Your browser is old and dusty. Try Google Chrome!

Details for slr7025

ORF slr7025
Accession NP_942313.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_1 Forward -155 -136 11.6018 0.203
NP_443032.1_8 Forward -250 -231 3.04771 0.238
NP_442272.1_2 Forward -53 -34 12.6523 0.217
NP_442173.1_1 Reverse -231 -239 5.72262 0.203
NP_441812.1_1 Forward -95 -81 14.5519 0.207
NP_442861.1_4 Reverse -146 -165 -0.00131823 0.297
NP_440110.1_6 Forward -312 -293 13.3725 0.228
NP_441802.1_1 Reverse -235 -254 7.47261 0.248
NP_442048.1_5 Forward -114 -95 15.8307 0.169
NP_439918.1_2 Reverse -299 -318 11.6025 0.126
NP_440518.1_8 Reverse -267 -286 10.4217 0.288
NP_442375.1_5 Forward -86 -72 13.9619 0.289
NP_441149.1_9 Forward -234 -215 -0.886293 0.282
NP_441738.1_2 Forward -139 -132 6.72528 0.236
NP_440447.1_1 Reverse -237 -255 2.57575 0.278
NP_441713.1_1 Reverse -308 -327 -15.8318 0.273
NP_442570.1_3 Reverse -296 -315 6.19431 0.159
NP_443013.1_3 Reverse -115 -134 9.83255 0.297
NP_441327.1_4 Forward -340 -326 15.0442 0.282
NP_441209.1_4 Forward -316 -297 22.6147 0.0887
NP_441695.1_8 Forward -314 -300 9.83269 0.296
NP_440376.1_1 Reverse -298 -307 -0.295266 0.286
NP_441002.1_5 Reverse -66 -85 9.73422 0.296
NP_442730.1_8 Forward -317 -298 9.04509 0.185
NP_442687.1_1 Reverse -65 -78 10.6384 0.294
NP_442687.1_7 Forward -252 -242 6.27322 0.175
NP_442589.1_5 Forward -300 -281 15.4374 0.265
NP_440642.1_10 Reverse -353 -367 4.62054 0.25
NP_440493.1_2 Reverse -192 -211 12.7825 0.234
NP_442782.1_2 Reverse -299 -313 1.57289 0.281
NP_442782.1_2 Forward -251 -237 0.687908 0.286
NP_442205.1_6 Reverse -305 -323 9.85225 0.288
NP_442937.1_5 Forward -370 -351 15.6341 0.0562
NP_440450.1_7 Forward -314 -300 17.1085 0.183
NP_442816.1_7 Reverse -176 -195 7.20922 0.238
NP_439905.1_2 Reverse -351 -365 10.3243 0.214
NP_441097.1_2 Reverse -296 -313 6.62702 0.252
NP_442690.1_1 Forward -21 -2 -15.0452 0.277
NP_442064.1_4 Reverse -346 -365 6.1935 0.256
NP_440200.1_7 Forward -60 -41 4.88691 0.287
NP_440496.1_3 Reverse -71 -90 14.6576 0.262
NP_441099.1_8 Reverse -179 -197 12.703 0.246
NP_442002.1_1 Reverse -296 -314 -6.86402 0.249
NP_442002.1_7 Reverse -166 -184 20.8174 0.0598
NP_441654.1_5 Reverse -254 -273 12.92 0.269
NP_442598.1_2 Reverse -149 -158 14.8477 0.252
NP_440983.1_5 Forward -320 -301 -5.01543 0.261
NP_441079.1_7 Forward -83 -64 -4.72118 0.252
NP_441079.1_7 Reverse -251 -270 -7.27777 0.29
NP_001035871.2_7 Reverse -296 -306 14.9263 0.171
NP_442500.1_8 Forward -359 -345 8.63588 0.291
NP_442215.1_2 Forward -102 -86 6.05672 0.074
NP_442970.1_3 Reverse -1 -19 14.5603 0.168
NP_441015.1_8 Forward -63 -44 0.0977854 0.28
NP_440265.1_7 Forward -200 -186 14.4536 0.287
NP_441764.1_8 Forward -216 -206 12.842 0.284
NP_441764.1_8 Reverse -23 -33 12.1721 0.284
NP_442719.1_2 Reverse -3 -21 6.60656 0.135
NP_442719.1_2 Reverse -243 -261 -10.4046 0.273
NP_442719.1_2 Forward -71 -53 -11.1913 0.29
NP_441612.1_2 Reverse -222 -232 7.29072 0.256
NP_442808.1_1 Forward -315 -305 4.20782 0.203
NP_440031.1_10 Forward -314 -295 0.687771 0.274
NP_442593.1_9 Reverse -106 -125 16.0762 0.257
NP_441036.1_9 Reverse -1 -19 8.7706 0.22
NP_441557.1_4 Reverse -129 -143 9.93102 0.291
NP_441590.1_6 Forward -317 -298 22.8114 0.0354
NP_440084.1_8 Forward -79 -65 8.60589 0.299
NP_440151.1_5 Reverse -293 -312 15.2408 0.0828
NP_442014.1_5 Forward -73 -54 15.6341 0.0711
NP_442998.1_5 Reverse -311 -321 12.1731 0.176
NP_442998.1_10 Reverse -232 -239 9.28223 0.117
NP_442504.1_4 Forward -51 -32 0.466041 0.279
NP_440709.1_1 Reverse -3 -22 3.73524 0.208
NP_442283.1_2 Forward -105 -86 10.1275 0.211
NP_441866.1_4 Reverse -68 -81 11.8832 0.3
NP_440537.1_6 Forward -62 -43 8.94757 0.267
NP_440306.1_1 Forward -177 -158 4.32602 0.203
NP_440306.1_8 Forward -328 -309 1.47364 0.204
NP_441340.1_9 Forward -215 -205 7.29115 0.289
NP_442484.1_2 Forward -250 -231 -1.57384 0.294
NP_439984.1_7 Forward -139 -121 -4.8974 0.292
NP_439984.1_10 Forward -137 -123 11.5037 0.253
NP_441740.2_10 Forward -232 -213 10.7175 0.286
NP_441138.1_5 Reverse -168 -181 12.3802 0.17
NP_442285.1_7 Reverse -351 -370 6.58763 0.275
NP_440316.1_10 Reverse -304 -314 8.4365 0.239
NP_441018.1_7 Reverse -346 -365 12.6841 0.154
NP_442262.1_10 Reverse -231 -238 7.90559 0.266
NP_442693.1_6 Forward -314 -295 -0.885524 0.297
NP_440237.1_5 Reverse -76 -90 22.025 0.0243
NP_440544.1_5 Reverse -265 -272 13.8024 0.28
NP_440454.1_2 Forward -181 -167 10.3247 0.291
NP_440516.1_8 Forward -239 -230 -0.590259 0.283
NP_442428.1_7 Reverse -40 -59 5.99764 0.296
NP_440673.1_2 Reverse -80 -99 8.43855 0.27
NP_442705.1_5 Forward -243 -224 21.0423 0.091
NP_441004.1_1 Reverse -305 -324 -9.34199 0.206
NP_441004.1_2 Forward -262 -243 -1.67217 0.263
NP_442366.1_3 Reverse -83 -101 -4.01242 0.262
NP_441542.1_4 Forward -243 -229 4.12949 0.264
NP_442689.1_8 Reverse -3 -20 2.79211 0.18
NP_441124.1_5 Reverse -8 -18 14.6315 0.215
NP_441432.1_8 Reverse -304 -313 7.27622 0.101
NP_441432.1_8 Forward -240 -231 5.40793 0.158
NP_440290.1_1 Reverse -8 -17 16.0328 0.292
NP_441022.1_1 Forward -74 -65 15.0954 0.183
NP_441968.1_1 Forward -177 -169 15.162 0.257
NP_440335.1_9 Forward -357 -339 8.96727 0.298
NP_441888.1_7 Forward -98 -84 3.44117 0.225
NP_443040.1_1 Forward -84 -70 10.0873 0.291
NP_441329.1_1 Forward -196 -177 7.11373 0.24
NP_440671.1_4 Reverse -224 -238 7.37441 0.219
NP_442943.1_1 Forward -18 -3 4.73258 0.221
NP_441609.1_1 Reverse -42 -61 1.86774 0.193
NP_441696.1_4 Reverse -306 -319 11.9173 0.267
NP_442028.1_1 Reverse -160 -173 10.0884 0.251
NP_442497.1_4 Forward -282 -263 24.4933 0.0139
NP_440624.1_5 Forward -81 -63 13.5482 0.178
NP_441541.1_1 Forward -23 -5 -1.3349 0.237
NP_442402.1_10 Forward -320 -310 10.8943 0.275
NP_441848.1_4 Reverse -2 -18 9.93796 0.267
NP_440825.1_6 Reverse -63 -82 10.9142 0.282
NP_440160.1_1 Reverse -124 -143 10.8206 0.232
NP_442360.1_5 Reverse -306 -316 16.1063 0.161
NP_441252.1_6 Reverse -309 -316 11.6422 0.288
NP_442844.1_1 Forward -383 -368 18.8594 0.263
NP_441576.1_10 Reverse -63 -82 10.9142 0.291
NP_442232.1_9 Reverse -306 -325 16.2232 0.224
NP_441697.1_5 Reverse -65 -84 -11.7937 0.299
NP_440816.1_2 Forward -85 -66 7.30627 0.267
NP_441527.1_4 Forward -182 -163 5.39487 0.106
NP_441527.1_4 Forward -360 -341 -9.31089 0.256
NP_441527.1_4 Forward -356 -337 -12.6531 0.292
NP_442673.1_7 Reverse -70 -89 11.6018 0.278
NP_441021.1_1 Reverse -85 -104 -11.1119 0.257
NP_440962.1_5 Reverse -336 -346 19.2529 0.248
NP_442794.1_1 Reverse -352 -364 4.16888 0.276
NP_441431.1_3 Reverse -305 -324 2.45773 0.283
NP_442743.1_1 Forward -323 -304 6.78348 0.268
NP_441489.1_3 Forward -16 -2 8.22393 0.244
NP_442582.1_3 Forward -89 -75 12.8075 0.284
NP_442703.1_8 Reverse -339 -357 10.8348 0.266
NP_441173.1_9 Reverse -6 -14 11.8187 0.222
NP_440750.1_5 Forward -59 -45 14.5526 0.126
NP_441105.1_3 Reverse -231 -250 1.96607 0.108
NP_440172.1_1 Forward -239 -229 2.43831 0.279
NP_441045.1_1 Reverse -370 -389 18.4857 0.121
NP_440305.1_1 Forward -90 -76 16.1498 0.134
NP_440305.1_1 Reverse -11 -25 13.9534 0.233
NP_442379.1_10 Reverse -221 -238 0.333834 0.223
NP_442116.1_6 Forward -59 -42 5.78166 0.291
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTTACTCCGCTTAGATTCTGCTTTAGCTGAAAGTGGCCAGAGTGAAAGCTTAAAAAGTAAAACCCTTACAATAGAACACGTTCTTCCCCAAAGCCTAACCCTGGAATGGAAAAGCTTAGGATGGAATGAAGAAAATCATGCAATTTGGGTCAATCGTTTAGGCAATCTGGCTTTGCTCTCTCAAAAGAAAAACTCATCCGGCAGTAATTTAAGCTTTGAAATCAAGAAAAAAGAGTATTTTCAAAAGAAAGGAAGCGTAACATTCCCCATTACAACCAGAATTTTAAGCTATTCGACTTGGACACCAGCAATAGTTGAACAAAATCAAAACTTTTACATCAAGACCCTGAAAAAAGTTTGGAGGTTAAGTTTGATGTAGTCAAATTTTGTAAAAAGTAA

CDS

ATGAATATAACCTTTAAGTTTAACTTTATGAGCTACAAACACTATTTTTCTCCTAAACATAAACCAGAAATTACTCAGGCTATTACTATTACTGAGCCTGCTATTATTTTTCGTCTTAATAAAACTTACTCTACCAATCTTAGCCAACAAGAAATTTATGATATAACCCGGAGTGACTGGATTCTTGGCCATAGGAGAGAAAAAGCAGAGTACGGCTTTGCTGCCTTCAAAGGGGTTGTCCTACAAGTTTATCGCATTGACCGCTGGGATTTTTCCGGTAAAGTGACCGATGTAGGTCGTCAGCGCTGGTTCTTTGAAGGAAAAGTAGCTACAGAAATGCAAGATTACATCAATGGTAATATATCTCATTATTTTAAAAAAGGTGATAGGTCTCCCACCAAATATTTAAATTGTTAA

Protein

No sequence available