205
NP_441078.1_4 Forward -239 -230 0.0980582 0.205
NP_441078.1_4 Reverse -335 -344 -2.06522 0.295
NP_442729.1_5 Reverse -334 -344 9.32148 0.235
NP_440526.1_3 Reverse -231 -242 1.23817 0.267
NP_440526.1_3 Reverse -4 -15 1.13984 0.267
NP_441432.1_8 Forward -240 -231 5.60459 0.147
NP_442320.1_8 Reverse -224 -238 4.12949 0.0551
NP_442320.1_8 Forward -245 -231 -5.31028 0.217
NP_440629.1_6 Forward -350 -331 12.603 0.289
NP_442003.1_4 Reverse -231 -250 9.24257 0.3
NP_442815.1_2 Reverse -324 -342 14.8671 0.0834
NP_440760.1_1 Reverse -230 -249 -19.8634 0.22
NP_442797.1_7 Forward -336 -318 -0.964162 0.291
NP_440199.1_10 Forward -242 -232 7.74818 0.231
NP_441057.1_4 Forward -182 -164 -1.16082 0.272
NP_440913.1_1 Reverse -228 -246 5.23069 0.243
NP_442407.1_6 Reverse -326 -345 10.3242 0.29
NP_442400.1_10 Forward -365 -352 9.80195 0.27
NP_440713.1_4 Reverse -280 -299 3.44104 0.244
NP_442489.1_2 Reverse -273 -292 4.916 0.203
NP_442489.1_7 Reverse -230 -239 0.786375 0.152
NP_442489.1_7 Forward -239 -230 0.589713 0.17
NP_442489.1_7 Reverse -335 -344 -1.57357 0.213
NP_442079.1_7 Forward -343 -324 2.26107 0.232
NP_442079.1_7 Forward -334 -315 0.786102 0.27
NP_440559.1_1 Reverse -231 -240 7.66954 0.0999
NP_440559.1_1 Forward -238 -229 6.09625 0.134
NP_441659.2_8 Reverse -230 -240 13.943 0.0106
NP_440708.1_6 Forward -342 -323 -7.86702 0.255
NP_441185.1_7 Reverse -324 -343 12.8808 0.283
NP_442346.1_5 Forward -240 -230 8.33817 0.14
NP_440545.1_3 Forward -348 -331 -6.25434 0.273
NP_440831.1_3 Forward -344 -325 5.12514 0.29
NP_440459.1_2 Reverse -228 -245 8.49531 0.259
NP_442027.1_4 Reverse -294 -313 12.9387 0.269
NP_441833.1_4 Reverse -231 -238 6.52896 0.0924
NP_441833.1_4 Forward -238 -231 6.23397 0.163
NP_442162.1_9 Forward -238 -231 12.9205 0.0282
NP_442162.1_9 Reverse -231 -238 12.9205 0.0282
NP_440671.1_4 Forward -245 -231 15.3392 0.0454
NP_440671.1_4 Reverse -329 -343 6.98109 0.23
NP_443026.1_5 Reverse -291 -310 -2.85214 0.283
NP_442140.1_3 Forward -238 -228 7.94484 0.124
NP_442140.1_3 Forward -334 -324 5.5849 0.202
NP_442140.1_3 Reverse -231 -241 3.61828 0.288
NP_441813.1_5 Forward -241 -231 6.37155 0.0947
NP_441813.1_5 Reverse -228 -238 6.07655 0.104
NP_440594.1_3 Reverse -230 -248 11.9172 0.282
NP_440590.1_4 Forward -238 -225 -5.38892 0.277
NP_440590.1_4 Reverse -231 -244 -5.58558 0.283
NP_442839.1_5 Reverse -38 -57 15.1424 0.219
NP_442497.1_10 Reverse -231 -240 10.0295 0.0222
NP_442497.1_10 Forward -343 -334 0.196389 0.208
NP_442497.1_10 Forward -238 -229 -1.18024 0.256
NP_440821.1_4 Forward -241 -231 10.1081 0.0188
NP_440821.1_4 Reverse -333 -343 0.373358 0.18
NP_440821.1_4 Reverse -228 -238 0.176696 0.198
NP_440821.1_4 Reverse -324 -334 -0.708283 0.287
NP_441239.1_9 Reverse -228 -240 16.7552 0.0157
NP_441239.1_9 Forward -346 -334 7.51213 0.158
NP_441239.1_9 Forward -337 -325 7.4138 0.161
NP_441951.1_4 Forward -245 -226 2.45773 0.283
NP_440156.1_3 Reverse -314 -333 9.14423 0.182
NP_441892.1_1 Forward -248 -231 2.20212 0.143
NP_441892.1_1 Reverse -326 -343 -0.944468 0.193
NP_441617.1_8 Forward -380 -361 9.63507 0.289
NP_440546.1_4 Forward -239 -229 14.5061 0.0459
NP_440546.1_4 Reverse -230 -240 11.0156 0.0991
NP_441509.1_1 Reverse -181 -200 6.58763 0.273
NP_441230.1_5 Forward -349 -330 5.80098 0.182
NP_441230.1_5 Reverse -225 -244 -0.885524 0.292
NP_440462.1_6 Reverse -228 -238 14.3364 0.0215
NP_440462.1_6 Forward -337 -327 4.60159 0.194
NP_442340.1_3 Reverse -94 -113 -8.94866 0.265
NP_440868.1_4 Forward -348 -336 7.51213 0.0691
NP_440868.1_4 Forward -339 -327 1.12062 0.192
NP_442479.1_9 Reverse -180 -199 -9.53865 0.266
NP_442479.1_9 Forward -190 -171 -9.93197 0.266
NP_441474.1_1 Forward -345 -326 -2.55791 0.28
NP_440696.1_3 Reverse -226 -244 -1.45582 0.259
NP_442039.1_4 Forward -238 -231 11.6422 0.0747
NP_442696.1_6 Forward -311 -292 -11.3086 0.235
NP_442837.1_3 Forward -238 -231 6.0373 0.25
NP_442837.1_3 Reverse -231 -238 6.0373 0.25
NP_442053.1_1 Reverse -230 -239 7.17789 0.104
NP_442053.1_1 Forward -335 -326 4.71961 0.228
NP_442053.1_1 Forward -344 -335 4.32629 0.254
NP_440505.1_3 Forward -241 -231 5.97822 0.202
NP_441011.1_8 Forward -238 -229 14.651 0.023
NP_442533.1_6 Forward -239 -230 5.40793 0.14
NP_442533.1_6 Reverse -230 -239 4.52295 0.179
NP_441482.1_7 Forward -245 -231 0.491246 0.0558
NP_441482.1_7 Reverse -329 -343 -11.6035 0.275
NP_439944.1_9 Reverse -231 -241 7.55152 0.138
NP_440116.1_8 Reverse -231 -250 -8.85033 0.261
NP_440007.1_9 Reverse -331 -345 9.2427 0.171
NP_440007.1_9 Forward -243 -229 2.65453 0.277
NP_441680.1_4 Reverse -164 -183 -1.08219 0.256
NP_441680.1_6 Reverse -1 -20 15.4366 0.162
NP_442492.1_2 Forward -239 -220 12.4875 0.0817
NP_441106.1_1 Reverse -229 -238 7.66954 0.0776
NP_441286.1_1 Reverse -229 -241 -4.58258 0.165
NP_440670.1_8 Forward -239 -230 8.65285 0.0627
NP_440670.1_8 Reverse -230 -239 6.29291 0.124
NP_440886.1_7 Reverse -229 -239 7.74772 0.0843
NP_440886.1_7 Forward -336 -326 6.66608 0.115
NP_440886.1_7 Reverse -325 -335 6.27276 0.134
NP_442382.1_9 Reverse -94 -113 10.3234 0.281
NP_440205.1_9 Reverse -63 -81 16.5379 0.2
NP_442072.1_9 Forward -240 -222 -14.7305 0.156
NP_440907.2_8 Reverse -231 -241 8.04271 0.117
NP_440907.2_8 Forward -334 -324 6.0761 0.179
NP_440907.2_8 Forward -238 -228 5.09279 0.222
NP_441021.1_8 Forward -244 -226 17.7187 0.0605
NP_442842.1_4 Reverse -297 -316 2.0644 0.272
NP_442842.1_4 Reverse -231 -250 1.0811 0.297
NP_441626.1_2 Forward -238 -231 12.2322 0.0511
NP_441626.1_2 Reverse -231 -238 5.93897 0.231
NP_442794.1_1 Reverse -129 -141 7.11881 0.148
NP_442615.1_1 Reverse -221 -239 -1.55415 0.13
NP_441796.1_8 Reverse -328 -346 15.3588 0.127
NP_440855.1_5 Forward -340 -321 5.70185 0.285
NP_441431.1_2 Reverse -227 -241 7.96378 0.23
NP_441431.1_2 Reverse -170 -184 7.47213 0.241
NP_441993.1_1 Reverse -230 -249 6.13735 0.186
NP_441993.1_1 Forward -245 -226 2.23906 0.261
NP_441993.1_1 Forward -182 -163 1.36194 0.28
NP_440814.1_4 Forward -248 -229 -12.3902 0.23
NP_440114.1_10 Forward -239 -225 12.1926 0.0885
NP_440114.1_10 Reverse -335 -349 5.80112 0.292
NP_440293.1_3 Reverse -327 -346 -6.49039 0.29
NP_440293.1_9 Reverse -93 -107 8.92841 0.299
NP_440766.1_4 Forward -243 -229 21.9274 0.0197
NP_439910.1_2 Reverse -222 -239 -13.7275 0.162
NP_442867.1_8 Forward -300 -281 4.03102 0.293
NP_440457.1_1 Forward -243 -231 19.1152 0.0353
NP_440457.1_1 Reverse -331 -343 8.20045 0.101
NP_440457.1_1 Forward -16 -4 7.51213 0.103
NP_440457.1_1 Reverse -322 -334 0.432302 0.25
NP_440457.1_1 Forward -17 -5 -0.944332 0.285
NP_440987.1_4 Forward -378 -359 2.75272 0.298
NP_441984.1_3 Reverse -226 -244 17.5221 0.0928
NP_441984.1_3 Reverse -163 -181 8.37728 0.232
NP_440473.1_1 Forward -347 -328 15.5957 0.111
NP_442509.1_9 Forward -335 -325 9.616 0.192
NP_440524.1_3 Reverse -5 -24 9.3409 0.28
NP_440554.1_4 Forward -238 -228 6.27322 0.123
NP_440554.1_4 Reverse -231 -241 4.0116 0.205
NP_441885.1_5 Forward -239 -229 7.94484 0.0385
NP_442341.1_7 Reverse -229 -243 7.07942 0.111
NP_442341.1_7 Forward -143 -129 2.45787 0.256
NP_442341.1_7 Reverse -325 -339 2.2612 0.263
NP_442341.1_9 Forward -346 -332 10.6187 0.133
NP_440423.1_6 Reverse -327 -346 -3.93378 0.126
NP_440423.1_6 Forward -247 -228 -21.3384 0.288
NP_440507.2_3 Reverse -89 -108 7.86512 0.268
NP_440275.1_3 Forward -241 -231 7.45319 0.0714
NP_440275.1_3 Reverse -324 -334 5.68323 0.136
NP_440091.1_1 Reverse -226 -238 13.0187 0.0346
NP_440091.1_1 Reverse -322 -334 -0.0593532 0.27
NP_440679.1_10 Forward -342 -323 -8.45701 0.18
NP_442451.1_2 Forward -103 -84 -2.85214 0.187
NP_439962.1_4 Forward -343 -324 -2.0655 0.224
NP_440216.1_1 Reverse -230 -244 -3.73699 0.0881
NP_440216.1_1 Reverse -335 -349 -11.8001 0.219
NP_440172.1_1 Reverse -335 -345 6.07655 0.115
NP_440172.1_1 Reverse -230 -240 3.61828 0.222
NP_442290.1_8 Forward -240 -226 18.7808 0.165
NP_441045.1_4 Reverse -73 -92 11.7992 0.274
NP_441226.1_7 Forward -238 -231 12.7234 0.0312
NP_441226.1_7 Reverse -231 -238 11.5435 0.0757
NP_441111.1_7 Reverse -231 -239 8.86921 0.0589
NP_441766.1_2 Forward -239 -230 8.1612 0.0645
NP_441766.1_2 Reverse -230 -239 5.89959 0.103
NP_441766.1_2 Forward -335 -326 4.91628 0.154
NP_442116.1_6 Forward -377 -360 6.64108 0.273
NP_442403.1_9 Reverse -323 -342 5.89931 0.208
NP_440261.1_5 Reverse -231 -244 -10.6005 0.201
NP_440261.1_5 Forward -343 -330 -10.9938 0.23
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

AAGACTAACAAACCTGACAATCTAAATTATTGGAGAGATTTCATGGAAACAGGGCACTCCATCGCCCTGATCGCCGCACAAACACCTAAAACCAAAGAAACCCCTCACGCTTTGGACGGCACAGAAGGGGTTCCTAAGGTCTTAAAGGCTCACCAACCAAGGGCGATCGGTGCTTTTAAATTGAATTTCTCAAACGGCAAGCCGCAACTAGCAAAATTTGCAGGGGGTGCCGCTTGATATCTATCTTATCGTTAATCCGTCGATATTCAAGGGGTACAGGCAAATTTAGTGTCGGCAACATCAACGGAACTCCCTCCCTGCCTGAAATTTGGAAGCAAAAACCCTTCTGTTTAGGGACATATACAACACGTCAGCTCAATGATGCAGGGGGGGTGGAGTA

CDS

ATGAAAGTTAGACCCCAGCACTGGCAAGAATGGGTGAATAGCGGCATCGCCCCTGAGATAATCGAAGCTAACCTGAAGAGCCTAGATAACGCCTACGGATGGTTACTGTATTCGGAGAAACTACCCCGGCGTAACGATGGACGATTAAGTCAAGGAATACTGACCCAATACCGTCACCTTGAACAGGGAGGCTGGTATTGCTCTGGATTAGATGCCATAACTCTAGAAGATTCCCAATGGGGCTGTTTTAAACCAGATCAGCCTCGACTCTCCCAAGAAGGGAAGCTAATTAAATATGAACACCCCCCCAAGACCTCAACAGAAGCATTTTGCTTAAAAATCACCCGTCATCAATGGCGACAAATTGCCCAGAAAGCTGGATTAGAGTGCCCCGACCTTGAGCATATCCCTAACCAAGAGATAGCCCAATCATTCTGGCAATGGGTAAAAAATAACCCCGCCGTACCCATCATCATCACCGAAGGAGCCAAAAAGACCGCATCCTTGCTTAGTTATGGCTATGCCGCCCTAGGCTTGCCGGGGATTTATTCCGGTTACCGCTCCAAAGATAGCGAGGGAATTGAATTAGTCCATAAACAGCTAATCCCCCAGCTTGAGACATTTTGCCAACAGGGTCGAGAATTTGTCTTCTGTTTTGACAACGACAACAAACCCACCACCAAGCACAACGTCAGAAAGGCGATCGCCAACACAGGGTGTCTGATGGAGCTCCAGGGATGCAAAGTCACTGTCATGACCTGGGCTGGATTAGCCAAGGGTATTGACGATGTCATCGTTGGCAACGGAGAAACCAGCCTAGACCGCATTTATTCTGCCCGCCAGAGCCTCGAAGCTCACAAACTAAGCGAATTTACCGACCTAACCCCCCTCATCTCCCAGATAGTAAATTGCCGCTACCTAGACCAGGATATTTTGGCCAATGTCACCAGCCGATTAGTAGGCATAAAAGCCGCCAAGGGAACAGGAAAAACCGAGGCTTTAGCCCAACAAGTACAGCAGGCGATCGCCAAAGGACTGCCCGTCATTGTCCTCACCCACCGGGAACAATTAGCCAAAGAATTGGCCCAGCGGTTTGGATTACCTTACCGGTCGGAATTGGAATTTGGAGCCGAATCCTTCCATGGTTATGTCTTGTGTGTTGATTCCCTGCATCCCCAAGCCAAGCCCGCCTTCGACTCCAGCCGCTACCCTGACGCCCTGGTCATTTTGGACGAAGCGGAGCAGGTCATCTGGCACTTACTCAATTCCGTCACCTGCCAACGCAATCGCCCCGCCATCCTGGAAACCCTCAGCCAATTGCTTAATGGAGCCGGGCAAATCGTCCTCAGTGATGCTGACCTAACCCGCATCAGCCTTGATTACCTCCATGGGCTATTAACAGTCCAGTGCGCTCCCTGGGTCTTGGTGAACGAATATCACCCCGCCAGTGCCCGTAAAGCTTTCCTTTATGACGCCCCAGAAGCTTTATTTTCCGATGCCTTGGAATGTATCCAAAACGGAGAACGGCTCATAATTCATACAGGAGCCCAAAAAGTCAGCAGCAAATGGGGCACTATTAACCTGGAAACAACCCTATCGGGAGCCTTCCCAGAGCTGAACATTTTACGCATTGATGCGGAATCAGTGGCGGAACCGGGACACCCCGCCTATGGAGTAATGGGCAACCTCAACGCCATCATTCCCCTCTATGACATTGTTATTGCCTCCCCAACTCTAGAAACAGGGGTAAGCATTGATGTTAAAGGGCATTTCCACCGCGTCTTCTGTTTTGCCCCCGGCAGTCAAACCGCTGAAGCTGTCTGTCAATCCTTGGCCCGGGTGCGGGAAGATCTCCCCCGTCATCTCTGGATTAAAAAATATTCCAATCAAAGCATTGGCAACGGCTCCACCATTCCAAAAATATTGGTCAGCTCCCAGCAAAAGCTCTTTAAAGCTAACTCCCTCCTCTTGGGACAAGCGGATACCATCGCCAACCTAGATGGCCATTGCTCCCGCCACATGGTCACCTGGGCCAGGTACAGCGCCCTCCACAACCATGGCTTTAAAAAATATCGAGATGTTATCCTTAGCCGCTTGGAAGCCGAAGGGTATAGCATTCTCTCCACCGATGCCCCCGACGATGCCAAAAGCGTTGGAGAATTTATGAAAGCCTACACAGAAGCCAATTATCAGCAACACTGCGAAAAGGTCGCCGCCGCCCCCCTGCTCGATGATCTAGAATTTGAGCGCATCAGCAGGGCCCGGGCCAAAAGTGAGCCAGAACGATTGTCAGAACAAAAAACAGCCATCTCCAAACGGTATCTCACCGACGACATCACCCCGGAACTGGTCAGCCAGGATGACAAAGGACTATATGGTCAATTGCAGTTGCGCTACTACTTAACCCTAGGGCGGGAATTTTTAGCTGAGCGGGATACCCATCGAGTTAAAAAGCTCACCAAACAAACCGGGGAGGCTTTCACCCCCGACATTAACAGCACCTGCTACAGCGCCAAGGTAAAAACCCTGGAAATTATCAATATCGGGCAATTCCTCGACGGTTCCGCCCATACCTCGGAAAGCTTACGGGACTGGTTTGAGCATATCTGTCAGTTCCGTGATGACATTAAGGCTATTCTCAATCAATCCATCAATCCCGAACGGGACACCCCCATCGCCGTTGCCCAACGATTGCTGGGATTAATGGGCTTGAAAATGACAGGGAAACAATACCGGATCAATGGGGGACGTCAGCGCATTTATGCCCTCGTAGACTCTCCCCCCGACGACCCAGCCAAAATCATTATGGAACGCTGGTTTGAACGGGATTCTAGCCGCGTCCCCTGTCACACCTCTTCTTTAAAAGAGTTATGTTAA

Protein

No sequence available