Your browser is old and dusty. Try Google Chrome!

Details for slr7023

ORF slr7023
Accession NP_942311.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_5 Reverse -212 -231 17.109 0.173
NP_441453.1_4 Forward -382 -374 6.80426 0.121
NP_441453.1_4 Reverse -373 -381 6.11594 0.121
NP_442151.1_6 Forward -382 -368 15.3392 0.0238
NP_442151.1_6 Forward -170 -156 7.07942 0.211
NP_441818.1_1 Forward -169 -158 11.8579 0.155
NP_441818.1_9 Reverse -343 -362 -6.09707 0.259
NP_440259.1_4 Forward -225 -211 10.564 0.262
NP_442173.1_1 Reverse -374 -382 12.0158 0.0316
NP_442173.1_1 Forward -258 -250 5.0343 0.24
NP_442173.1_1 Forward -381 -373 4.83764 0.241
NP_442752.1_4 Forward -382 -375 13.8055 0.0199
NP_443027.1_4 Forward -172 -162 11.0914 0.107
NP_442975.1_10 Reverse -100 -114 2.8506 0.269
NP_440784.1_7 Forward -169 -162 8.59391 0.129
NP_440784.1_7 Forward -381 -374 6.23397 0.241
NP_440784.1_7 Reverse -374 -381 6.13563 0.241
NP_440110.1_6 Reverse -244 -263 17.8957 0.139
NP_442974.1_2 Forward -362 -344 19.292 0.121
NP_441859.1_3 Forward -383 -364 2.45694 0.258
NP_440044.1_8 Forward -381 -362 -1.96717 0.256
NP_439923.1_10 Reverse -310 -329 10.9142 0.291
NP_440893.1_10 Forward -211 -192 7.96426 0.293
NP_441594.1_6 Reverse -376 -395 0.58944 0.282
NP_442196.1_9 Reverse -245 -258 15.3589 0.297
NP_442110.1_7 Forward -382 -368 4.12949 0.205
NP_441925.1_2 Forward -62 -43 6.19431 0.262
NP_441925.1_4 Forward -362 -343 -1.77127 0.158
NP_441925.1_4 Forward -368 -349 -12.4893 0.254
NP_441925.1_4 Forward -365 -346 -14.9476 0.263
NP_441083.1_5 Reverse -373 -383 8.82982 0.03
NP_441083.1_5 Forward -382 -372 8.04317 0.046
NP_442115.2_7 Forward -362 -345 7.41366 0.218
NP_441738.1_2 Reverse -375 -382 15.28 0.0102
NP_440209.1_1 Forward -382 -374 8.57422 0.0425
NP_440209.1_1 Reverse -373 -381 5.52596 0.0821
NP_442889.1_8 Forward -173 -159 4.52221 0.263
NP_441770.1_4 Forward -274 -255 6.88262 0.101
NP_442111.1_4 Reverse -372 -386 12.586 0.0422
NP_440906.1_5 Forward -381 -374 6.23397 0.234
NP_440906.1_5 Reverse -374 -381 6.13563 0.241
NP_440747.1_10 Forward -385 -373 -2.4193 0.0434
NP_440747.1_10 Reverse -370 -382 -12.1541 0.227
NP_441130.1_10 Reverse -371 -385 6.88276 0.173
NP_441486.1_1 Forward -173 -159 -2.36035 0.175
NP_440842.1_5 Forward -352 -333 12.6741 0.283
NP_441695.1_10 Forward -212 -193 15.4366 0.267
NP_441014.1_8 Forward -365 -346 13.1758 0.0932
NP_441014.1_10 Forward -171 -152 -1.27961 0.259
NP_442848.1_1 Reverse -155 -169 -4.4253 0.291
NP_441012.1_4 Reverse -375 -388 5.62415 0.291
NP_443018.1_3 Reverse -374 -381 11.7405 0.0655
NP_443018.1_3 Forward -381 -374 5.44732 0.193
NP_441634.1_8 Reverse -341 -355 -2.75368 0.295
NP_441634.1_8 Forward -384 -370 -4.22864 0.295
NP_440376.1_1 Forward -382 -373 5.99792 0.111
NP_440376.1_1 Reverse -373 -382 -0.196935 0.285
NP_441857.1_5 Reverse -366 -384 3.95239 0.222
NP_442687.1_7 Forward -383 -373 4.50326 0.245
NP_442191.1_4 Forward -391 -377 10.7022 0.288
NP_441797.1_1 Forward -371 -352 14.5524 0.239
NP_441077.1_6 Reverse -83 -99 10.8036 0.16
NP_440360.1_5 Reverse -257 -276 -0.983855 0.297
NP_442658.1_1 Forward -384 -374 7.35439 0.214
NP_442544.1_6 Forward -389 -370 4.03102 0.0884
NP_441414.1_9 Reverse -373 -392 -5.70374 0.178
NP_441414.1_9 Forward -382 -363 -9.44032 0.259
NP_440800.1_2 Forward -396 -377 17.4284 0.0967
NP_442300.1_10 Reverse -349 -368 9.93088 0.293
NP_442321.1_4 Forward -218 -199 -6.68705 0.284
NP_441958.1_5 Forward -383 -373 0.865012 0.12
NP_441127.1_1 Reverse -167 -181 8.94771 0.284
NP_440950.1_1 Reverse -102 -121 -0.0988766 0.276
NP_442816.1_7 Forward -22 -3 5.0129 0.256
NP_439990.1_5 Reverse -156 -169 6.50913 0.234
NP_442376.1_6 Reverse -191 -210 2.0644 0.295
NP_442911.1_2 Reverse -363 -382 -8.45701 0.235
NP_440153.1_8 Forward -366 -353 -3.12731 0.285
NP_442536.1_8 Reverse -294 -313 12.2908 0.253
NP_440993.1_3 Forward -149 -130 -1.96793 0.292
NP_441099.1_5 Reverse -363 -382 9.14423 0.0328
NP_442002.1_9 Forward -383 -376 10.7572 0.185
NP_442431.1_10 Reverse -340 -358 5.03403 0.206
NP_442431.1_10 Reverse -297 -315 1.10079 0.26
NP_442431.1_10 Reverse -343 -361 0.707465 0.267
NP_441000.1_6 Reverse -372 -386 -3.147 0.221
NP_440147.1_4 Forward -384 -371 8.27909 0.0533
NP_441550.1_8 Reverse -371 -381 12.1726 0.0361
NP_441550.1_8 Forward -384 -374 7.55106 0.154
NP_441041.1_7 Forward -385 -373 10.0414 0.103
NP_439966.1_7 Reverse -371 -381 14.5325 0.0203
NP_439966.1_7 Forward -362 -352 8.53436 0.135
NP_439966.1_7 Forward -384 -374 8.23937 0.14
NP_439966.1_9 Reverse -380 -389 4.52295 0.253
NP_439966.1_9 Forward -384 -375 0.884706 0.253
NP_442941.1_3 Forward -169 -159 4.99491 0.132
NP_442941.1_3 Reverse -374 -384 0.963343 0.16
NP_440289.1_2 Forward -385 -372 0.117615 0.175
NP_440289.1_2 Reverse -224 -237 -0.669033 0.206
NP_440983.1_9 Forward -227 -208 3.24438 0.285
NP_442500.1_8 Reverse -227 -241 10.564 0.272
NP_442049.1_2 Forward -197 -178 10.6192 0.176
NP_441644.1_6 Reverse -373 -383 7.15773 0.133
NP_441644.1_6 Forward -382 -372 4.01116 0.253
NP_443049.1_6 Forward -383 -373 11.6409 0.24
NP_440867.1_10 Reverse -342 -361 3.53937 0.283
NP_442029.1_1 Reverse -341 -360 -18.9784 0.277
NP_440253.1_2 Forward -382 -364 13.7855 0.0208
NP_440929.1_8 Reverse -373 -382 7.07956 0.0713
NP_441751.2_8 Reverse -374 -388 -4.03198 0.158
NP_442554.1_8 Forward -381 -371 6.17489 0.125
NP_442554.1_8 Reverse -374 -384 4.3066 0.189
NP_440133.1_10 Reverse -343 -362 7.86593 0.181
NP_441762.1_7 Forward -383 -371 4.16888 0.0533
NP_442142.1_4 Reverse -370 -383 8.86849 0.106
NP_442142.1_4 Forward -355 -342 7.59019 0.135
NP_442142.1_4 Forward -173 -160 4.34528 0.223
NP_442142.1_4 Forward -167 -154 2.87033 0.273
NP_442142.1_4 Forward -385 -372 2.28034 0.295
NP_442292.1_1 Forward -381 -372 -0.0986038 0.239
NP_442292.1_1 Reverse -374 -383 -0.196935 0.239
NP_442476.1_6 Reverse -374 -388 6.98109 0.116
NP_441865.1_3 Forward -75 -57 12.4089 0.287
NP_442301.1_2 Forward -367 -348 7.37347 0.257
NP_441371.1_3 Forward -274 -256 5.42735 0.287
NP_441715.1_4 Reverse -374 -384 9.02648 0.105
NP_440379.1_5 Reverse -342 -361 11.3075 0.122
NP_441468.1_1 Reverse -352 -359 6.72562 0.126
NP_441468.1_1 Forward -381 -374 6.13563 0.209
NP_441468.1_1 Reverse -374 -381 6.0373 0.223
NP_441468.1_1 Reverse -162 -169 4.26735 0.246
NP_441020.2_6 Reverse -371 -388 5.74204 0.291
NP_441015.1_10 Reverse -344 -363 -4.32711 0.202
NP_441015.1_10 Reverse -215 -234 -10.9153 0.289
NP_441673.1_1 Forward -382 -373 1.37636 0.114
NP_441673.1_1 Reverse -373 -382 1.1797 0.163
NP_441731.1_3 Forward -390 -371 -4.91709 0.284
NP_441876.1_9 Forward -232 -222 10.9926 0.28
NP_441637.1_9 Forward -19 -1 -3.52077 0.296
NP_442490.1_10 Forward -362 -344 10.9339 0.21
NP_442868.1_6 Reverse -371 -381 7.35486 0.0808
NP_442868.1_6 Forward -384 -374 0.57002 0.217
NP_442719.1_2 Forward -236 -218 -10.5029 0.276
NP_441612.1_2 Reverse -257 -267 7.19391 0.26
NP_442808.1_1 Reverse -372 -382 9.616 0.0481
NP_442808.1_1 Forward -353 -343 6.0761 0.131
NP_442820.1_4 Reverse -368 -385 11.2486 0.265
NP_442542.1_2 Forward -384 -371 6.21414 0.232
NP_442050.1_5 Reverse -371 -381 12.4676 0.0617
NP_442050.1_8 Reverse -373 -392 12.5288 0.272
NP_442342.1_9 Forward -362 -346 12.8416 0.103
NP_440346.1_6 Reverse -209 -219 15.119 0.231
NP_440558.1_2 Reverse -163 -182 -5.11376 0.253
NP_441036.1_8 Forward -383 -373 6.8632 0.213
NP_441557.1_5 Forward -382 -373 1.08137 0.0794
NP_441557.1_5 Reverse -373 -382 0.589713 0.134
NP_442183.1_1 Forward -382 -368 4.42448 0.261
NP_442183.1_9 Reverse -354 -364 10.9931 0.235
NP_442135.1_8 Forward -393 -375 10.8356 0.207
NP_442347.1_2 Forward -317 -308 11.6028 0.056
NP_442347.1_2 Reverse -374 -383 8.94785 0.0718
NP_440547.1_1 Reverse -27 -46 7.07848 0.294
NP_441633.1_3 Forward -384 -371 -4.01229 0.179
NP_440136.1_2 Forward -381 -374 6.23397 0.171
NP_440136.1_2 Reverse -374 -381 6.13563 0.193
NP_442590.1_10 Reverse -346 -365 6.58763 0.241
NP_442998.1_10 Reverse -375 -382 15.5754 0.0102
NP_440299.1_1 Forward -108 -95 7.98351 0.1
NP_440299.1_3 Reverse -181 -200 10.3242 0.244
NP_442334.1_2 Reverse -217 -234 -14.0225 0.297
NP_441449.1_10 Reverse -367 -385 11.0322 0.295
NP_442961.1_4 Reverse -292 -311 10.8159 0.118
NP_442961.1_4 Reverse -365 -384 9.24257 0.118
NP_441559.1_8 Reverse -378 -392 -5.50694 0.264
NP_440915.1_6 Forward -386 -372 1.27789 0.142
NP_441179.1_9 Reverse -264 -274 15.7125 0.246
NP_440702.1_8 Reverse -366 -385 12.0942 0.217
NP_442386.1_9 Reverse -372 -381 11.9957 0.0754
NP_442386.1_9 Forward -383 -374 5.9975 0.23
NP_440570.1_5 Reverse -341 -360 -1.27885 0.267
NP_441340.1_5 Forward -381 -374 13.5105 0.0314
NP_441340.1_5 Reverse -374 -381 5.84064 0.208
NP_439976.1_5 Forward -98 -84 11.2087 0.268
NP_440161.1_3 Reverse -371 -390 10.2259 0.23
NP_442714.1_10 Forward -288 -269 13.3716 0.247
NP_440211.1_4 Forward -35 -25 16.6963 0.21
NP_440586.1_8 Reverse -374 -381 9.47853 0.146
NP_440586.1_8 Forward -169 -162 9.28187 0.164
NP_440586.1_8 Reverse -152 -159 7.02027 0.279
NP_440586.1_8 Forward -381 -374 5.74197 0.283
NP_440192.1_4 Forward -384 -365 13.5695 0.169
NP_441262.1_3 Forward -382 -375 14.7888 0.0223
NP_443051.1_1 Forward -383 -374 7.47288 0.0571
NP_439996.1_1 Reverse -203 -222 7.7676 0.263
NP_439937.1_9 Forward -383 -366 -8.8116 0.177
NP_440398.1_6 Reverse -366 -385 4.32602 0.275
NP_440439.1_1 Forward -385 -372 -0.177378 0.209
NP_440372.1_2 Forward -381 -374 13.8055 0.0214
NP_440372.1_2 Reverse -374 -381 6.52896 0.188
NP_440574.1_3 Forward -175 -156 -0.39387 0.277
NP_442783.1_10 Reverse -369 -379 16.6958 0.149
NP_440819.1_5 Reverse -256 -264 7.98423 0.228
NP_440316.1_10 Forward -383 -373 11.1898 0.214
NP_441803.1_2 Forward -175 -156 4.03102 0.182
NP_441803.1_2 Forward -387 -368 3.34271 0.191
NP_439977.1_5 Forward -366 -347 3.93269 0.157
NP_442384.1_10 Reverse -373 -386 5.23083 0.134
NP_442384.1_10 Reverse -161 -174 1.78924 0.247
NP_442384.1_10 Forward -318 -305 1.00259 0.271
NP_442114.1_4 Reverse -373 -384 8.4168 0.197
NP_441877.1_7 Forward -387 -368 2.9486 0.218
NP_442790.1_4 Forward -391 -372 1.96607 0.0729
NP_442262.1_10 Reverse -374 -381 13.2155 0.0213
NP_440344.1_10 Reverse -366 -383 9.28195 0.00838
NP_441060.1_1 Reverse -327 -346 13.3499 0.294
NP_441335.1_8 Reverse -342 -361 18.0924 0.111
NP_440562.1_10 Reverse -271 -289 5.23069 0.298
NP_441965.1_10 Reverse -370 -386 8.80999 0.123
NP_442693.1_6 Forward -361 -342 1.67108 0.278
NP_440297.1_9 Reverse -162 -172 -0.511621 0.289
NP_440350.1_5 Reverse -289 -308 -6.68705 0.297
NP_441103.1_9 Forward -232 -222 15.0287 0.192
NP_443036.1_1 Reverse -30 -49 8.35677 0.294
NP_440999.1_1 Forward -363 -344 20.5498 0.0215
NP_440999.1_9 Reverse -100 -114 5.21113 0.113
NP_440999.1_9 Forward -45 -31 3.73617 0.124
NP_440999.1_9 Forward -386 -372 -2.55701 0.27
NP_440888.1_2 Reverse -373 -387 6.68548 0.223
NP_442454.1_2 Reverse -11 -30 10.9334 0.259
NP_442277.1_7 Reverse -238 -254 -0.279674 0.221
NP_442033.1_10 Forward -384 -365 -10.817 0.243
NP_442512.1_3 Forward -256 -237 8.45592 0.291
NP_441543.1_2 Reverse -374 -383 8.65285 0.0968
NP_441543.1_2 Forward -169 -160 8.55452 0.0988
NP_442710.1_7 Reverse -57 -76 3.63766 0.147
NP_441469.1_4 Reverse -357 -376 12.0942 0.249
NP_441469.1_8 Forward -171 -162 11.9961 0.136
NP_441469.1_8 Forward -383 -374 6.39124 0.227
NP_443064.1_6 Forward -282 -272 11.6943 0.124
NP_442578.1_7 Forward -381 -374 6.0373 0.18
NP_441462.1_2 Forward -382 -372 7.55152 0.0543
NP_441621.1_7 Reverse -349 -363 -2.26202 0.188
NP_441621.1_7 Reverse -371 -385 -3.34366 0.188
NP_443062.1_1 Reverse -161 -179 12.8362 0.0725
NP_443062.1_1 Reverse -373 -391 8.83844 0.145
NP_442204.1_1 Forward -386 -375 1.7303 0.266
NP_440516.1_8 Forward -382 -373 18.9776 0.00442
NP_440516.1_8 Reverse -373 -382 5.01461 0.118
NP_441785.1_1 Forward -170 -156 11.6718 0.289
NP_442428.1_5 Reverse -162 -169 11.4455 0.062
NP_442428.1_5 Forward -381 -374 6.13563 0.209
NP_442428.1_5 Reverse -374 -381 6.0373 0.212
NP_440673.1_3 Reverse -375 -382 12.4288 0.0426
NP_441052.1_2 Reverse -373 -383 1.25834 0.249
NP_441052.1_2 Forward -382 -372 0.668351 0.256
NP_442219.1_9 Forward -381 -372 8.65285 0.0681
NP_440436.1_4 Reverse -374 -383 8.55409 0.0997
NP_441884.1_8 Reverse -298 -317 -13.2752 0.278
NP_441719.1_4 Forward -381 -374 6.82395 0.0855
NP_441719.1_4 Reverse -374 -381 6.52896 0.188
NP_441733.1_10 Reverse -370 -383 8.27909 0.14
NP_441004.1_1 Reverse -345 -364 -10.227 0.219
NP_440129.1_10 Forward -389 -375 4.03116 0.185
NP_442206.1_10 Reverse -373 -388 8.63302 0.167
NP_440593.1_3 Forward -307 -288 1.47442 0.19
NP_442689.1_8 Forward -74 -57 -6.451 0.285
NP_441409.1_6 Reverse -367 -386 -14.9469 0.27
NP_441477.1_5 Reverse -339 -358 5.99764 0.292
NP_441477.1_9 Forward -362 -343 13.7658 0.291
NP_440431.1_4 Reverse -87 -106 -10.0748 0.295
NP_441031.1_8 Forward -109 -90 9.63589 0.137
NP_442335.1_7 Reverse -374 -388 16.2235 0.146
NP_441570.1_1 Forward -170 -152 -16.1071 0.238
NP_441078.1_4 Forward -382 -373 0.196389 0.205
NP_441078.1_4 Reverse -373 -382 -0.000272808 0.205
NP_442729.1_5 Reverse -342 -352 8.63316 0.248
NP_440793.1_1 Forward -96 -82 18.6818 0.147
NP_440526.1_3 Forward -381 -370 1.53316 0.267
NP_441432.1_8 Forward -383 -374 5.50626 0.151
NP_441432.1_9 Reverse -283 -296 8.30749 0.29
NP_442320.1_8 Reverse -367 -381 -2.95034 0.1
NP_440497.1_6 Forward -387 -368 -6.58872 0.264
NP_442797.1_1 Forward -316 -297 -4.03212 0.286
NP_441131.1_5 Reverse -166 -185 1.76941 0.261
NP_442274.1_8 Forward -222 -204 15.9557 0.227
NP_442751.1_1 Forward -368 -349 16.3393 0.222
NP_442400.1_1 Reverse -32 -51 -4.52377 0.266
NP_440713.1_4 Reverse -299 -318 2.45773 0.262
NP_442489.1_7 Forward -382 -373 0.688044 0.152
NP_442489.1_7 Reverse -373 -382 0.688044 0.152
NP_442079.1_7 Forward -381 -362 0.294447 0.286
NP_440559.1_1 Forward -381 -372 6.48957 0.134
NP_442346.1_5 Reverse -160 -170 8.04317 0.149
NP_440545.1_3 Reverse -369 -386 -6.84433 0.289
NP_441126.1_6 Reverse -222 -236 14.895 0.256
NP_442603.1_7 Forward -382 -368 12.9786 0.0925
NP_441888.1_7 Forward -387 -373 3.53951 0.225
NP_441833.1_4 Reverse -374 -381 6.52896 0.0924
NP_441833.1_4 Forward -381 -374 6.23397 0.163
NP_441329.1_6 Reverse -56 -75 1.28872 0.24
NP_442162.1_9 Forward -381 -374 12.9205 0.0282
NP_442162.1_9 Reverse -374 -381 12.9205 0.0282
NP_440671.1_4 Reverse -155 -169 9.2427 0.184
NP_442821.1_3 Reverse -207 -226 21.4356 0.00922
NP_440772.1_8 Reverse -367 -386 9.3409 0.253
NP_442140.1_3 Reverse -374 -384 12.1731 0.0637
NP_442140.1_3 Forward -381 -371 6.07655 0.184
NP_442140.1_3 Reverse -344 -354 4.0116 0.265
NP_440875.1_9 Reverse -375 -385 17.327 0.0126
NP_441813.1_5 Forward -384 -374 9.7148 0.0241
NP_441813.1_5 Reverse -371 -381 5.5849 0.118
NP_439901.1_1 Reverse -369 -388 4.12936 0.235
NP_440590.1_4 Forward -381 -368 12.9006 0.013
NP_440567.1_1 Forward -381 -367 1.27789 0.211
NP_442497.1_10 Reverse -374 -383 0.589713 0.153
NP_440821.1_4 Reverse -371 -381 5.78156 0.106
NP_440821.1_4 Forward -384 -374 0.471689 0.174
NP_441239.1_9 Reverse -371 -383 8.10212 0.142
NP_442691.1_2 Forward -368 -349 6.19431 0.216
NP_441892.1_1 Reverse -152 -169 -3.5994 0.244
NP_440219.1_2 Forward -296 -278 26.6668 0.00208
NP_441541.1_1 Reverse -71 -89 -4.29515 0.273
NP_440949.1_7 Forward -390 -371 10.4217 0.233
NP_440546.1_4 Forward -382 -372 12.1791 0.0679
NP_440546.1_4 Reverse -373 -383 6.55553 0.291
NP_440462.1_6 Forward -384 -374 7.74818 0.0699
NP_440462.1_6 Reverse -371 -381 6.37155 0.118
NP_440868.1_4 Forward -386 -374 17.0502 0.0124
NP_441474.1_1 Forward -362 -343 -1.57461 0.262
NP_442402.1_2 Forward -269 -255 11.012 0.291
NP_442402.1_4 Forward -274 -255 -7.76943 0.278
NP_442882.1_7 Forward -389 -375 11.2087 0.261
NP_442039.1_4 Forward -381 -374 11.6422 0.0747
NP_442039.1_7 Forward -38 -28 6.76487 0.299
NP_442039.1_10 Forward -334 -316 16.9313 0.209
NP_442679.1_1 Reverse -50 -69 -3.54046 0.259
NP_442837.1_3 Forward -381 -374 6.0373 0.25
NP_442837.1_3 Reverse -374 -381 6.0373 0.25
NP_442053.1_1 Reverse -373 -382 14.4544 0.0114
NP_442053.1_1 Forward -382 -373 7.86621 0.0863
NP_440505.1_3 Forward -384 -374 14.3364 0.0224
NP_440505.1_3 Forward -194 -184 4.50326 0.284
NP_442532.1_1 Reverse -55 -69 11.0854 0.23
NP_440914.1_1 Forward -382 -372 12.1284 0.0654
NP_441011.1_8 Reverse -374 -383 7.07956 0.179
NP_442533.1_1 Reverse -346 -365 -15.2418 0.253
NP_442533.1_6 Reverse -373 -382 4.42462 0.179
NP_442533.1_6 Forward -170 -161 3.04799 0.228
NP_442541.1_10 Forward -229 -215 4.71887 0.248
NP_442541.1_10 Reverse -31 -45 2.5556 0.255
NP_441482.1_7 Forward -388 -374 -3.147 0.11
NP_439944.1_9 Forward -235 -225 8.4365 0.108
NP_441028.1_6 Forward -264 -254 7.74772 0.218
NP_441028.1_6 Forward -232 -222 5.38779 0.255
NP_441028.1_6 Forward -233 -223 3.71617 0.281
NP_441028.1_6 Forward -265 -255 3.51951 0.292
NP_440116.1_8 Forward -381 -362 12.6841 0.0278
NP_441527.1_4 Reverse -214 -233 -8.45146 0.244
NP_441527.1_4 Reverse -56 -75 -9.50187 0.259
NP_441527.1_4 Reverse -213 -232 -11.4117 0.282
NP_440115.1_6 Forward -385 -375 7.64985 0.146
NP_440007.1_9 Forward -386 -372 4.12949 0.267
NP_440007.1_9 Reverse -157 -171 1.37622 0.285
NP_439965.1_7 Forward -395 -376 10.0276 0.294
NP_441106.1_1 Forward -383 -374 8.45619 0.0548
NP_439903.1_6 Forward -339 -320 1.47364 0.245
NP_001035870.1_3 Forward -393 -374 1.0811 0.163
NP_441286.1_1 Forward -383 -371 1.7106 0.0803
NP_440670.1_8 Forward -382 -373 8.75118 0.0606
NP_440670.1_8 Reverse -373 -382 6.19458 0.124
NP_441930.1_3 Reverse -57 -76 7.48206 0.263
NP_440886.1_7 Forward -383 -373 6.86274 0.113
NP_440886.1_7 Reverse -372 -382 6.66608 0.115
NP_442614.1_2 Forward -382 -368 6.29277 0.291
NP_440907.2_8 Reverse -374 -384 6.17443 0.178
NP_441463.1_3 Forward -180 -161 -5.21209 0.222
NP_441626.1_2 Forward -381 -374 12.2322 0.0511
NP_441626.1_2 Reverse -374 -381 5.93897 0.231
NP_442794.1_1 Reverse -369 -381 2.49725 0.288
NP_441962.1_4 Reverse -368 -387 -0.983855 0.117
NP_441962.1_4 Forward -46 -27 -13.2752 0.271
NP_441431.1_2 Forward -385 -371 11.9953 0.128
NP_440634.1_10 Forward -345 -326 8.94676 0.221
NP_441993.1_1 Reverse -343 -362 0.777198 0.292
NP_442437.1_3 Reverse -375 -394 14.7483 0.106
NP_441510.2_7 Reverse -244 -258 9.6354 0.281
NP_440293.1_10 Reverse -351 -370 1.57275 0.219
NP_440766.1_4 Reverse -369 -383 8.06273 0.0871
NP_441237.1_9 Forward -381 -371 11.7798 0.156
NP_440457.1_1 Forward -386 -374 2.79224 0.205
NP_442680.1_5 Reverse -78 -97 1.73297 0.237
NP_440054.1_4 Forward -298 -279 13.8641 0.148
NP_442509.1_9 Reverse -373 -383 9.71433 0.192
NP_441765.1_4 Reverse -205 -224 11.8975 0.183
NP_440554.1_4 Reverse -374 -384 13.5497 0.0245
NP_441885.1_5 Forward -382 -372 9.51814 0.0206
NP_442341.1_7 Forward -383 -369 7.17775 0.11
NP_442341.1_7 Forward -283 -269 2.16287 0.267
NP_442341.1_9 Forward -384 -370 9.73373 0.144
NP_441173.1_9 Forward -264 -256 9.75379 0.284
NP_440119.1_2 Reverse -353 -371 3.26407 0.299
NP_442395.2_9 Forward -281 -265 12.2516 0.279
NP_442534.1_7 Forward -360 -341 15.9291 0.163
NP_440191.1_4 Forward -263 -253 15.0872 0.254
NP_440423.1_6 Forward -390 -371 -15.8318 0.229
NP_443000.1_7 Reverse -159 -169 3.81494 0.226
NP_443000.1_7 Forward -384 -374 1.84832 0.228
NP_440507.2_3 Reverse -342 -361 12.7816 0.145
NP_440275.1_3 Forward -384 -374 12.8614 0.0299
NP_441359.1_5 Forward -385 -366 0.687771 0.29
NP_442686.1_7 Forward -75 -56 14.3693 0.259
NP_441207.1_7 Reverse -55 -69 11.5789 0.241
NP_439962.1_4 Reverse -343 -362 -3.93378 0.262
NP_440175.1_7 Forward -196 -178 10.6318 0.25
NP_440216.1_1 Reverse -373 -387 -4.52363 0.111
NP_440216.1_1 Reverse -343 -357 -12.5868 0.288
NP_440172.1_1 Forward -382 -372 6.27322 0.107
NP_441226.1_7 Forward -381 -374 12.7234 0.0312
NP_441226.1_7 Reverse -374 -381 11.5435 0.0757
NP_441111.1_7 Reverse -374 -382 8.86921 0.0589
NP_441766.1_2 Reverse -373 -382 14.7494 0.00772
NP_441766.1_9 Reverse -344 -363 -2.16383 0.276
NP_442969.1_4 Reverse -380 -399 5.30933 0.274
NP_442417.1_5 Reverse -373 -387 8.06273 0.164
NP_440416.1_9 Forward -377 -358 -16.3235 0.212
NP_440072.1_5 Reverse -345 -363 -2.73412 0.271
NP_442154.1_1 Reverse -343 -361 0.314141 0.103
NP_442046.1_8 Forward -169 -150 12.1925 0.293
NP_440261.1_5 Reverse -374 -387 -3.02898 0.108
NP_440261.1_5 Reverse -201 -214 -4.79893 0.17
NP_440988.1_10 Reverse -371 -385 5.18926 0.243
NP_440988.1_10 Reverse -165 -179 4.89883 0.249
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTCCTTCTACTAATCCCGGCGATCGGGACTGAAACACGCCGCCAGCCCACCAGCGCCAGTTAACATCATCTCCAAGTCTAAACTGAACCCCACCAGTAGCGCTAAAAACAGCTATTTGAGAATCAGCCATGATTGTTTTCCCCGGTTGCAGTTTTTAGTTTAGAGCTTTCTCCCCTGTCCACTTTTTCGGGGCCACCTTACAGCCCTGGTAATAGGATTTGCTTCTCACTGCCATCACTATTGATGGGACACTCCACTCACGTAGTTACAGAAACCTCCCTTGTTAGGAGACCACTGCCATATATTTTGCTTTTTATCAAACGAAATTACTGCTTATATTTTTTGACTCTAAAACAGCAGTCACTGGCACAATTAGATTAGGTTTATTGTTATATTCCT

CDS

ATGCCTAAACTTAAAAAGCTTACTCCCAAGGCCGAAGCCCAATCTGAGTCCACCAGTCTAGACCGTCTAAGGGAACTGGCCCAAGACCCCAAACTGGCCAAGCTAGTAGCGGCTAATTATATGGCCCCACCGGATTTGTTGGAGGAGCTGAGCCACACCAGCGACAAGCCCCTGCTTAAAGCTCTGGTCAGTAATCCCAATACGCCGACGGAGGTGTTACTAAAACTGGGTTCCCTGTTCCCGGAGCAGTTGTTGGACAATCCGGTGTTCGATATTTTATTGATCGAAAATCCCAATCTGTTGTCGGAGTTTCCCAAGTCTTCCCTCAATAGTTTGCTGAAGCGGGAAGTGGCTCCGGTTAGTTTTCTGCGCTGGGCGGCTACCAATGGTGATGAAAATACGTTGCAGTCGTTGTTGATTAACCCGAATGTGCCGGCGGAGGTGGTCCAGGGGTTGACCGAGCATGGGGATTGGGATGTGGTTATAGCGGCCAAGCTCCATGTTAATAGTGGAGTAGAGGTCGAACCAAGCTGGGAAGAGCAGGGGTTAAAGCGGCGAGTACCGGAGAAAGAAAATGAACGGGTAACGGATTTTTTTAGGTATTTCTGGCCGGAGTTAAAGGATTTAGTTTGTTTGAATTACTGGATACGCAGGCGCATAGCATCGCATCCGAATTGTCCGGTGGATGTACTGGCTCAACTCGCACTAGATGATGATTTAGATGTACGCATTTGTGTAGCGAAGAATCCAAATTGTCCGGTGGAGCTAAGGCTGAAGCTACTGACCCAACTTGCACTAGATGATGGTTGCTGGGTACGCATTTGTGTAGCGGAGAATCCAAATTGTCCGGTGGATGTACTGACCCAATTTGCACTAGATAATAATTCATATGTGCGCAGGGACGTGGCATCGAATCTGAATTGCCCGGTAGAGGTACTGACCCAACTTGCACTAGATGATGATTACAGGGTACGCAGGGACGTGGCATCGAATCCAAATTGCCCGGTGGATGTACTGACCCAACTTGCACTAGATAATAATTCAGATGTACGCATAGGCATAACATTGAATCTGAATTGCCCGGTGGATGTACTGACCCAACTTGCACTAGATAATAATTCAGATGTACGCATAGGCATAACATTGAATCCGAATTGTCCAGTGGAGCTAAGGTTGAAGCTACTGACCCAACTTGCACTAGATAATAATTCAGATGTACGCATAGACGTAACATTGAATCCGAATTGTCCAGTGGAGGTACTGACCCAACTTGCATTAGATGATTCATATGTGCGCAGGGGCATAGCATTGAATCTGAATTGCCCGGTGGAGGTACTGACCCAACTTGCATTAGATAATAATTCAGATGTACGCAGGGGCGTGGCATCGAATCCGAATTGCCCGGTGGAGGTACTGACCCAACTTGCATTAGATAATAATTCAGATGTACGCAGGGGCGTGGCATCGAATCCGAATTGCCCGGTGGAGGTACTGACCCAACTTGCATTAGATAATAATTCAGATGTACGCAGGGGCGTGGCATCGAATCCGAATTGCCCGGTGGAGGTACTGACCCAACTTGCATTAGATAATAATTCAGATGTACGCAGGGGCGTGGCATCGAATCTGAATTGCCCACCCGCAGATTTAATCGTGGATTCCTTCTTGGAACAGTTCACCAAGAGTTCTATTCCCACCTACCCTCGTCTCATTGCCTTCCGTTCTCCCCATTGTCCCACCGGTGCCCTTGCCAAAAACTACCGCAGTCGGGATTGGCTAGAACGGTGTGCCATAGCAGAACACCCCAAAACCCCCGATGCCACTCTGCAAAAACTATTGCTGGATGGGAATCGTCTCGTACGACAAAAAGCCCAGGCTAATCTGGAGCAACGACAAAACATCATCCCAGAGGATTAA

Protein

No sequence available