Your browser is old and dusty. Try Google Chrome!

Details for slr7014

ORF slr7014
Accession NP_942302.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -43 -57 9.43936 0.0734
NP_441061.1_2 Reverse -262 -276 1.27789 0.192
NP_440795.1_7 Forward -269 -262 14.6904 0.0123
NP_440795.1_7 Reverse -262 -269 14.6904 0.0123
NP_440795.1_7 Forward -50 -43 14.6904 0.0123
NP_440795.1_7 Reverse -43 -50 14.6904 0.0123
NP_441418.1_6 Reverse -42 -61 5.99764 0.00793
NP_440815.1_5 Forward -134 -115 9.24257 0.228
NP_442291.1_5 Reverse -41 -57 -3.28472 0.239
NP_440295.1_2 Reverse -29 -48 5.99764 0.283
NP_441453.1_4 Reverse -261 -269 16.539 0.00633
NP_441453.1_4 Reverse -42 -50 16.539 0.00633
NP_441453.1_4 Forward -270 -262 16.539 0.00633
NP_441453.1_4 Forward -51 -43 16.539 0.00633
NP_442151.1_6 Forward -270 -256 17.9942 0.00866
NP_442151.1_6 Forward -51 -37 17.3058 0.0111
NP_442151.1_6 Reverse -261 -275 12.4876 0.0722
NP_440561.1_6 Reverse -256 -275 14.2574 0.298
NP_441818.1_1 Forward -269 -258 14.4145 0.0502
NP_441818.1_1 Reverse -43 -54 9.30127 0.246
NP_441818.1_6 Forward -277 -263 11.701 0.253
NP_440226.1_1 Forward -101 -82 4.12936 0.202
NP_440226.1_1 Reverse -261 -280 3.6377 0.218
NP_440226.1_1 Reverse -42 -61 2.55606 0.259
NP_442173.1_1 Forward -269 -261 15.4574 0.00633
NP_442173.1_1 Forward -50 -42 15.4574 0.00633
NP_442173.1_1 Reverse -262 -270 15.4574 0.00633
NP_442173.1_1 Reverse -43 -51 15.4574 0.00633
NP_442173.1_1 Reverse -125 -133 5.72262 0.203
NP_442752.1_4 Forward -270 -263 13.8055 0.0199
NP_442752.1_4 Reverse -261 -268 13.8055 0.0199
NP_442752.1_4 Forward -51 -44 13.8055 0.0199
NP_442752.1_4 Reverse -42 -49 13.8055 0.0199
NP_443027.1_4 Forward -272 -262 15.3197 0.0437
NP_443027.1_4 Forward -53 -43 14.828 0.0437
NP_443027.1_4 Reverse -259 -269 6.46988 0.275
NP_441812.1_1 Forward -194 -180 14.9452 0.203
NP_441812.1_3 Reverse -260 -274 6.88276 0.287
NP_442975.1_10 Forward -55 -41 13.372 0.0459
NP_442975.1_10 Reverse -257 -271 12.5853 0.0477
NP_442975.1_10 Forward -225 -211 3.44058 0.259
NP_442975.1_10 Forward -274 -260 2.5556 0.273
NP_442975.1_10 Reverse -38 -52 1.86729 0.29
NP_440784.1_7 Forward -269 -262 15.9687 0.0123
NP_440784.1_7 Reverse -262 -269 15.9687 0.0123
NP_440784.1_7 Forward -50 -43 15.9687 0.0123
NP_440784.1_7 Reverse -43 -50 15.9687 0.0123
NP_442909.1_7 Reverse -43 -57 13.5686 0.12
NP_442909.1_7 Reverse -262 -276 13.4703 0.126
NP_440061.1_9 Forward -53 -39 9.24208 0.149
NP_441145.1_1 Reverse -41 -60 8.06259 0.254
NP_440878.1_9 Reverse -251 -270 2.26107 0.177
NP_442062.1_8 Reverse -42 -52 19.4496 0.000558
NP_442062.1_8 Forward -270 -260 17.6796 0.00193
NP_442062.1_8 Forward -51 -41 17.6796 0.00193
NP_442062.1_8 Reverse -261 -271 10.3048 0.0493
NP_441859.1_3 Forward -271 -252 7.07848 0.165
NP_441859.1_3 Forward -225 -206 2.75194 0.257
NP_442972.1_2 Forward -342 -328 16.2235 0.136
NP_440304.1_4 Forward -272 -262 18.9579 0.00406
NP_440304.1_4 Reverse -259 -269 17.9746 0.00654
NP_440304.1_4 Forward -53 -43 10.8948 0.051
NP_440304.1_4 Reverse -40 -50 9.91146 0.051
NP_442242.1_4 Forward -269 -262 14.3954 0.0124
NP_442242.1_4 Reverse -262 -269 14.3954 0.0124
NP_442242.1_4 Forward -50 -43 14.3954 0.0124
NP_442242.1_4 Reverse -43 -50 14.3954 0.0124
NP_440044.1_8 Reverse -43 -62 6.29264 0.092
NP_440044.1_8 Reverse -262 -281 4.71934 0.11
NP_441208.1_9 Reverse -258 -272 16.1259 0.0671
NP_441208.1_9 Forward -273 -259 8.84938 0.219
NP_441208.1_9 Reverse -39 -53 6.09611 0.253
NP_440370.1_10 Forward -279 -260 10.6192 0.2
NP_440370.1_10 Reverse -33 -52 7.47261 0.257
NP_442276.1_2 Reverse -249 -268 3.24438 0.299
NP_442375.1_6 Forward -203 -184 14.4541 0.294
NP_442110.1_7 Reverse -261 -275 8.94771 0.0795
NP_442110.1_7 Reverse -42 -56 2.45787 0.222
NP_442110.1_7 Forward -270 -256 1.27789 0.233
NP_440330.1_2 Reverse -380 -399 11.4058 0.291
NP_441083.1_5 Forward -270 -260 19.3512 0.000718
NP_441083.1_5 Forward -51 -41 19.3512 0.000718
NP_441083.1_5 Reverse -42 -52 11.3864 0.0159
NP_441083.1_5 Reverse -261 -271 11.2881 0.0159
NP_439957.1_6 Forward -344 -325 13.6675 0.152
NP_442827.1_8 Reverse -253 -272 11.7983 0.05
NP_442827.1_8 Forward -278 -259 11.5033 0.0523
NP_442827.1_8 Forward -59 -40 -2.95123 0.294
NP_441434.1_1 Reverse -175 -189 8.98786 0.251
NP_441434.1_7 Forward -268 -254 5.99778 0.225
NP_441141.1_2 Reverse -41 -60 12.29 0.288
NP_441738.1_2 Forward -268 -261 15.28 0.0102
NP_441738.1_2 Reverse -263 -270 15.28 0.0102
NP_441738.1_2 Forward -49 -42 15.28 0.0102
NP_441738.1_2 Reverse -44 -51 15.28 0.0102
NP_441558.1_5 Reverse -259 -278 13.1758 0.0619
NP_441558.1_5 Forward -272 -253 11.4058 0.0814
NP_441558.1_5 Forward -53 -34 4.12936 0.29
NP_440209.1_1 Reverse -261 -269 18.1123 0.00295
NP_440209.1_1 Reverse -42 -50 18.1123 0.00295
NP_440209.1_1 Forward -270 -262 18.1123 0.00295
NP_440209.1_1 Forward -51 -43 18.1123 0.00295
NP_440655.1_2 Reverse -262 -281 3.73603 0.293
NP_442889.1_1 Forward -209 -190 -11.0136 0.217
NP_442889.1_1 Reverse -187 -206 -13.6686 0.262
NP_442889.1_8 Reverse -39 -53 7.47213 0.149
NP_442889.1_8 Forward -54 -40 4.12889 0.27
NP_440447.1_6 Reverse -253 -271 7.4923 0.14
NP_440447.1_6 Reverse -34 -52 5.13236 0.156
NP_441713.1_1 Reverse -255 -274 -2.45882 0.113
NP_441713.1_1 Reverse -36 -55 -13.0786 0.252
NP_440178.1_7 Reverse -260 -279 17.404 0.0016
NP_440178.1_7 Reverse -41 -60 -11.5053 0.0945
NP_440178.1_7 Forward -271 -252 -20.65 0.196
NP_441716.1_1 Reverse -42 -56 12.9793 0.0689
NP_441716.1_1 Forward -270 -256 10.6193 0.0936
NP_441716.1_1 Forward -51 -37 3.93283 0.259
NP_442111.1_4 Reverse -41 -55 14.9459 0.0259
NP_442111.1_4 Forward -271 -257 10.4227 0.0544
NP_442111.1_4 Forward -52 -38 10.1277 0.0562
NP_442111.1_4 Reverse -260 -274 8.16106 0.0794
NP_441163.1_1 Reverse -253 -270 5.44632 0.274
NP_441163.1_9 Forward -60 -41 12.7825 0.272
NP_440906.1_5 Forward -269 -262 15.8704 0.0124
NP_440906.1_5 Reverse -262 -269 15.8704 0.0124
NP_440906.1_5 Forward -50 -43 15.8704 0.0124
NP_440906.1_5 Reverse -43 -50 15.8704 0.0124
NP_442596.1_9 Forward -396 -377 15.5357 0.25
NP_440747.1_10 Reverse -39 -51 5.44718 0.0137
NP_440747.1_10 Reverse -258 -270 -1.92764 0.0192
NP_440747.1_10 Forward -273 -261 -1.92764 0.0192
NP_440747.1_10 Forward -54 -42 -2.02597 0.0196
NP_441130.1_10 Reverse -259 -273 15.8309 0.0282
NP_441130.1_10 Forward -272 -258 10.521 0.112
NP_441486.1_1 Forward -54 -40 22.714 0.00162
NP_441486.1_1 Reverse -39 -53 2.35953 0.0844
NP_441486.1_1 Forward -273 -259 -2.85201 0.175
NP_441880.2_10 Forward -269 -251 9.16393 0.259
NP_442634.1_4 Reverse -259 -273 12.3893 0.0401
NP_442634.1_4 Forward -272 -258 4.12949 0.0841
NP_442634.1_4 Reverse -40 -54 -3.63866 0.161
NP_441265.1_3 Reverse -255 -269 5.1128 0.181
NP_440403.1_4 Forward -60 -41 3.34271 0.126
NP_440403.1_4 Reverse -252 -271 -9.53865 0.278
NP_442848.1_1 Forward -57 -43 17.2075 0.0143
NP_442848.1_1 Forward -276 -262 6.48943 0.0791
NP_442848.1_1 Reverse -255 -269 6.3911 0.0791
NP_442848.1_9 Reverse -36 -55 4.12936 0.208
NP_441012.1_4 Reverse -44 -57 10.8357 0.26
NP_441012.1_4 Forward -399 -386 6.31247 0.282
NP_443018.1_3 Forward -269 -262 14.8871 0.0123
NP_443018.1_3 Reverse -262 -269 14.8871 0.0123
NP_443018.1_3 Forward -50 -43 14.8871 0.0123
NP_443018.1_3 Reverse -43 -50 14.8871 0.0123
NP_443018.1_3 Forward -150 -143 8.20058 0.153
NP_441316.1_7 Reverse -259 -274 14.3362 0.0486
NP_441634.1_8 Reverse -259 -273 -3.54032 0.295
NP_441634.1_8 Reverse -40 -54 -3.63866 0.295
NP_441634.1_8 Forward -272 -258 -4.22864 0.295
NP_440376.1_1 Forward -270 -261 19.4693 0.000692
NP_440376.1_1 Reverse -261 -270 19.4693 0.000692
NP_440376.1_1 Forward -51 -42 19.4693 0.000692
NP_440376.1_1 Reverse -42 -51 19.4693 0.000692
NP_441588.1_4 Forward -49 -39 6.96153 0.178
NP_442687.1_7 Reverse -260 -270 18.5646 0.0028
NP_442687.1_7 Reverse -41 -51 18.5646 0.0028
NP_442687.1_7 Forward -52 -42 15.8113 0.0125
NP_442687.1_7 Forward -271 -261 9.02648 0.0994
NP_442485.1_3 Forward -62 -43 5.01433 0.17
NP_442485.1_3 Reverse -40 -59 -2.16383 0.262
NP_442958.1_3 Forward -281 -262 8.45592 0.146
NP_440042.1_2 Reverse -251 -270 2.3594 0.195
NP_441422.1_7 Reverse -259 -276 4.07041 0.107
NP_442658.1_1 Reverse -259 -269 17.6791 0.00565
NP_442658.1_1 Forward -272 -262 15.9091 0.00966
NP_442658.1_1 Forward -53 -43 15.9091 0.00966
NP_442658.1_1 Reverse -40 -50 14.8275 0.0188
NP_441855.2_4 Forward -59 -40 10.3907 0.255
NP_442205.1_9 Forward -276 -260 15.7915 0.0259
NP_440656.1_8 Forward -62 -43 6.4893 0.0791
NP_441414.1_9 Forward -51 -32 -1.47551 0.101
NP_441414.1_9 Reverse -261 -280 -8.752 0.245
NP_441414.1_9 Forward -270 -251 -9.34199 0.259
NP_440720.1_1 Reverse -250 -269 3.34271 0.26
NP_441487.1_9 Reverse -260 -279 1.17943 0.208
NP_442937.1_5 Reverse -37 -56 7.66927 0.244
NP_442937.1_5 Reverse -177 -196 5.89931 0.295
NP_441958.1_5 Forward -271 -261 21.2195 0.000805
NP_441958.1_5 Reverse -260 -270 20.5312 0.000966
NP_441958.1_5 Reverse -41 -51 20.5312 0.000966
NP_441958.1_5 Forward -52 -42 12.2714 0.00183
NP_442836.1_5 Reverse -255 -274 2.45773 0.259
NP_440203.1_5 Reverse -264 -274 9.51767 0.254
NP_440203.1_5 Forward -200 -190 8.73102 0.288
NP_439905.1_1 Reverse -262 -275 19.0955 0.0201
NP_440984.1_7 Forward -275 -261 12.9793 0.121
NP_441162.1_3 Reverse -24 -43 8.45592 0.261
NP_439990.1_5 Reverse -256 -269 11.9173 0.126
NP_439990.1_5 Reverse -37 -50 11.1307 0.128
NP_442376.1_2 Forward -275 -256 -4.81876 0.257
NP_442911.1_2 Forward -61 -42 13.5691 0.0118
NP_442911.1_2 Reverse -32 -51 5.70265 0.0321
NP_442911.1_2 Reverse -251 -270 -2.75381 0.102
NP_442911.1_2 Forward -280 -261 -5.40875 0.158
NP_441580.1_6 Forward -62 -43 -6.49039 0.235
NP_440153.1_5 Reverse -43 -57 16.9125 0.0551
NP_440153.1_5 Reverse -262 -276 5.89945 0.191
NP_443055.1_10 Forward -260 -247 21.7504 0.0513
NP_440993.1_2 Forward -275 -259 5.36841 0.234
NP_440993.1_2 Reverse -256 -272 4.28677 0.256
NP_440934.1_2 Reverse -188 -207 5.70265 0.239
NP_440615.1_2 Forward -386 -367 4.42435 0.296
NP_441099.1_5 Reverse -32 -51 0.294447 0.0807
NP_441099.1_5 Reverse -251 -270 -8.94866 0.209
NP_442002.1_9 Reverse -260 -267 14.1004 0.074
NP_442002.1_9 Reverse -41 -48 14.1004 0.074
NP_442002.1_9 Reverse -193 -200 12.4288 0.185
NP_442002.1_9 Forward -52 -45 10.7572 0.185
NP_441294.1_7 Reverse -257 -271 12.6102 0.0916
NP_441294.1_7 Forward -55 -41 12.0343 0.117
NP_441646.1_1 Reverse -254 -273 6.78429 0.17
NP_441646.1_1 Reverse -35 -54 4.52268 0.191
NP_442438.1_10 Forward -56 -42 10.226 0.0568
NP_442438.1_10 Forward -275 -261 4.62115 0.144
NP_442438.1_10 Reverse -256 -270 0.196253 0.236
NP_441000.1_6 Reverse -41 -55 5.1128 0.0933
NP_441000.1_6 Reverse -260 -274 -4.7203 0.251
NP_442771.1_1 Forward -272 -254 -4.70074 0.166
NP_440147.1_4 Forward -272 -259 13.3923 0.0326
NP_440147.1_4 Reverse -259 -272 12.8023 0.0326
NP_440147.1_4 Reverse -40 -53 11.9173 0.0326
NP_440147.1_4 Forward -53 -40 3.75586 0.181
NP_441175.1_7 Forward -51 -32 4.916 0.294
NP_441550.1_8 Reverse -259 -269 19.8424 0.00352
NP_441550.1_8 Reverse -40 -50 17.6791 0.00754
NP_441550.1_8 Forward -272 -262 17.4824 0.00754
NP_441550.1_8 Forward -53 -43 6.0761 0.214
NP_441916.1_7 Reverse -261 -271 18.9579 0.00144
NP_441916.1_7 Reverse -42 -52 18.4663 0.00144
NP_441916.1_7 Forward -270 -260 16.893 0.00407
NP_441916.1_7 Forward -51 -41 16.893 0.00407
NP_440465.1_10 Reverse -212 -231 0.982764 0.284
NP_441041.1_4 Reverse -261 -280 -10.0303 0.227
NP_441041.1_4 Forward -270 -251 -12.0953 0.258
NP_441041.1_4 Forward -51 -32 -12.3902 0.265
NP_441041.1_7 Reverse -258 -270 21.8971 0.000853
NP_441041.1_7 Reverse -39 -51 11.8878 0.0689
NP_441041.1_7 Forward -273 -261 8.97244 0.125
NP_442004.1_6 Reverse -261 -275 15.5359 0.0577
NP_442004.1_6 Reverse -42 -56 3.14618 0.248
NP_441725.1_1 Forward -190 -171 15.3391 0.19
NP_441725.1_5 Forward -269 -259 18.7612 0.0119
NP_441725.1_5 Forward -50 -40 11.7798 0.0247
NP_441725.1_5 Reverse -43 -53 11.2881 0.0247
NP_441725.1_5 Reverse -262 -272 8.92815 0.0553
NP_439966.1_7 Forward -53 -43 18.4657 0.00473
NP_439966.1_7 Forward -272 -262 13.8442 0.0234
NP_439966.1_7 Reverse -259 -269 8.14104 0.14
NP_439966.1_9 Forward -272 -263 0.983037 0.253
NP_439966.1_9 Forward -53 -44 0.983037 0.253
NP_439966.1_9 Reverse -259 -268 0.983037 0.253
NP_440202.1_8 Forward -59 -40 15.4476 0.23
NP_442941.1_3 Reverse -43 -53 11.4848 0.0116
NP_442941.1_3 Reverse -262 -272 10.9931 0.0116
NP_442941.1_3 Forward -50 -40 2.53664 0.14
NP_442941.1_3 Forward -269 -259 2.43831 0.14
NP_440674.1_4 Reverse -27 -46 21.1406 0.0766
NP_440289.1_2 Forward -54 -41 14.7689 0.0107
NP_440289.1_2 Reverse -258 -271 14.1789 0.0118
NP_440289.1_2 Forward -273 -260 5.13249 0.0636
NP_440289.1_2 Reverse -39 -52 -2.34066 0.254
NP_440983.1_5 Reverse -264 -283 -3.04881 0.233
NP_442281.1_1 Forward -56 -42 11.7987 0.0437
NP_442281.1_1 Reverse -256 -270 10.2254 0.0608
NP_442281.1_1 Forward -275 -261 4.42388 0.195
NP_442281.1_1 Reverse -37 -51 4.22722 0.203
NP_441334.1_7 Reverse -259 -278 -11.2103 0.12
NP_441334.1_7 Forward -272 -253 -19.4701 0.275
NP_442256.1_2 Reverse -259 -277 -6.76569 0.214
NP_440437.1_1 Reverse -255 -274 7.37428 0.066
NP_440437.1_1 Forward -43 -24 -1.96717 0.207
NP_442012.1_1 Forward -276 -257 12.5858 0.067
NP_442012.1_1 Forward -57 -38 11.1109 0.0769
NP_441457.1_7 Reverse -259 -278 8.84924 0.144
NP_440498.1_1 Forward -279 -261 -2.63579 0.244
NP_440498.1_1 Forward -60 -42 -3.42244 0.261
NP_441644.1_6 Reverse -261 -271 19.0557 0.000803
NP_441644.1_6 Forward -270 -260 15.7125 0.0048
NP_441644.1_6 Forward -51 -41 15.7125 0.0048
NP_441644.1_6 Reverse -42 -52 10.1076 0.0628
NP_443049.1_6 Forward -285 -275 10.9578 0.292
NP_442215.1_2 Forward -53 -37 1.04184 0.142
NP_442215.1_2 Forward -272 -256 -1.61309 0.186
NP_440253.1_2 Reverse -42 -60 11.8189 0.0302
NP_440253.1_2 Forward -51 -33 2.37909 0.139
NP_440929.1_8 Forward -270 -261 19.2726 0.000701
NP_440929.1_8 Reverse -261 -270 19.2726 0.000701
NP_440929.1_8 Forward -51 -42 19.2726 0.000701
NP_440929.1_8 Reverse -42 -51 19.2726 0.000701
NP_442933.1_10 Forward -270 -261 17.601 0.00325
NP_442933.1_10 Reverse -261 -270 17.601 0.00325
NP_442933.1_10 Forward -51 -42 17.601 0.00325
NP_442933.1_10 Reverse -42 -51 17.601 0.00325
NP_441751.2_8 Reverse -262 -276 2.75286 0.0759
NP_441751.2_8 Forward -269 -255 1.86788 0.0935
NP_442554.1_8 Reverse -262 -272 19.1546 0.00369
NP_442554.1_8 Forward -269 -259 16.9913 0.0065
NP_442554.1_8 Forward -50 -40 14.238 0.0144
NP_442554.1_8 Reverse -43 -53 13.8447 0.0145
NP_442554.1_8 Reverse -125 -135 2.14332 0.281
NP_441762.1_7 Reverse -41 -53 11.4454 0.0142
NP_441762.1_7 Reverse -260 -272 11.1504 0.0142
NP_441762.1_7 Forward -52 -40 9.47875 0.0142
NP_441762.1_7 Forward -271 -259 2.69391 0.0676
NP_442142.1_4 Reverse -258 -271 12.5067 0.0442
NP_442142.1_4 Reverse -39 -52 5.23026 0.197
NP_442292.1_1 Reverse -262 -271 17.5026 0.00435
NP_442292.1_1 Reverse -43 -52 9.63616 0.0183
NP_442292.1_1 Forward -269 -260 9.53783 0.0183
NP_442292.1_1 Forward -50 -41 9.53783 0.0183
NP_442292.1_5 Forward -274 -255 8.55425 0.14
NP_441525.1_1 Forward -61 -48 13.884 0.238
NP_442476.1_6 Reverse -262 -276 12.7826 0.0457
NP_442476.1_6 Reverse -43 -57 1.96621 0.199
NP_443009.1_5 Reverse -41 -52 20.6093 0.001
NP_443009.1_5 Forward -271 -260 17.0694 0.00659
NP_443009.1_5 Reverse -260 -271 16.7744 0.00677
NP_443009.1_5 Forward -52 -41 9.10461 0.0965
NP_443009.1_5 Reverse -214 -225 8.90795 0.0965
NP_442408.2_1 Reverse -42 -61 -5.31042 0.27
NP_441715.1_4 Reverse -43 -53 16.303 0.0117
NP_441715.1_4 Reverse -262 -272 7.25653 0.108
NP_440015.1_9 Forward -270 -252 0.904127 0.247
NP_442076.1_5 Forward -119 -100 8.06259 0.256
NP_441198.1_8 Forward -272 -262 15.4199 0.0427
NP_441198.1_8 Reverse -259 -269 15.2245 0.0427
NP_441198.1_8 Reverse -40 -50 12.5877 0.12
NP_441468.1_1 Forward -269 -262 15.8704 0.0124
NP_441468.1_1 Reverse -262 -269 15.8704 0.0124
NP_441468.1_1 Forward -50 -43 15.8704 0.0124
NP_441468.1_1 Reverse -43 -50 15.8704 0.0124
NP_441020.2_6 Forward -272 -255 10.1669 0.151
NP_441020.2_6 Reverse -259 -276 10.1669 0.151
NP_441020.2_6 Forward -53 -36 9.28195 0.176
NP_441020.2_6 Reverse -40 -57 9.08529 0.18
NP_441015.1_10 Forward -275 -256 -4.03212 0.197
NP_441673.1_1 Forward -270 -261 20.8459 0.000698
NP_441673.1_1 Reverse -261 -270 20.8459 0.000698
NP_441673.1_1 Forward -51 -42 20.8459 0.000698
NP_441673.1_1 Reverse -42 -51 20.8459 0.000698
NP_441826.1_2 Forward -57 -43 16.5192 0.0187
NP_441826.1_2 Reverse -255 -269 12.8809 0.0248
NP_441826.1_2 Reverse -36 -50 -4.52363 0.296
NP_441764.1_8 Reverse -170 -180 14.8518 0.284
NP_442868.1_6 Reverse -259 -269 16.7946 0.0131
NP_442868.1_6 Reverse -40 -50 9.12481 0.0539
NP_442868.1_6 Forward -272 -262 8.63316 0.0555
NP_442868.1_6 Forward -53 -43 0.963343 0.205
NP_441944.1_4 Forward -286 -267 18.8944 0.277
NP_442808.1_1 Forward -52 -42 18.4657 0.00201
NP_442808.1_1 Reverse -260 -270 8.73102 0.0481
NP_442808.1_1 Reverse -41 -51 8.73102 0.0481
NP_442808.1_1 Forward -271 -261 8.73102 0.0481
NP_441101.1_10 Reverse -38 -57 -8.16202 0.297
NP_440869.1_6 Reverse -322 -341 3.04771 0.245
NP_440145.1_3 Forward -280 -261 11.4058 0.0364
NP_440145.1_3 Reverse -32 -51 0.687771 0.134
NP_440145.1_3 Reverse -251 -270 -2.36049 0.168
NP_442542.1_2 Reverse -259 -272 4.64084 0.299
NP_442050.1_5 Forward -272 -262 17.1874 0.00812
NP_442050.1_5 Reverse -259 -269 14.9258 0.0175
NP_442050.1_5 Forward -53 -43 9.12434 0.193
NP_442050.1_5 Reverse -40 -50 6.96107 0.27
NP_442342.1_9 Forward -272 -256 12.1532 0.112
NP_442342.1_9 Forward -53 -37 7.13836 0.213
NP_442342.1_9 Reverse -259 -275 4.18844 0.251
NP_441114.1_3 Forward -201 -192 7.37455 0.239
NP_442789.1_4 Reverse -259 -278 -4.81876 0.264
NP_441878.1_6 Reverse -260 -270 20.2362 0.0046
NP_441878.1_6 Reverse -41 -51 20.2362 0.0046
NP_441878.1_6 Forward -271 -261 10.5014 0.0176
NP_441878.1_6 Forward -52 -42 10.4031 0.0176
NP_441036.1_8 Forward -52 -42 17.7779 0.000554
NP_441036.1_8 Forward -271 -261 15.713 0.00724
NP_441036.1_8 Reverse -260 -270 8.4365 0.174
NP_441036.1_8 Reverse -41 -51 8.4365 0.174
NP_441557.1_5 Forward -270 -261 19.9609 0.000699
NP_441557.1_5 Reverse -261 -270 19.9609 0.000699
NP_441557.1_5 Forward -51 -42 19.9609 0.000699
NP_441557.1_5 Reverse -42 -51 19.9609 0.000699
NP_442066.2_9 Forward -274 -261 12.409 0.154
NP_442579.1_4 Reverse -68 -87 4.42435 0.29
NP_441308.1_8 Forward -272 -262 12.4681 0.218
NP_441308.1_8 Forward -53 -43 10.1081 0.22
NP_440101.1_3 Forward -275 -256 4.32602 0.22
NP_442183.1_1 Reverse -42 -56 19.1741 0.0065
NP_442183.1_1 Reverse -261 -275 16.9125 0.0129
NP_442183.1_1 Forward -270 -256 10.3243 0.0857
NP_441574.1_1 Forward -282 -263 -7.76869 0.293
NP_442444.1_6 Forward -278 -260 13.9846 0.224
NP_441549.1_9 Reverse -257 -275 -2.0458 0.186
NP_441549.1_9 Forward -274 -256 -6.96235 0.206
NP_442170.1_5 Reverse -261 -280 2.26107 0.18
NP_442347.1_2 Reverse -43 -52 11.1111 0.056
NP_442347.1_2 Forward -269 -260 3.34298 0.284
NP_442347.1_2 Reverse -262 -271 3.34298 0.284
NP_442347.1_2 Forward -50 -41 3.34298 0.284
NP_442645.1_2 Reverse -34 -53 -2.95047 0.0487
NP_442645.1_2 Forward -278 -259 -10.9153 0.144
NP_442645.1_2 Forward -59 -40 -14.0619 0.17
NP_441037.1_4 Reverse -259 -269 18.9151 0.00351
NP_441037.1_4 Reverse -40 -50 17.3558 0.0127
NP_441037.1_4 Forward -272 -262 16.5761 0.0168
NP_441037.1_4 Forward -53 -43 7.02532 0.237
NP_442317.1_6 Reverse -256 -275 6.39097 0.238
NP_441633.1_3 Forward -226 -213 11.4257 0.0286
NP_441633.1_3 Forward -272 -259 6.01747 0.0481
NP_441633.1_3 Forward -53 -40 5.72248 0.0481
NP_441633.1_3 Reverse -40 -53 1.29759 0.109
NP_441633.1_3 Reverse -259 -272 -3.52063 0.177
NP_440136.1_2 Forward -269 -262 15.9687 0.0123
NP_440136.1_2 Reverse -262 -269 15.9687 0.0123
NP_440136.1_2 Forward -50 -43 15.9687 0.0123
NP_440136.1_2 Reverse -43 -50 15.9687 0.0123
NP_442590.1_10 Forward -276 -257 6.29264 0.246
NP_442590.1_10 Forward -57 -38 5.60432 0.258
NP_442998.1_5 Reverse -78 -88 7.25653 0.298
NP_442998.1_10 Forward -268 -261 15.5754 0.0102
NP_442998.1_10 Reverse -263 -270 15.5754 0.0102
NP_442998.1_10 Forward -49 -42 15.5754 0.0102
NP_442998.1_10 Reverse -44 -51 15.5754 0.0102
NP_440899.1_2 Forward -62 -43 10.3234 0.166
NP_440299.1_1 Reverse -38 -51 19.4882 0.00234
NP_440299.1_1 Forward -55 -42 17.8166 0.00525
NP_440299.1_1 Reverse -257 -270 10.3434 0.0573
NP_441799.1_1 Forward -274 -260 10.9137 0.0648
NP_441799.1_1 Reverse -38 -52 10.5204 0.0725
NP_441799.1_1 Reverse -257 -271 5.70218 0.197
NP_441007.1_10 Forward -275 -262 22.6354 0.00574
NP_441007.1_10 Reverse -256 -269 3.46087 0.182
NP_442201.1_10 Reverse -31 -50 2.75272 0.0961
NP_442333.2_5 Forward -62 -43 -14.2585 0.272
NP_440256.1_1 Reverse -39 -58 9.63589 0.0198
NP_440087.1_1 Forward -279 -260 -6.09707 0.252
NP_440087.1_1 Forward -60 -41 -6.58872 0.253
NP_441559.1_8 Forward -207 -193 3.8345 0.141
NP_441559.1_8 Reverse -47 -61 3.73617 0.143
NP_441559.1_8 Forward -56 -42 2.5562 0.143
NP_441559.1_8 Reverse -256 -270 -5.90027 0.271
NP_441559.1_8 Reverse -37 -51 -6.09693 0.274
NP_440915.1_6 Reverse -257 -271 24.9757 0.000297
NP_440915.1_6 Forward -55 -41 5.70279 0.0879
NP_440915.1_6 Reverse -38 -52 5.30946 0.091
NP_440915.1_6 Forward -274 -260 3.73617 0.1
NP_440997.1_3 Reverse -255 -274 14.9458 0.187
NP_442866.1_1 Forward -275 -256 1.96607 0.158
NP_440748.1_5 Forward -131 -112 -0.000545616 0.252
NP_441464.1_8 Reverse -261 -275 10.7177 0.178
NP_441464.1_8 Forward -270 -256 9.93102 0.187
NP_441464.1_8 Forward -51 -37 5.89945 0.248
NP_440695.1_5 Reverse -261 -280 5.70265 0.174
NP_441939.1_3 Forward -269 -250 11.1109 0.118
NP_441939.1_3 Reverse -262 -281 9.14423 0.153
NP_441199.1_6 Forward -55 -36 5.01433 0.156
NP_441199.1_6 Forward -274 -255 2.65439 0.197
NP_441494.1_6 Forward -275 -262 18.3088 0.059
NP_441494.1_6 Reverse -210 -223 6.80412 0.272
NP_442993.1_1 Forward -270 -254 -7.51295 0.146
NP_442993.1_1 Reverse -261 -277 -13.1178 0.286
NP_442386.1_9 Forward -52 -43 15.7322 0.0144
NP_442386.1_9 Forward -271 -262 6.39082 0.219
NP_442386.1_9 Reverse -260 -269 6.39082 0.219
NP_442386.1_9 Reverse -41 -50 6.39082 0.219
NP_441340.1_5 Forward -269 -262 15.6737 0.0124
NP_441340.1_5 Reverse -262 -269 15.6737 0.0124
NP_441340.1_5 Forward -50 -43 15.6737 0.0124
NP_441340.1_5 Reverse -43 -50 15.6737 0.0124
NP_441271.1_1 Forward -276 -258 12.1131 0.236
NP_440168.1_9 Reverse -40 -59 -5.01543 0.296
NP_439976.1_5 Forward -181 -167 13.4703 0.257
NP_442240.1_2 Reverse -262 -281 -6.1954 0.114
NP_442240.1_2 Reverse -43 -62 -16.8151 0.249
NP_442240.1_2 Forward -50 -31 -19.4701 0.295
NP_440161.1_3 Reverse -122 -141 9.24257 0.251
NP_442714.1_7 Forward -50 -31 2.3594 0.225
NP_441027.1_1 Forward -144 -130 11.602 0.27
NP_440586.1_8 Forward -269 -262 13.2151 0.026
NP_440586.1_8 Forward -50 -43 13.2151 0.026
NP_440586.1_8 Reverse -262 -269 13.2151 0.026
NP_440586.1_8 Reverse -43 -50 13.2151 0.026
NP_440586.1_8 Forward -150 -143 9.08521 0.178
NP_442251.1_6 Forward -269 -262 15.2804 0.0124
NP_442251.1_6 Reverse -262 -269 15.2804 0.0124
NP_442251.1_6 Forward -50 -43 15.2804 0.0124
NP_442251.1_6 Reverse -43 -50 15.2804 0.0124
NP_442959.1_5 Reverse -182 -201 6.09597 0.262
NP_440684.1_9 Forward -57 -43 7.07942 0.28
NP_441262.1_3 Reverse -261 -268 14.7888 0.0223
NP_441262.1_3 Reverse -42 -49 14.7888 0.0223
NP_441262.1_3 Forward -270 -263 14.7888 0.0223
NP_441262.1_3 Forward -51 -44 14.7888 0.0223
NP_440027.1_3 Forward -61 -43 14.0797 0.12
NP_443051.1_1 Forward -271 -262 19.5676 0.00335
NP_443051.1_1 Reverse -260 -269 18.0926 0.00402
NP_443051.1_1 Reverse -41 -50 18.0926 0.00402
NP_443051.1_1 Forward -52 -43 10.4228 0.00754
NP_439937.1_9 Forward -271 -254 -6.84499 0.157
NP_439937.1_9 Reverse -41 -58 -8.51661 0.176
NP_439937.1_9 Forward -52 -35 -8.71327 0.177
NP_439937.1_9 Forward -204 -187 -9.7949 0.209
NP_439937.1_9 Reverse -260 -277 -14.4164 0.287
NP_440439.1_1 Forward -273 -260 21.7504 0.00844
NP_440439.1_1 Forward -54 -41 19.7838 0.0105
NP_440439.1_1 Reverse -258 -271 1.19926 0.159
NP_440372.1_2 Forward -269 -262 16.3621 0.0124
NP_440372.1_2 Reverse -262 -269 16.3621 0.0124
NP_440372.1_2 Forward -50 -43 16.3621 0.0124
NP_440372.1_2 Reverse -43 -50 16.3621 0.0124
NP_441789.1_7 Forward -222 -203 -5.40949 0.298
NP_441803.1_2 Forward -275 -256 14.3558 0.0442
NP_441803.1_2 Forward -56 -37 5.60432 0.166
NP_439977.1_5 Forward -276 -257 14.2574 0.0531
NP_439977.1_5 Reverse -255 -274 0.0977854 0.214
NP_442384.1_10 Forward -51 -38 18.3088 0.00492
NP_442384.1_10 Reverse -42 -55 17.3255 0.00599
NP_442384.1_10 Reverse -261 -274 9.06573 0.0574
NP_442384.1_10 Forward -270 -257 4.54251 0.153
NP_442384.1_10 Forward -221 -208 0.510939 0.289
NP_442790.1_4 Reverse -252 -271 -7.17871 0.151
NP_442790.1_4 Forward -60 -41 -14.5535 0.278
NP_442262.1_10 Forward -269 -262 14.1988 0.0123
NP_442262.1_10 Reverse -262 -269 14.1988 0.0123
NP_442262.1_10 Forward -50 -43 14.1988 0.0123
NP_442262.1_10 Reverse -43 -50 14.1988 0.0123
NP_442262.1_10 Forward -150 -143 9.38056 0.202
NP_441689.1_5 Forward -53 -43 8.53436 0.132
NP_441689.1_5 Forward -272 -262 8.43603 0.132
NP_440344.1_10 Forward -58 -41 0.628827 0.0349
NP_440344.1_10 Reverse -254 -271 0.235503 0.0365
NP_440344.1_10 Reverse -35 -52 -2.02611 0.06
NP_440531.1_6 Forward -59 -40 -0.39387 0.211
NP_442910.1_1 Forward -58 -39 -4.91709 0.254
NP_440562.1_3 Forward -269 -252 9.08529 0.15
NP_441965.1_10 Reverse -258 -274 6.64671 0.167
NP_442556.1_10 Reverse -179 -198 10.6451 0.256
NP_440297.1_9 Forward -50 -40 9.61647 0.0917
NP_440297.1_9 Forward -269 -259 9.51814 0.0917
NP_440297.1_9 Reverse -43 -53 9.32148 0.0917
NP_440297.1_9 Reverse -262 -272 -0.314959 0.282
NP_442280.1_10 Forward -206 -188 11.0063 0.213
NP_441592.1_4 Forward -270 -251 -1.86883 0.26
NP_441592.1_4 Reverse -194 -213 -2.75381 0.269
NP_441896.1_3 Forward -60 -41 10.5209 0.0847
NP_441896.1_3 Forward -279 -260 10.3242 0.0847
NP_441896.1_3 Reverse -33 -52 7.96426 0.0922
NP_441896.1_3 Reverse -252 -271 7.57094 0.0933
NP_440894.1_10 Reverse -37 -56 12.3892 0.129
NP_440894.1_10 Reverse -256 -275 11.5042 0.144
NP_440894.1_10 Forward -219 -200 4.22769 0.257
NP_440999.1_9 Reverse -257 -271 11.406 0.0448
NP_440999.1_9 Forward -55 -41 9.93102 0.0574
NP_440999.1_9 Forward -274 -260 6.6861 0.0962
NP_440888.1_2 Reverse -42 -56 16.9119 0.00511
NP_440888.1_2 Reverse -261 -275 14.2569 0.0193
NP_440888.1_2 Forward -270 -256 11.4053 0.0681
NP_442277.1_4 Forward -60 -41 5.2102 0.175
NP_442033.1_10 Forward -272 -253 5.89931 0.0746
NP_442033.1_10 Reverse -259 -278 -0.197208 0.116
NP_442033.1_10 Forward -53 -34 -5.50708 0.179
NP_440105.1_7 Forward -111 -92 16.2241 0.191
NP_441543.1_2 Reverse -43 -52 18.486 0.00236
NP_441543.1_2 Reverse -262 -271 15.9293 0.00518
NP_441543.1_2 Forward -269 -260 9.34117 0.0818
NP_441543.1_2 Forward -50 -41 9.34117 0.0818
NP_442845.1_2 Forward -276 -262 8.35772 0.195
NP_442845.1_4 Forward -272 -253 7.66927 0.189
NP_441551.1_5 Forward -274 -258 6.64602 0.262
NP_442710.1_6 Reverse -120 -139 7.7676 0.204
NP_441469.1_8 Forward -52 -43 16.126 0.00797
NP_441469.1_8 Reverse -260 -269 13.3727 0.073
NP_441469.1_8 Reverse -41 -50 13.3727 0.073
NP_441469.1_8 Forward -271 -262 6.5879 0.227
NP_443064.1_6 Forward -270 -260 13.8273 0.0796
NP_443064.1_6 Forward -51 -41 13.8273 0.0796
NP_443064.1_6 Reverse -261 -271 10.8217 0.13
NP_442578.1_7 Forward -269 -262 14.5921 0.026
NP_442578.1_7 Forward -50 -43 14.5921 0.026
NP_442578.1_7 Reverse -262 -269 14.5921 0.026
NP_442578.1_7 Reverse -43 -50 14.5921 0.026
NP_441462.1_2 Reverse -261 -271 20.2362 0.000805
NP_441462.1_2 Forward -270 -260 20.1379 0.000967
NP_441462.1_2 Forward -51 -41 20.1379 0.000967
NP_441462.1_2 Reverse -42 -52 11.5831 0.00406
NP_441621.1_7 Reverse -259 -273 12.3893 0.0393
NP_441621.1_7 Forward -272 -258 -2.95034 0.188
NP_441621.1_7 Reverse -40 -54 -5.40861 0.252
NP_441929.1_6 Reverse -67 -86 8.94757 0.262
NP_443062.1_6 Forward -59 -40 2.3594 0.256
NP_443062.1_6 Reverse -34 -53 2.26107 0.258
NP_440936.1_2 Forward -118 -99 15.9291 0.16
NP_442204.1_1 Forward -55 -44 7.92515 0.108
NP_442204.1_1 Forward -274 -263 0.353664 0.281
NP_442204.1_5 Reverse -251 -270 13.6675 0.0554
NP_442204.1_5 Forward -61 -42 0.392778 0.264
NP_441560.1_8 Reverse -37 -56 13.3631 0.217
NP_440516.1_8 Forward -270 -261 16.9127 0.00442
NP_440516.1_8 Reverse -261 -270 16.9127 0.00442
NP_440516.1_8 Forward -51 -42 16.9127 0.00442
NP_440516.1_8 Reverse -42 -51 16.9127 0.00442
NP_442080.1_7 Reverse -37 -56 5.99764 0.122
NP_442428.1_4 Forward -271 -252 6.39097 0.198
NP_442428.1_5 Forward -269 -262 15.8704 0.0124
NP_442428.1_5 Reverse -262 -269 15.8704 0.0124
NP_442428.1_5 Forward -50 -43 15.8704 0.0124
NP_442428.1_5 Reverse -43 -50 15.8704 0.0124
NP_440673.1_2 Reverse -32 -51 16.3403 0.0707
NP_440673.1_2 Forward -280 -261 15.3647 0.0888
NP_440673.1_2 Forward -61 -42 11.0725 0.188
NP_440673.1_3 Forward -268 -261 12.4288 0.0426
NP_440673.1_3 Forward -49 -42 12.4288 0.0426
NP_440673.1_3 Reverse -263 -270 12.4288 0.0426
NP_440673.1_3 Reverse -44 -51 12.4288 0.0426
NP_440673.1_3 Reverse -53 -60 5.54565 0.288
NP_440865.1_9 Forward -276 -257 1.57275 0.118
NP_441052.1_2 Reverse -42 -52 10.5014 0.0285
NP_441052.1_2 Forward -270 -260 10.4031 0.0285
NP_441052.1_2 Reverse -261 -271 10.4031 0.0285
NP_441052.1_2 Forward -51 -41 10.4031 0.0285
NP_442219.1_9 Reverse -43 -52 8.35786 0.0681
NP_442219.1_9 Forward -269 -260 8.25953 0.0681
NP_442219.1_9 Reverse -262 -271 8.25953 0.0681
NP_442219.1_9 Forward -50 -41 8.25953 0.0681
NP_440436.1_4 Reverse -43 -52 18.1905 0.00233
NP_440436.1_4 Forward -269 -260 15.9289 0.00508
NP_440436.1_4 Forward -50 -41 15.9289 0.00508
NP_440436.1_4 Reverse -262 -271 9.24241 0.0871
NP_441884.1_8 Reverse -41 -60 -7.27704 0.248
NP_441884.1_9 Reverse -258 -277 -5.50708 0.0594
NP_441884.1_9 Reverse -39 -58 -15.5368 0.138
NP_441357.1_2 Reverse -326 -345 15.1424 0.222
NP_440314.1_9 Forward -50 -31 8.55425 0.0371
NP_440314.1_9 Reverse -262 -281 -7.08038 0.237
NP_440314.1_9 Reverse -125 -144 -9.83364 0.278
NP_441719.1_4 Forward -269 -262 16.3621 0.0124
NP_441719.1_4 Reverse -262 -269 16.3621 0.0124
NP_441719.1_4 Forward -50 -43 16.3621 0.0124
NP_441719.1_4 Reverse -43 -50 16.3621 0.0124
NP_441733.1_10 Reverse -258 -271 9.95071 0.106
NP_441733.1_10 Forward -273 -260 7.29578 0.156
NP_441733.1_10 Reverse -39 -52 6.80412 0.171
NP_441004.1_1 Reverse -36 -55 -11.4069 0.238
NP_441004.1_5 Reverse -38 -52 7.07942 0.292
NP_442366.1_5 Reverse -39 -49 15.4175 0.0374
NP_441437.1_1 Reverse -262 -281 11.6025 0.264
NP_439949.1_10 Reverse -120 -139 18.6035 0.106
NP_441034.1_4 Forward -275 -256 16.6773 0.143
NP_440129.1_10 Forward -250 -236 3.14618 0.228
NP_441115.1_4 Forward -271 -253 17.5212 0.0174
NP_442206.1_10 Reverse -42 -57 1.74985 0.219
NP_440328.1_4 Reverse -255 -274 4.62101 0.162
NP_443054.1_2 Forward -272 -258 10.3243 0.0761
NP_443054.1_2 Forward -53 -39 9.04604 0.102
NP_441851.1_10 Reverse -260 -270 17.4829 0.0027
NP_441851.1_10 Reverse -41 -51 17.4829 0.0027
NP_441851.1_10 Forward -52 -42 16.008 0.00552
NP_441851.1_10 Forward -271 -261 8.53483 0.114
NP_441555.1_5 Reverse -28 -47 16.0265 0.245
NP_441668.1_4 Reverse -32 -51 5.30933 0.17
NP_442515.1_1 Reverse -260 -274 13.4709 0.0278
NP_442515.1_1 Reverse -41 -55 2.06454 0.143
NP_442515.1_1 Forward -271 -257 -1.47537 0.255
NP_442515.1_1 Forward -52 -38 -1.47537 0.255
NP_441396.1_5 Reverse -143 -152 17.2076 0.141
NP_440940.1_7 Reverse -251 -269 14.2763 0.0772
NP_440940.1_7 Forward -61 -43 6.01657 0.225
NP_440432.1_9 Forward -269 -254 -1.49507 0.167
NP_440432.1_9 Forward -50 -35 -2.97003 0.177
NP_440432.1_9 Reverse -262 -277 -3.46169 0.181
NP_442843.1_1 Reverse -43 -62 -11.2103 0.286
NP_442843.1_6 Forward -110 -91 13.9625 0.174
NP_440474.1_8 Reverse -262 -276 7.17714 0.207
NP_440396.1_10 Reverse -262 -278 14.5125 0.151
NP_441596.1_10 Reverse -43 -62 11.7008 0.22
NP_442450.1_5 Reverse -40 -50 17.3846 0.0267
NP_442450.1_5 Reverse -259 -269 10.1081 0.115
NP_442450.1_5 Forward -53 -43 9.32148 0.115
NP_440588.1_2 Reverse -39 -58 -5.40875 0.25
NP_441570.1_1 Reverse -42 -60 3.16574 0.0223
NP_441570.1_1 Reverse -261 -279 -16.1071 0.238
NP_441570.1_1 Forward -270 -252 -16.5005 0.247
NP_441570.1_1 Forward -133 -115 -17.5821 0.283
NP_441078.1_4 Forward -270 -261 19.6659 0.0007
NP_441078.1_4 Reverse -261 -270 19.6659 0.0007
NP_441078.1_4 Forward -51 -42 19.6659 0.0007
NP_441078.1_4 Reverse -42 -51 19.6659 0.0007
NP_442729.1_8 Reverse -38 -51 9.65572 0.125
NP_442729.1_8 Reverse -257 -270 9.06573 0.125
NP_442729.1_8 Forward -55 -42 8.18076 0.125
NP_440526.1_3 Forward -269 -258 20.7076 0.0073
NP_440526.1_3 Reverse -262 -273 2.31981 0.267
NP_440526.1_3 Forward -50 -39 1.72983 0.267
NP_441432.1_8 Forward -271 -262 16.8143 0.00595
NP_441432.1_8 Reverse -260 -269 8.35786 0.0755
NP_441432.1_8 Reverse -41 -50 8.35786 0.0755
NP_441432.1_8 Forward -52 -43 8.25953 0.0755
NP_441432.1_9 Reverse -327 -340 11.5071 0.226
NP_442320.1_8 Forward -57 -43 4.81781 0.0459
NP_442320.1_8 Reverse -255 -269 -1.5737 0.0821
NP_441732.1_2 Reverse -257 -273 -5.15301 0.0476
NP_441732.1_2 Reverse -38 -54 -6.52964 0.0495
NP_441732.1_2 Forward -274 -258 -6.62797 0.0495
NP_441732.1_2 Forward -55 -39 -7.51295 0.0859
NP_440760.1_1 Forward -51 -32 7.37428 0.0115
NP_440760.1_1 Reverse -261 -280 -2.36049 0.0332
NP_440760.1_1 Forward -270 -251 -4.6221 0.0452
NP_440760.1_1 Reverse -42 -61 -21.83 0.245
NP_440199.1_10 Forward -54 -44 13.2547 0.108
NP_442489.1_7 Forward -270 -261 20.1576 0.000695
NP_442489.1_7 Reverse -261 -270 20.1576 0.000695
NP_442489.1_7 Forward -51 -42 20.1576 0.000695
NP_442489.1_7 Reverse -42 -51 20.1576 0.000695
NP_442079.1_7 Forward -50 -31 3.14605 0.212
NP_442079.1_7 Reverse -43 -62 0.884433 0.27
NP_440559.1_1 Forward -269 -260 17.306 0.00658
NP_440559.1_1 Forward -50 -41 17.306 0.00658
NP_440559.1_1 Reverse -43 -52 8.75118 0.0586
NP_440559.1_1 Reverse -262 -271 8.65285 0.0586
NP_441659.2_8 Reverse -261 -271 20.9245 0.000805
NP_441659.2_8 Forward -270 -260 19.3512 0.000966
NP_441659.2_8 Forward -51 -41 19.3512 0.000966
NP_441659.2_8 Reverse -42 -52 11.9764 0.0147
NP_442913.1_10 Reverse -252 -271 16.2241 0.0148
NP_442913.1_10 Forward -279 -260 0.392778 0.154
NP_440779.1_5 Forward -270 -253 -13.4325 0.212
NP_442346.1_2 Forward -281 -262 7.96426 0.216
NP_442346.1_5 Reverse -260 -270 17.9746 0.00128
NP_442346.1_5 Reverse -41 -51 17.9746 0.00128
NP_442346.1_5 Forward -271 -261 16.303 0.00248
NP_442346.1_5 Forward -52 -42 9.02648 0.118
NP_440545.1_3 Reverse -257 -274 18.4267 0.0103
NP_440545.1_3 Reverse -38 -55 12.9202 0.0193
NP_440545.1_3 Forward -274 -257 11.5436 0.0251
NP_442900.1_1 Reverse -181 -200 -3.83545 0.209
NP_442603.1_7 Forward -51 -37 10.6187 0.125
NP_442603.1_7 Forward -270 -256 10.5204 0.125
NP_442603.1_7 Reverse -42 -56 10.1271 0.133
NP_441888.1_7 Forward -56 -42 13.6676 0.0743
NP_440449.1_6 Reverse -253 -271 15.8424 0.0851
NP_440449.1_6 Forward -278 -260 6.21331 0.255
NP_441593.1_8 Reverse -175 -194 21.0423 0.0604
NP_441948.1_4 Reverse -35 -53 -0.177514 0.139
NP_441833.1_4 Forward -269 -262 15.9687 0.0124
NP_441833.1_4 Reverse -262 -269 15.9687 0.0124
NP_441833.1_4 Forward -50 -43 15.9687 0.0124
NP_441833.1_4 Reverse -43 -50 15.9687 0.0124
NP_442162.1_9 Forward -269 -262 16.2637 0.0124
NP_442162.1_9 Reverse -262 -269 16.2637 0.0124
NP_442162.1_9 Forward -50 -43 16.2637 0.0124
NP_442162.1_9 Reverse -43 -50 16.2637 0.0124
NP_440671.1_4 Forward -57 -43 11.3077 0.137
NP_440671.1_4 Reverse -255 -269 5.99778 0.266
NP_442140.1_3 Forward -269 -259 14.828 0.0433
NP_442140.1_3 Forward -50 -40 13.5497 0.0542
NP_442140.1_3 Reverse -43 -53 8.33817 0.119
NP_442140.1_3 Reverse -262 -272 7.94484 0.124
NP_441696.1_6 Reverse -262 -281 7.86593 0.212
NP_441671.1_10 Reverse -187 -206 11.5042 0.149
NP_440875.1_9 Reverse -263 -273 14.5042 0.0411
NP_440875.1_9 Forward -268 -258 8.5667 0.233
NP_441813.1_5 Forward -53 -43 17.188 0.00979
NP_441813.1_5 Reverse -259 -269 8.92815 0.0347
NP_441813.1_5 Reverse -40 -50 8.82982 0.0367
NP_441813.1_5 Forward -272 -262 8.73149 0.0367
NP_440594.1_8 Reverse -262 -275 8.67183 0.213
NP_440590.1_4 Forward -269 -256 14.6706 0.0106
NP_440590.1_4 Forward -50 -37 11.229 0.0216
NP_440590.1_4 Reverse -43 -56 6.31247 0.058
NP_440590.1_4 Reverse -262 -275 3.26421 0.0749
NP_440567.1_1 Reverse -262 -276 11.0127 0.0305
NP_440567.1_1 Reverse -43 -57 6.3911 0.0837
NP_440567.1_1 Forward -269 -255 0.786239 0.232
NP_442497.1_10 Forward -269 -260 19.8626 0.00532
NP_442497.1_10 Forward -50 -41 19.8626 0.00532
NP_442497.1_10 Reverse -262 -271 17.601 0.00813
NP_442497.1_10 Reverse -43 -52 10.4228 0.0087
NP_440821.1_4 Reverse -259 -269 19.5479 0.00399
NP_440821.1_4 Forward -53 -43 19.0562 0.00399
NP_440821.1_4 Reverse -40 -50 10.9931 0.0146
NP_440821.1_4 Forward -272 -262 10.7964 0.0146
NP_441239.1_9 Forward -272 -260 18.4269 0.0114
NP_441239.1_9 Forward -53 -41 16.8536 0.0155
NP_441239.1_9 Reverse -259 -271 14.4936 0.0272
NP_441239.1_9 Reverse -40 -52 13.3137 0.037
NP_441951.1_4 Reverse -42 -61 2.3594 0.283
NP_441009.1_7 Forward -134 -115 10.0292 0.247
NP_440706.1_1 Forward -274 -255 -1.67217 0.258
NP_441892.1_1 Forward -60 -43 3.38209 0.127
NP_441892.1_1 Reverse -252 -269 2.49712 0.14
NP_442044.1_1 Forward -275 -256 -4.91709 0.18
NP_441017.1_6 Forward -55 -41 15.2402 0.114
NP_442772.1_4 Reverse -376 -395 3.24438 0.217
NP_440876.1_5 Reverse -263 -282 14.8474 0.221
NP_442052.1_8 Reverse -40 -50 12.7631 0.253
NP_440546.1_4 Reverse -261 -271 13.5365 0.0459
NP_440546.1_4 Forward -270 -260 12.8578 0.0572
NP_440546.1_4 Forward -51 -41 12.8578 0.0572
NP_440546.1_4 Reverse -42 -52 11.8882 0.0679
NP_440546.1_6 Forward -280 -261 19.764 0.0578
NP_440546.1_6 Forward -61 -42 9.63589 0.247
NP_441230.1_3 Forward -272 -253 5.99764 0.267
NP_441230.1_5 Reverse -256 -275 -0.197208 0.28
NP_440462.1_6 Forward -272 -262 19.4496 0.00371
NP_440462.1_6 Forward -53 -43 15.418 0.0142
NP_440462.1_6 Reverse -259 -269 10.4031 0.0396
NP_440462.1_6 Reverse -40 -50 1.455 0.294
NP_440868.1_4 Forward -274 -262 19.0169 0.0123
NP_440868.1_4 Forward -55 -43 11.2487 0.0327
NP_442812.1_10 Forward -79 -60 20.059 0.049
NP_441848.1_4 Forward -312 -296 8.50558 0.288
NP_440696.1_6 Reverse -249 -268 17.994 0.109
NP_442039.1_4 Forward -269 -262 15.1821 0.0124
NP_442039.1_4 Reverse -262 -269 15.1821 0.0124
NP_442039.1_4 Forward -50 -43 15.1821 0.0124
NP_442039.1_4 Reverse -43 -50 15.1821 0.0124
NP_442039.1_4 Reverse -125 -132 7.02061 0.269
NP_442039.1_7 Reverse -144 -154 10.4031 0.257
NP_441811.1_8 Reverse -36 -50 13.0776 0.194
NP_441811.1_8 Forward -276 -262 10.7177 0.219
NP_441811.1_8 Reverse -255 -269 8.16106 0.238
NP_440825.1_6 Forward -115 -96 7.37428 0.285
NP_440825.1_7 Forward -50 -40 11.8361 0.2
NP_442837.1_3 Forward -269 -262 15.7721 0.0124
NP_442837.1_3 Reverse -262 -269 15.7721 0.0124
NP_442837.1_3 Forward -50 -43 15.7721 0.0124
NP_442837.1_3 Reverse -43 -50 15.7721 0.0124
NP_439994.1_3 Forward -271 -252 14.4868 0.112
NP_442053.1_1 Forward -270 -261 18.3876 0.0007
NP_442053.1_1 Reverse -261 -270 18.3876 0.0007
NP_442053.1_1 Forward -51 -42 18.3876 0.0007
NP_442053.1_1 Reverse -42 -51 18.3876 0.0007
NP_440505.1_3 Forward -272 -262 15.418 0.0114
NP_440505.1_3 Forward -53 -43 13.8447 0.0247
NP_440505.1_3 Reverse -259 -269 7.84651 0.147
NP_441203.1_1 Reverse -43 -62 -10.7186 0.137
NP_441203.1_1 Forward -50 -31 -12.5869 0.143
NP_441203.1_1 Forward -269 -250 -20.1584 0.297
NP_440308.1_6 Forward -63 -44 0.491109 0.296
NP_442532.1_7 Reverse -261 -275 14.2576 0.0644
NP_442532.1_7 Reverse -42 -56 5.70279 0.171
NP_440914.1_1 Reverse -261 -271 16.3248 0.00196
NP_440914.1_1 Forward -133 -123 9.00547 0.186
NP_440914.1_1 Reverse -42 -52 8.6151 0.186
NP_440914.1_1 Forward -270 -260 8.51751 0.186
NP_440914.1_1 Forward -51 -41 8.51751 0.186
NP_441011.1_8 Reverse -43 -52 16.9127 0.00602
NP_441011.1_8 Reverse -262 -271 16.6177 0.00602
NP_441011.1_8 Forward -269 -260 14.356 0.0249
NP_441011.1_8 Forward -50 -41 14.356 0.0249
NP_442101.1_10 Reverse -34 -53 -11.8003 0.265
NP_442931.1_3 Reverse -256 -275 14.7491 0.246
NP_440724.1_10 Reverse -249 -268 11.2092 0.298
NP_442533.1_1 Forward -288 -269 -16.9135 0.277
NP_442533.1_6 Forward -270 -261 17.2076 0.00137
NP_442533.1_6 Reverse -261 -270 17.2076 0.00137
NP_442533.1_6 Forward -51 -42 17.2076 0.00137
NP_442533.1_6 Reverse -42 -51 17.2076 0.00137
NP_442232.1_3 Forward -278 -259 -15.7335 0.296
NP_442229.1_1 Forward -272 -258 7.66879 0.196
NP_442535.1_9 Reverse -252 -270 -3.71743 0.262
NP_441219.1_5 Forward -209 -190 14.5524 0.138
NP_441482.1_7 Reverse -36 -50 8.55439 0.0162
NP_441482.1_7 Forward -57 -43 8.35772 0.0173
NP_441482.1_7 Reverse -255 -269 1.17956 0.0554
NP_441482.1_7 Forward -276 -262 -1.08205 0.0618
NP_439944.1_9 Reverse -262 -272 17.7779 0.00341
NP_439944.1_9 Forward -269 -259 17.4829 0.00423
NP_439944.1_9 Reverse -43 -53 10.3048 0.0887
NP_439944.1_9 Forward -50 -40 8.82982 0.101
NP_441028.1_6 Forward -178 -168 4.60114 0.278
NP_442202.1_10 Reverse -260 -274 4.81781 0.255
NP_440116.1_8 Forward -269 -250 -1.7705 0.122
NP_440116.1_8 Forward -50 -31 -3.24547 0.15
NP_440115.1_6 Forward -273 -263 16.008 0.0325
NP_440115.1_6 Reverse -258 -268 10.1081 0.115
NP_440115.1_6 Reverse -191 -201 5.97822 0.206
NP_440007.1_9 Reverse -257 -271 4.32615 0.267
NP_441602.1_3 Forward -275 -256 8.65258 0.117
NP_441972.1_5 Forward -223 -204 -7.37537 0.248
NP_441106.1_1 Forward -271 -262 18.486 0.0028
NP_441106.1_1 Forward -52 -43 18.191 0.0028
NP_441106.1_1 Reverse -260 -269 9.73449 0.0311
NP_441106.1_1 Reverse -41 -50 9.73449 0.0311
NP_441106.1_1 Forward -58 -49 8.06287 0.0629
NP_440480.1_10 Forward -41 -27 14.1586 0.295
NP_439903.1_6 Reverse -258 -277 2.06362 0.233
NP_442306.1_10 Forward -275 -256 -11.0136 0.114
NP_440797.1_2 Forward -62 -43 11.888 0.288
NP_441286.1_1 Forward -271 -259 14.7886 0.00418
NP_441286.1_1 Forward -52 -40 5.93884 0.0258
NP_441286.1_1 Reverse -260 -272 5.25052 0.0259
NP_441286.1_1 Reverse -41 -53 5.05386 0.0259
NP_442674.1_2 Reverse -129 -148 7.17762 0.285
NP_440670.1_8 Forward -270 -261 18.3876 0.000699
NP_440670.1_8 Reverse -261 -270 18.3876 0.000699
NP_440670.1_8 Forward -51 -42 18.3876 0.000699
NP_440670.1_8 Reverse -42 -51 18.3876 0.000699
NP_441930.1_1 Reverse -38 -57 10.1275 0.194
NP_440886.1_7 Forward -52 -42 17.7774 0.0011
NP_440886.1_7 Forward -271 -261 8.04271 0.0805
NP_440886.1_7 Reverse -260 -270 8.04271 0.0805
NP_440886.1_7 Reverse -41 -51 8.04271 0.0805
NP_440886.1_7 Forward -152 -142 5.28945 0.188
NP_442614.1_2 Reverse -261 -275 6.58777 0.291
NP_442614.1_2 Forward -270 -256 6.3911 0.291
NP_442072.1_9 Reverse -260 -278 -3.32411 0.0355
NP_442072.1_9 Forward -271 -253 -13.6489 0.118
NP_442072.1_9 Reverse -41 -59 -15.1238 0.171
NP_442072.1_9 Forward -52 -34 -23.482 0.297
NP_440907.2_8 Forward -269 -259 19.449 0.00351
NP_440907.2_8 Reverse -262 -272 19.1541 0.00362
NP_440907.2_8 Forward -50 -40 16.2041 0.0161
NP_440907.2_8 Reverse -43 -53 7.84605 0.117
NP_441021.1_1 Forward -269 -250 -7.27704 0.182
NP_441626.1_2 Forward -269 -262 15.7721 0.0124
NP_441626.1_2 Reverse -262 -269 15.7721 0.0124
NP_441626.1_2 Forward -50 -43 15.7721 0.0124
NP_441626.1_2 Reverse -43 -50 15.7721 0.0124
NP_440107.1_5 Reverse -41 -60 0.58944 0.178
NP_442794.1_1 Reverse -38 -50 9.67541 0.0795
NP_442615.1_1 Reverse -252 -270 1.78911 0.0793
NP_442615.1_1 Forward -279 -261 -3.22577 0.159
NP_442615.1_1 Reverse -33 -51 -3.91409 0.171
NP_442615.1_1 Reverse -185 -203 -4.8974 0.197
NP_441962.1_4 Reverse -256 -275 -7.67036 0.192
NP_441962.1_4 Forward -275 -256 -7.76869 0.194
NP_441962.1_4 Reverse -37 -56 -11.6036 0.243
NP_441962.1_4 Forward -65 -46 -15.0452 0.297
NP_440387.1_1 Reverse -261 -277 21.298 0.00238
NP_440387.1_1 Reverse -42 -58 14.3165 0.00649
NP_440387.1_1 Forward -51 -35 6.25339 0.0282
NP_440387.1_1 Forward -270 -254 -0.924775 0.142
NP_441431.1_2 Forward -273 -259 13.6669 0.0834
NP_441431.1_2 Reverse -258 -272 13.077 0.0984
NP_441431.1_2 Forward -54 -40 12.0937 0.128
NP_441488.1_7 Forward -276 -257 16.8141 0.0543
NP_441488.1_8 Reverse -37 -51 8.65209 0.179
NP_441836.1_2 Forward -276 -257 -1.18052 0.217
NP_440634.1_1 Forward -272 -253 15.9291 0.223
NP_441993.1_1 Reverse -42 -61 1.06957 0.285
NP_441174.1_2 Forward -273 -259 11.5043 0.296
NP_440814.1_4 Reverse -252 -271 -11.2103 0.224
NP_440814.1_4 Reverse -33 -52 -12.4886 0.23
NP_440114.1_10 Reverse -261 -275 18.0925 0.0075
NP_440114.1_10 Forward -270 -256 6.98109 0.25
NP_441510.2_7 Forward -57 -43 12.2903 0.28
NP_441510.2_10 Reverse -259 -278 15.3391 0.182
NP_440766.1_4 Forward -55 -41 15.2409 0.0269
NP_440766.1_4 Reverse -257 -271 8.35772 0.0871
NP_440766.1_4 Forward -274 -260 4.03116 0.137
NP_440766.1_4 Reverse -38 -52 0.982901 0.259
NP_441237.1_9 Forward -269 -259 17.2863 0.00348
NP_441237.1_9 Forward -50 -40 17.188 0.00445
NP_441237.1_9 Forward -202 -192 10.8948 0.214
NP_441979.1_5 Reverse -36 -55 -11.8986 0.228
NP_442743.1_4 Reverse -43 -62 -6.09707 0.278
NP_440457.1_1 Reverse -257 -269 15.1819 0.0611
NP_440457.1_1 Forward -55 -43 8.88877 0.101
NP_440457.1_1 Reverse -38 -50 8.10212 0.101
NP_440457.1_1 Forward -274 -262 0.23564 0.25
NP_440798.1_6 Reverse -262 -275 1.69091 0.205
NP_441984.1_1 Reverse -36 -54 6.70565 0.283
NP_441984.1_3 Forward -274 -256 10.9339 0.184
NP_442509.1_9 Forward -270 -260 17.3841 0.00128
NP_442509.1_9 Forward -51 -41 17.3841 0.00128
NP_442509.1_9 Reverse -42 -52 16.2041 0.00739
NP_442509.1_9 Reverse -261 -271 8.04271 0.192
NP_440554.1_4 Reverse -262 -272 15.418 0.0199
NP_440554.1_4 Reverse -43 -53 14.6313 0.02
NP_440554.1_4 Forward -269 -259 6.27322 0.123
NP_441885.1_5 Reverse -42 -52 11.4848 0.00668
NP_441885.1_5 Forward -270 -260 11.3864 0.00668
NP_441885.1_5 Reverse -261 -271 11.3864 0.00668
NP_441885.1_5 Forward -51 -41 11.3864 0.00668
NP_442228.1_5 Forward -273 -254 19.0748 0.234
NP_440898.1_1 Forward -63 -44 13.4708 0.23
NP_442341.1_7 Reverse -41 -55 17.1092 0.0138
NP_442341.1_7 Forward -52 -38 16.1259 0.0186
NP_442341.1_7 Forward -271 -257 10.6193 0.0625
NP_442341.1_7 Reverse -260 -274 6.3911 0.127
NP_442341.1_9 Forward -53 -39 7.86545 0.185
NP_441173.1_9 Forward -137 -129 12.1137 0.21
NP_440409.1_1 Forward -278 -259 13.2741 0.112
NP_443000.1_7 Forward -272 -262 10.7964 0.0345
NP_443000.1_7 Forward -53 -43 8.73149 0.0437
NP_443000.1_7 Reverse -259 -269 2.14332 0.226
NP_443000.1_7 Reverse -40 -50 2.04498 0.226
NP_440507.2_3 Reverse -39 -58 9.24175 0.227
NP_440727.1_2 Forward -278 -259 -1.7705 0.295
NP_441842.1_10 Forward -58 -44 7.07942 0.267
NP_442122.1_2 Reverse -297 -316 18.0924 0.251
NP_440275.1_3 Reverse -259 -269 19.5479 0.00756
NP_440275.1_3 Forward -272 -262 18.6629 0.0082
NP_440275.1_3 Reverse -40 -50 9.91146 0.046
NP_440275.1_3 Forward -53 -43 8.4365 0.0602
NP_440091.1_1 Forward -55 -43 8.29878 0.0653
NP_440091.1_1 Reverse -257 -269 3.2839 0.163
NP_440091.1_1 Forward -61 -49 3.18557 0.166
NP_440091.1_1 Forward -274 -262 0.825626 0.227
NP_440679.1_10 Reverse -44 -63 1.0811 0.092
NP_443010.1_10 Forward -273 -256 17.9423 0.0367
NP_442451.1_2 Forward -59 -40 12.1925 0.0595
NP_442451.1_2 Forward -278 -259 11.7992 0.0595
NP_442495.1_4 Reverse -186 -196 11.5831 0.271
NP_440149.1_8 Reverse -42 -61 19.6656 0.00856
NP_441105.1_3 Reverse -250 -269 -7.17871 0.248
NP_440216.1_1 Reverse -42 -56 -1.27871 0.0303
NP_440216.1_1 Forward -270 -256 -1.47537 0.0328
NP_440216.1_1 Reverse -261 -275 -1.5737 0.034
NP_440216.1_1 Forward -51 -37 -2.36035 0.0494
NP_440172.1_1 Reverse -261 -271 17.5813 0.00421
NP_440172.1_1 Forward -270 -260 16.303 0.00854
NP_440172.1_1 Forward -51 -41 16.303 0.00854
NP_440172.1_1 Reverse -42 -52 8.73149 0.0586
NP_442015.1_10 Forward -55 -42 19.5871 0.00427
NP_442015.1_10 Reverse -38 -51 12.114 0.0372
NP_442015.1_10 Reverse -257 -270 4.54251 0.167
NP_441226.1_7 Forward -269 -262 14.4934 0.0123
NP_441226.1_7 Reverse -262 -269 14.4934 0.0123
NP_441226.1_7 Forward -50 -43 14.4934 0.0123
NP_441226.1_7 Reverse -43 -50 14.4934 0.0123
NP_441111.1_7 Forward -269 -261 18.7023 0.00294
NP_441111.1_7 Forward -50 -42 18.7023 0.00294
NP_441111.1_7 Reverse -262 -270 18.7023 0.00294
NP_441111.1_7 Reverse -43 -51 18.7023 0.00294
NP_442379.1_10 Forward -277 -260 8.10198 0.102
NP_441766.1_2 Forward -270 -261 17.5026 0.00297
NP_441766.1_2 Reverse -261 -270 17.5026 0.00297
NP_441766.1_2 Forward -51 -42 17.5026 0.00297
NP_441766.1_2 Reverse -42 -51 17.5026 0.00297
NP_442417.1_5 Reverse -42 -56 13.3726 0.0786
NP_440416.1_1 Forward -270 -251 -13.5702 0.281
NP_440416.1_1 Reverse -261 -280 -14.6519 0.295
NP_443052.1_8 Forward -280 -261 -5.9004 0.137
NP_443052.1_8 Reverse -251 -270 -11.3086 0.226
NP_443052.1_8 Forward -61 -42 -11.4069 0.229
NP_443052.1_9 Reverse -266 -285 -4.13045 0.254
NP_440591.1_9 Reverse -41 -59 7.59063 0.198
NP_440591.1_9 Reverse -254 -272 3.85406 0.295
NP_440261.1_5 Forward -269 -256 6.80412 0.0316
NP_440261.1_5 Reverse -262 -275 6.70579 0.0318
NP_440261.1_5 Forward -50 -37 -2.43899 0.0924
NP_440261.1_5 Reverse -43 -56 -12.0754 0.27
NP_440988.1_10 Forward -397 -383 11.8693 0.187
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACTATGGTCGTGCCAAAGAATTAGCAGTAGGTAGTGAGTTTCTGACTTATATCGTGAGTCAAAAAGAGCTAGATCTTCCAGTATGGATTCGTTTAGGAAAATGGTCTTCTAAAATTCGGGTTGAAGTGGAGGCGATCGCCCCTGATCAGATCAAAACTGCATCCGGAGTCTATGTCTGCAATCATCCCCTGAATCCTCTGGATTGCCCAGCAAATCAACAAATTTTGCTCTATAACCGGGTTGTTATGCCCCCATCGAGTTTATTTAGCCAATCTCAATTACAGGGTGATTATTGGCAGATTGATCGTAATACGTTTTTGCCTCAAGGATTTCACTATGGAGCAACGACGGCGATCGCCCAAGATTCACCGCAATTATCACTATTAGATACTAATTAATC

CDS

ATGTTTGATGATCGCTACAGTTTGTATTCCGTTGTTATTGAATTAGGCGCAGCAAAAAAAGGGTTTCCTACAGGTATTTTAGGCAGAGCTTTACATTCGCAGGTGTTGGAGTGGCTTAAAATCGGTGAACCTTCCCTTGCTGAAGAATTACACCAAAGCCAAATTTCTCCATTTTCTATTTCTCCACTAATTGGTAAACGTCGTTCTAAATTGACAGAGGAAGGCGATCGCTTCTTTTTTCGTATCAGCCTCTTAAATGGATCTTTATTACAGCCCTTATTAAAAGGCTTAGAACAACAGGATAAACAAATAGTAATGTTAGATAAGTTCGCATTTCGTCTCTGCCATATTCATATTTTACCCGGTAGTCATTCCCTTGCTCGTGCGAGTAGTTATGCTTTAACTACTCAAGCTCCAACATCTTCTAAAATCACTTTAAAATTTCATAGTGCAACAAGTTTTAAGATTGATCGCAATACAATTCAACCTTTTCCATTAGGTGATTCTGTTTTTAATAGTTTACTGAGACGCTGGAATCATTTTGCACCAGAAGAATTGTATTTTCCCTCTGTATCTTGGCAAATTCCTGTTGCGGCTTTTGAACTTAAAACCTATAGTGTTCAACTCAAAAAATCAGAAATTGGTTCTGAAGGGTGGGTAACTTACTTATTTCCTGATCAAGAACAAGCAAAAATAGCATCTGTATTGTCGCAATTTGCTTTTTTTGCTGGAGTTGGACGTAAAACATCAATGGGTATGGGACAGGTTTCAGTTAACAATCATGGATGA

Protein

No sequence available