Your browser is old and dusty. Try Google Chrome!

Details for slr7012

ORF slr7012
Accession NP_942300.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -159 -173 4.42448 0.148
NP_440557.1_1 Reverse -159 -178 11.0125 0.11
NP_440795.1_7 Forward -166 -159 14.6904 0.0123
NP_440795.1_7 Reverse -159 -166 14.6904 0.0123
NP_441418.1_6 Forward -167 -148 -29.9915 0.249
NP_441453.1_4 Forward -167 -159 16.539 0.00633
NP_441453.1_4 Reverse -158 -166 7.8859 0.0536
NP_442151.1_6 Reverse -158 -172 14.6509 0.0321
NP_442151.1_6 Forward -167 -153 10.816 0.114
NP_440561.1_4 Reverse -156 -175 18.0737 0.125
NP_441818.1_1 Forward -166 -155 11.8579 0.155
NP_441818.1_1 Reverse -159 -170 9.59626 0.232
NP_440226.1_1 Reverse -158 -177 9.3409 0.0734
NP_440226.1_1 Forward -110 -91 4.81767 0.178
NP_440996.1_4 Forward -381 -371 15.713 0.27
NP_442173.1_1 Reverse -159 -167 15.4574 0.00633
NP_442173.1_1 Forward -166 -158 8.27922 0.101
NP_442752.1_4 Forward -167 -160 13.8055 0.0199
NP_443027.1_4 Forward -169 -159 16.2046 0.0437
NP_442975.1_10 Reverse -154 -168 12.2903 0.0477
NP_442975.1_10 Forward -171 -157 3.53891 0.257
NP_440784.1_7 Forward -166 -159 15.9687 0.0123
NP_440784.1_7 Reverse -159 -166 15.9687 0.0123
NP_442909.1_7 Reverse -153 -167 8.75042 0.163
NP_442909.1_7 Forward -166 -152 8.25877 0.184
NP_442062.1_8 Forward -167 -157 9.41981 0.0625
NP_440304.1_4 Forward -169 -159 19.9412 0.00364
NP_440304.1_4 Reverse -156 -166 9.12481 0.0626
NP_442242.1_4 Forward -166 -159 14.3954 0.0124
NP_442242.1_4 Reverse -159 -166 14.3954 0.0124
NP_442242.1_4 Forward -307 -300 9.77388 0.213
NP_441781.1_7 Reverse -158 -177 -0.39387 0.257
NP_442110.1_7 Reverse -158 -172 12.7826 0.0586
NP_441083.1_5 Reverse -158 -168 10.0098 0.0214
NP_441083.1_5 Forward -167 -157 9.61647 0.0243
NP_441083.1_5 Forward -308 -298 6.8632 0.0735
NP_442827.1_8 Reverse -150 -169 9.24175 0.0718
NP_441738.1_2 Reverse -160 -167 15.28 0.0102
NP_441738.1_2 Forward -306 -299 13.3134 0.0335
NP_441738.1_2 Reverse -187 -194 6.03696 0.295
NP_441558.1_5 Forward -310 -291 13.0775 0.0626
NP_440209.1_1 Forward -167 -159 18.1123 0.00295
NP_440209.1_1 Reverse -158 -166 15.1624 0.00583
NP_440209.1_1 Forward -308 -300 2.1827 0.254
NP_441770.1_4 Reverse -236 -255 -10.1286 0.267
NP_440178.1_7 Forward -168 -149 -21.6334 0.232
NP_440178.1_7 Reverse -157 -176 -23.2067 0.298
NP_442059.1_10 Forward -89 -70 12.8808 0.195
NP_441327.1_1 Reverse -377 -396 7.48109 0.235
NP_441327.1_1 Forward -217 -198 2.96396 0.279
NP_442111.1_4 Reverse -157 -171 9.93102 0.0575
NP_440906.1_5 Forward -166 -159 15.8704 0.0124
NP_440906.1_5 Reverse -159 -166 15.8704 0.0124
NP_440747.1_10 Reverse -296 -308 -4.58258 0.109
NP_440747.1_10 Forward -170 -158 -11.6624 0.131
NP_440747.1_10 Reverse -155 -167 -11.8591 0.161
NP_441130.1_10 Reverse -156 -170 8.06273 0.141
NP_441486.1_1 Forward -170 -156 4.32615 0.0462
NP_442634.1_4 Reverse -156 -170 -3.93365 0.176
NP_440470.1_5 Forward -219 -200 9.02356 0.24
NP_442848.1_1 Forward -173 -159 5.80112 0.0803
NP_443018.1_3 Forward -166 -159 14.8871 0.0123
NP_443018.1_3 Reverse -159 -166 14.8871 0.0123
NP_441316.1_7 Reverse -156 -171 -1.20007 0.228
NP_440376.1_1 Forward -167 -158 9.73449 0.0365
NP_440376.1_1 Reverse -158 -167 9.63616 0.0385
NP_441588.1_4 Reverse -160 -170 6.66654 0.185
NP_442730.1_9 Forward -245 -226 19.2914 0.276
NP_442687.1_7 Reverse -157 -167 15.8113 0.0125
NP_442485.1_3 Reverse -147 -166 2.85105 0.207
NP_440533.1_9 Reverse -158 -177 2.0644 0.289
NP_441763.1_10 Forward -172 -153 5.40686 0.288
NP_442658.1_1 Forward -169 -159 13.0576 0.04
NP_442658.1_1 Reverse -156 -166 12.6642 0.0497
NP_442658.1_1 Forward -175 -165 7.35439 0.214
NP_442782.1_2 Reverse -255 -269 2.35953 0.275
NP_442205.1_9 Reverse -152 -168 -0.826444 0.264
NP_441414.1_9 Forward -308 -289 -9.73531 0.266
NP_441414.1_9 Forward -167 -148 -10.4236 0.284
NP_441958.1_1 Forward -385 -366 18.4754 0.27
NP_441958.1_5 Forward -168 -158 12.0747 0.00222
NP_441958.1_5 Reverse -157 -167 10.6981 0.0112
NP_440203.1_5 Forward -305 -295 11.8776 0.171
NP_441441.1_4 Reverse -219 -233 17.7968 0.279
NP_443001.1_7 Forward -193 -174 2.3594 0.279
NP_440984.1_7 Reverse -294 -308 5.30946 0.259
NP_439990.1_5 Forward -172 -159 6.90245 0.22
NP_440993.1_4 Forward -326 -309 6.62702 0.241
NP_440615.1_8 Reverse -374 -393 13.8641 0.213
NP_441099.1_5 Reverse -148 -167 -7.4737 0.176
NP_442002.1_1 Forward -368 -350 -10.4039 0.292
NP_442013.1_7 Forward -245 -226 5.30933 0.299
NP_442013.1_10 Forward -366 -347 11.1109 0.123
NP_441752.1_6 Reverse -106 -125 1.76941 0.255
NP_441000.1_6 Reverse -157 -171 -2.45868 0.216
NP_442771.1_1 Reverse -156 -174 -6.56903 0.168
NP_442771.1_1 Forward -169 -151 -8.73231 0.204
NP_441550.1_8 Forward -169 -159 13.0576 0.0273
NP_441550.1_8 Reverse -156 -166 11.7793 0.0435
NP_441916.1_7 Reverse -158 -168 10.6981 0.0261
NP_441916.1_7 Forward -167 -157 7.55152 0.0639
NP_441041.1_4 Forward -167 -148 -8.65367 0.205
NP_441041.1_7 Forward -170 -158 8.68091 0.133
NP_442004.1_6 Reverse -158 -172 11.2093 0.125
NP_442004.1_6 Reverse -185 -199 3.53951 0.238
NP_441725.1_4 Forward -172 -158 4.71887 0.278
NP_441725.1_5 Forward -166 -156 19.0562 0.0119
NP_441725.1_5 Reverse -159 -169 11.1898 0.0247
NP_439966.1_6 Forward -365 -347 23.4219 0.0208
NP_439966.1_7 Forward -169 -159 14.8275 0.0177
NP_439966.1_7 Reverse -156 -166 9.81266 0.1
NP_442941.1_3 Reverse -159 -169 19.9412 0.00262
NP_442941.1_3 Forward -166 -156 1.94665 0.147
NP_440289.1_2 Forward -170 -157 14.9656 0.0107
NP_440289.1_2 Reverse -155 -168 5.91914 0.0605
NP_442281.1_1 Forward -172 -158 6.29216 0.13
NP_442281.1_1 Reverse -153 -167 2.35894 0.269
NP_442281.1_1 Reverse -294 -308 2.06395 0.278
NP_442256.1_2 Forward -310 -292 -6.86402 0.214
NP_442982.1_5 Forward -177 -158 -1.27885 0.265
NP_441644.1_6 Reverse -158 -168 16.4008 0.00405
NP_441644.1_6 Forward -167 -157 11.9759 0.0408
NP_443049.1_6 Forward -168 -158 11.7385 0.24
NP_442247.1_8 Forward -169 -155 11.996 0.247
NP_440929.1_8 Forward -167 -158 9.93116 0.0249
NP_440929.1_8 Reverse -158 -167 9.83282 0.0254
NP_442933.1_10 Forward -167 -158 9.04618 0.063
NP_442933.1_10 Reverse -158 -167 8.94785 0.0643
NP_440382.1_2 Forward -82 -63 10.0284 0.191
NP_441751.2_8 Reverse -159 -173 4.32615 0.0511
NP_441751.2_8 Forward -166 -152 -3.73699 0.154
NP_442554.1_8 Reverse -159 -169 16.9913 0.0065
NP_442554.1_8 Forward -166 -156 5.28991 0.153
NP_442554.1_8 Forward -307 -297 2.83163 0.253
NP_442554.1_9 Reverse -64 -83 16.4102 0.198
NP_441762.1_7 Forward -168 -156 -4.77924 0.182
NP_441762.1_7 Reverse -157 -169 -5.86088 0.246
NP_442142.1_4 Reverse -155 -168 9.16348 0.101
NP_442142.1_4 Forward -170 -157 3.65697 0.248
NP_442292.1_1 Reverse -159 -168 17.5026 0.00435
NP_442292.1_1 Forward -307 -298 6.5879 0.101
NP_442292.1_1 Forward -166 -157 0.688044 0.23
NP_442381.1_8 Forward -170 -151 -13.0786 0.267
NP_443009.1_5 Forward -168 -157 8.4163 0.109
NP_443009.1_5 Reverse -157 -168 7.03967 0.141
NP_441715.1_4 Reverse -159 -169 14.238 0.0295
NP_440015.1_9 Reverse -158 -176 0.412472 0.252
NP_441198.1_8 Forward -169 -159 13.2713 0.108
NP_441468.1_1 Forward -166 -159 15.8704 0.0124
NP_441468.1_1 Reverse -159 -166 15.8704 0.0124
NP_441020.2_6 Forward -169 -152 7.31533 0.235
NP_441015.1_10 Reverse -147 -166 -7.67036 0.27
NP_441673.1_1 Forward -167 -158 11.1111 0.0121
NP_441673.1_1 Reverse -158 -167 11.0128 0.018
NP_441826.1_2 Forward -173 -159 -2.65535 0.273
NP_441764.1_8 Forward -387 -377 13.3205 0.284
NP_442868.1_6 Reverse -156 -166 8.92815 0.0555
NP_442868.1_6 Forward -169 -159 1.06167 0.205
NP_442719.1_2 Reverse -164 -182 -2.63651 0.191
NP_441056.1_1 Forward -167 -148 -0.0988766 0.156
NP_442361.1_3 Forward -173 -160 8.86907 0.285
NP_442808.1_1 Reverse -157 -167 9.12434 0.0481
NP_442050.1_5 Forward -169 -159 18.0724 0.00365
NP_442050.1_5 Reverse -156 -166 14.8275 0.0179
NP_442050.1_5 Forward -310 -300 8.3377 0.234
NP_442050.1_5 Reverse -183 -193 7.64939 0.243
NP_442342.1_9 Reverse -156 -172 16.7748 0.0737
NP_441878.1_6 Reverse -157 -167 10.4031 0.0176
NP_441878.1_6 Forward -168 -158 0.766681 0.134
NP_441036.1_7 Forward -231 -221 15.8108 0.292
NP_441036.1_8 Forward -168 -158 6.07655 0.242
NP_441036.1_8 Reverse -157 -167 6.07655 0.242
NP_441557.1_5 Forward -167 -158 10.8161 0.00464
NP_441557.1_5 Reverse -158 -167 10.4228 0.00915
NP_441739.1_2 Reverse -171 -187 3.79444 0.252
NP_441308.1_8 Forward -169 -159 13.353 0.218
NP_442183.1_1 Forward -167 -153 16.1259 0.0162
NP_442183.1_1 Reverse -158 -172 8.75105 0.109
NP_441655.1_10 Reverse -146 -164 5.82068 0.219
NP_441549.1_9 Reverse -319 -337 -8.92897 0.238
NP_442170.1_5 Forward -167 -148 3.44104 0.172
NP_442347.1_2 Forward -307 -298 5.3096 0.233
NP_442347.1_2 Reverse -159 -168 3.34298 0.284
NP_442645.1_2 Reverse -150 -169 -7.96535 0.118
NP_441037.1_4 Forward -169 -159 7.31769 0.237
NP_442594.1_5 Forward -326 -307 9.53674 0.233
NP_442594.1_9 Forward -389 -370 9.34008 0.228
NP_441633.1_3 Reverse -233 -246 -5.68391 0.236
NP_440136.1_2 Forward -166 -159 15.9687 0.0123
NP_440136.1_2 Reverse -159 -166 15.9687 0.0123
NP_442998.1_5 Forward -122 -112 9.81313 0.233
NP_442998.1_10 Reverse -160 -167 15.5754 0.0102
NP_442998.1_10 Forward -306 -299 12.3305 0.0564
NP_442998.1_10 Forward -165 -158 5.84064 0.235
NP_441799.1_1 Reverse -154 -168 8.84875 0.105
NP_441007.1_10 Forward -172 -159 4.64084 0.182
NP_441007.1_10 Reverse -153 -166 -0.0790467 0.26
NP_440915.1_6 Forward -171 -157 10.7177 0.0301
NP_441179.1_1 Forward -170 -151 4.62101 0.247
NP_442866.1_1 Reverse -126 -145 -8.45701 0.279
NP_440695.1_5 Forward -167 -148 10.3242 0.15
NP_442993.1_1 Reverse -158 -174 -1.41643 0.0906
NP_442993.1_1 Forward -167 -151 -7.41462 0.146
NP_442386.1_9 Reverse -157 -166 8.35743 0.201
NP_442386.1_9 Forward -168 -159 6.39082 0.219
NP_441340.1_5 Forward -166 -159 15.6737 0.0124
NP_441340.1_5 Reverse -159 -166 15.6737 0.0124
NP_441340.1_9 Reverse -1 -11 8.06241 0.256
NP_442186.1_10 Forward -337 -318 14.9449 0.268
NP_440251.1_8 Reverse -152 -166 17.6992 0.142
NP_441254.1_2 Reverse -31 -50 17.8957 0.0427
NP_440586.1_8 Forward -166 -159 13.2151 0.026
NP_440586.1_8 Reverse -159 -166 13.2151 0.026
NP_442251.1_6 Forward -166 -159 15.2804 0.0124
NP_442251.1_6 Reverse -159 -166 15.2804 0.0124
NP_442251.1_6 Forward -307 -300 9.77388 0.162
NP_442251.1_6 Reverse -132 -139 7.11894 0.274
NP_440684.1_9 Forward -116 -102 9.5377 0.218
NP_441262.1_3 Forward -167 -160 14.7888 0.0223
NP_441262.1_3 Reverse -158 -165 6.52896 0.0809
NP_443051.1_1 Forward -168 -159 19.5676 0.00335
NP_443051.1_1 Reverse -157 -166 8.65285 0.029
NP_441595.1_2 Forward -390 -377 9.13351 0.278
NP_440439.1_1 Forward -170 -157 2.87088 0.124
NP_439943.1_1 Forward -116 -97 -5.50708 0.232
NP_440372.1_2 Forward -166 -159 16.3621 0.0124
NP_440372.1_2 Reverse -159 -166 16.3621 0.0124
NP_441293.1_3 Reverse -4 -22 11.7475 0.291
NP_440316.1_10 Forward -168 -158 12.1731 0.214
NP_439977.1_5 Forward -173 -154 -3.3438 0.299
NP_440139.1_1 Reverse -152 -171 16.7149 0.0474
NP_442114.1_8 Forward -84 -70 8.3571 0.234
NP_442262.1_10 Forward -166 -159 14.1988 0.0123
NP_442262.1_10 Reverse -159 -166 14.1988 0.0123
NP_441689.1_5 Forward -169 -159 17.8758 0.0158
NP_441689.1_5 Reverse -183 -193 12.4676 0.132
NP_440344.1_10 Forward -174 -157 -6.05768 0.111
NP_441965.1_10 Forward -311 -295 2.02515 0.292
NP_440297.1_9 Forward -166 -156 10.5998 0.0917
NP_440297.1_9 Reverse -159 -169 9.22315 0.0917
NP_440350.1_5 Reverse -66 -85 -3.63879 0.261
NP_442187.1_3 Reverse -298 -308 16.303 0.0823
NP_442187.1_3 Forward -168 -158 15.0247 0.12
NP_440999.1_9 Forward -162 -148 -2.75368 0.276
NP_440999.1_9 Reverse -355 -369 -3.24533 0.289
NP_440888.1_2 Reverse -158 -172 15.1419 0.0122
NP_442033.1_10 Forward -161 -142 -11.4069 0.253
NP_441543.1_2 Reverse -159 -168 15.9293 0.00518
NP_442845.1_2 Forward -173 -159 14.0609 0.0872
NP_442845.1_2 Reverse -152 -166 7.47274 0.195
NP_441304.1_10 Forward -352 -343 13.8644 0.23
NP_441469.1_8 Reverse -157 -166 12.6844 0.0995
NP_441469.1_8 Forward -168 -159 6.5879 0.227
NP_442578.1_7 Forward -166 -159 14.5921 0.026
NP_442578.1_7 Reverse -159 -166 14.5921 0.026
NP_442578.1_7 Reverse -300 -307 5.25066 0.251
NP_441462.1_2 Forward -167 -157 17.8763 0.00406
NP_441462.1_2 Reverse -158 -168 10.4031 0.011
NP_441462.1_2 Reverse -299 -309 -1.19994 0.291
NP_441462.1_2 Reverse -255 -265 -1.29827 0.299
NP_443062.1_1 Forward -368 -350 5.5232 0.227
NP_441410.1_3 Forward -176 -157 3.93269 0.295
NP_442204.1_1 Forward -171 -160 9.89177 0.0736
NP_442204.1_1 Forward -312 -301 4.5819 0.246
NP_440516.1_8 Forward -167 -158 18.9776 0.00442
NP_440516.1_8 Reverse -158 -167 7.07956 0.0867
NP_440516.1_8 Reverse -299 -308 0.688044 0.136
NP_442428.1_5 Forward -166 -159 15.8704 0.0124
NP_442428.1_5 Reverse -159 -166 15.8704 0.0124
NP_441835.1_2 Reverse -162 -181 4.62101 0.27
NP_440673.1_3 Forward -165 -158 13.1171 0.0426
NP_440673.1_3 Reverse -160 -167 12.4288 0.0426
NP_440673.1_3 Forward -262 -255 7.02061 0.274
NP_440865.1_9 Forward -173 -154 -6.98204 0.238
NP_441052.1_2 Reverse -158 -168 10.9931 0.0285
NP_441052.1_2 Forward -308 -298 1.25834 0.249
NP_441052.1_2 Forward -167 -157 0.668351 0.256
NP_442219.1_9 Forward -166 -157 8.84951 0.0681
NP_442219.1_9 Reverse -159 -168 8.25953 0.0681
NP_440436.1_4 Reverse -159 -168 9.24241 0.0871
NP_440436.1_4 Forward -166 -157 6.78414 0.147
NP_442086.1_3 Forward -166 -147 11.4058 0.191
NP_442864.1_3 Reverse -293 -312 6.88262 0.293
NP_440314.1_9 Reverse -102 -121 1.76941 0.0872
NP_440314.1_9 Forward -166 -147 -8.26035 0.246
NP_440648.1_1 Forward -308 -289 5.30933 0.219
NP_441719.1_4 Forward -166 -159 16.3621 0.0124
NP_441719.1_4 Reverse -159 -166 16.3621 0.0124
NP_441719.1_7 Reverse -58 -77 15.8307 0.295
NP_441733.1_10 Forward -170 -157 8.86907 0.132
NP_442366.1_3 Reverse -157 -175 2.0841 0.135
NP_442366.1_3 Reverse -234 -252 -5.88071 0.298
NP_442694.1_9 Forward -22 -3 11.7008 0.207
NP_442206.1_10 Forward -368 -353 7.64971 0.178
NP_442854.1_6 Reverse -299 -318 2.0644 0.279
NP_440328.1_4 Forward -314 -295 1.37609 0.225
NP_441851.1_10 Reverse -157 -167 8.1415 0.122
NP_441668.1_4 Forward -346 -327 8.25926 0.145
NP_442515.1_1 Forward -168 -154 3.73617 0.115
NP_441409.1_6 Reverse -152 -171 -13.8652 0.244
NP_440474.1_8 Reverse -159 -173 5.60385 0.246
NP_442450.1_5 Reverse -156 -166 19.4496 0.0103
NP_442450.1_5 Forward -169 -159 9.41981 0.115
NP_440588.1_2 Forward -176 -157 7.17762 0.0516
NP_439950.1_1 Forward -351 -342 14.4544 0.224
NP_441570.1_1 Forward -167 -149 -16.7954 0.254
NP_441078.1_4 Forward -167 -158 9.93116 0.0203
NP_441078.1_4 Reverse -158 -167 9.83282 0.0226
NP_441663.1_8 Forward -314 -295 -3.14714 0.276
NP_440526.1_3 Reverse -159 -170 1.82816 0.267
NP_441432.1_8 Forward -168 -159 16.8143 0.00595
NP_441432.1_9 Forward -31 -18 10.2466 0.254
NP_442320.1_8 Forward -173 -159 15.8309 0.0102
NP_442320.1_8 Reverse -152 -166 -2.75368 0.0966
NP_442344.1_7 Forward -166 -147 -4.91709 0.168
NP_442344.1_7 Reverse -165 -184 -9.047 0.235
NP_441732.1_2 Forward -171 -155 -16.5594 0.174
NP_441732.1_2 Forward -312 -296 -16.9527 0.223
NP_441732.1_2 Forward -165 -149 -17.5427 0.27
NP_441030.1_6 Reverse -156 -175 13.044 0.23
NP_440629.1_4 Reverse -323 -342 7.7676 0.287
NP_442815.1_3 Reverse -156 -175 12.6841 0.195
NP_440760.1_1 Forward -167 -148 -9.73531 0.084
NP_440199.1_10 Forward -170 -160 14.238 0.0861
NP_442353.1_4 Reverse -360 -379 0.293673 0.276
NP_442400.1_10 Reverse -6 -19 14.0036 0.173
NP_440713.1_4 Forward -363 -344 3.04771 0.251
NP_442489.1_7 Forward -167 -158 10.4228 0.0151
NP_442489.1_7 Reverse -158 -167 10.3245 0.0193
NP_440565.1_7 Forward -242 -223 -2.16383 0.291
NP_440559.1_1 Forward -166 -157 9.14451 0.0586
NP_440559.1_1 Reverse -159 -168 8.65285 0.0586
NP_441659.2_8 Reverse -158 -168 11.3864 0.0184
NP_441659.2_8 Forward -167 -157 9.81313 0.0269
NP_442346.1_5 Reverse -157 -167 14.1397 0.0164
NP_442346.1_5 Forward -168 -158 7.84651 0.156
NP_440352.1_8 Reverse -263 -279 17.7441 0.216
NP_440545.1_3 Reverse -319 -336 -6.35267 0.276
NP_441856.1_7 Reverse -311 -330 11.2092 0.246
NP_440025.1_3 Reverse -168 -182 17.6781 0.107
NP_440459.1_2 Reverse -357 -374 9.18362 0.233
NP_440449.1_6 Forward -175 -157 7.57499 0.218
NP_441833.1_4 Forward -166 -159 15.9687 0.0124
NP_441833.1_4 Reverse -159 -166 15.9687 0.0124
NP_441895.1_10 Reverse -8 -27 -19.3717 0.282
NP_442699.1_10 Forward -64 -45 18.9773 0.0823
NP_442162.1_9 Forward -166 -159 16.2637 0.0124
NP_442162.1_9 Reverse -159 -166 16.2637 0.0124
NP_440671.1_4 Forward -173 -159 17.0108 0.0246
NP_440671.1_4 Reverse -152 -166 7.27608 0.222
NP_443026.1_5 Forward -199 -180 -3.14714 0.283
NP_442140.1_3 Forward -166 -156 7.45319 0.14
NP_440875.1_9 Reverse -160 -170 7.59334 0.255
NP_441813.1_5 Reverse -156 -166 16.1063 0.01
NP_441813.1_5 Forward -169 -159 15.9097 0.01
NP_440590.1_4 Reverse -159 -172 4.05085 0.0642
NP_440567.1_1 Reverse -159 -173 15.4376 0.0176
NP_440567.1_1 Forward -166 -152 6.98109 0.0795
NP_440567.1_1 Forward -307 -293 -0.295402 0.276
NP_442497.1_10 Reverse -159 -168 17.601 0.00813
NP_442497.1_10 Forward -166 -157 10.8161 0.0087
NP_440821.1_4 Reverse -156 -166 17.4829 0.00613
NP_440821.1_4 Forward -169 -159 11.0914 0.0146
NP_441239.1_9 Reverse -156 -168 11.4454 0.0607
NP_441239.1_9 Forward -169 -157 6.1355 0.2
NP_441009.1_7 Reverse -349 -368 10.8159 0.238
NP_441892.1_1 Forward -176 -159 -3.99273 0.253
NP_440604.1_6 Forward -194 -175 -5.9004 0.287
NP_441017.1_6 Forward -171 -157 14.2569 0.157
NP_440833.1_6 Forward -119 -105 7.47213 0.278
NP_440546.1_4 Forward -167 -157 14.0213 0.0459
NP_440546.1_4 Reverse -158 -168 10.8217 0.104
NP_440546.1_4 Forward -110 -100 7.33119 0.246
NP_441509.1_8 Reverse -345 -359 20.5501 0.041
NP_441230.1_5 Reverse -153 -172 3.93269 0.189
NP_440675.1_1 Reverse -226 -245 2.3594 0.27
NP_440462.1_6 Forward -169 -159 16.893 0.00853
NP_440462.1_6 Reverse -156 -166 6.8632 0.0967
NP_442465.1_9 Forward -82 -68 10.4227 0.291
NP_440868.1_4 Forward -312 -300 0.530633 0.21
NP_440868.1_4 Reverse -154 -166 0.432302 0.212
NP_440868.1_4 Forward -171 -159 -0.846001 0.282
NP_442499.1_1 Forward -166 -147 10.0292 0.203
NP_442402.1_6 Forward -185 -176 13.4711 0.284
NP_441848.1_4 Forward -392 -376 12.7072 0.199
NP_441848.1_7 Reverse -336 -355 0.686995 0.228
NP_439948.1_2 Reverse -17 -35 13.7528 0.259
NP_441084.1_6 Forward -334 -320 11.0893 0.218
NP_440696.1_3 Reverse -154 -172 -3.71743 0.289
NP_442039.1_4 Forward -166 -159 15.1821 0.0124
NP_442039.1_4 Reverse -159 -166 15.1821 0.0124
NP_441811.1_8 Reverse -152 -166 5.80112 0.289
NP_442829.1_2 Reverse -5 -21 10.4603 0.287
NP_441926.1_3 Forward -167 -151 12.7432 0.0785
NP_441926.1_3 Reverse -158 -174 5.6634 0.17
NP_442837.1_3 Forward -166 -159 15.7721 0.0124
NP_442837.1_3 Reverse -159 -166 15.7721 0.0124
NP_442053.1_1 Forward -167 -158 17.601 0.00138
NP_442053.1_1 Reverse -158 -167 16.2243 0.00451
NP_442053.1_1 Forward -308 -299 4.52295 0.242
NP_442053.1_1 Reverse -299 -308 4.22796 0.261
NP_440505.1_3 Forward -169 -159 15.123 0.014
NP_441252.1_6 Forward -184 -177 11.6422 0.288
NP_441203.1_1 Reverse -159 -178 -2.95047 0.0655
NP_442532.1_7 Forward -167 -153 3.8345 0.187
NP_440914.1_1 Reverse -158 -168 13.7874 0.0256
NP_440914.1_1 Forward -167 -157 7.24882 0.242
NP_441011.1_8 Reverse -159 -168 16.6177 0.00602
NP_441011.1_8 Forward -166 -157 12.7828 0.0397
NP_442101.1_10 Forward -175 -156 -6.29373 0.186
NP_442533.1_6 Forward -167 -158 7.86621 0.0862
NP_442533.1_6 Reverse -158 -167 7.37455 0.0898
NP_440263.1_5 Forward -20 -6 7.27608 0.294
NP_443050.1_2 Forward -366 -347 10.8159 0.147
NP_441482.1_7 Forward -173 -159 8.25939 0.0181
NP_441482.1_7 Reverse -152 -166 -1.8687 0.0876
NP_439944.1_9 Reverse -159 -169 17.6796 0.00347
NP_439944.1_9 Forward -166 -156 8.33817 0.111
NP_441697.1_5 Reverse -198 -217 -1.19407 0.204
NP_440816.1_2 Reverse -13 -32 8.2744 0.253
NP_440116.1_5 Reverse -296 -313 5.05372 0.176
NP_440007.1_9 Forward -171 -157 11.5043 0.163
NP_441059.1_2 Forward -193 -174 -6.88371 0.268
NP_441106.1_1 Forward -168 -159 18.486 0.0028
NP_439903.1_6 Forward -170 -151 12.0933 0.0872
NP_439903.1_6 Reverse -155 -174 3.53858 0.209
NP_442306.1_10 Forward -172 -153 -20.5517 0.213
NP_441286.1_1 Forward -168 -156 13.5103 0.00683
NP_441286.1_1 Reverse -157 -169 -4.28759 0.154
NP_440670.1_8 Forward -167 -158 9.04618 0.0606
NP_440670.1_8 Reverse -158 -167 8.75118 0.0606
NP_440886.1_7 Reverse -157 -167 8.04271 0.0805
NP_440886.1_7 Forward -168 -158 6.76441 0.114
NP_442072.1_9 Reverse -157 -175 -22.597 0.246
NP_442072.1_9 Reverse -298 -316 -22.7936 0.259
NP_440907.2_8 Reverse -159 -169 9.51767 0.103
NP_440326.1_9 Forward -25 -6 14.4533 0.274
NP_440176.1_3 Reverse -349 -363 12.9786 0.261
NP_441463.1_3 Reverse -148 -167 -5.99873 0.238
NP_441463.1_3 Reverse -206 -225 -10.3253 0.293
NP_441463.1_6 Forward -169 -155 8.92841 0.25
NP_441626.1_2 Forward -166 -159 15.7721 0.0124
NP_441626.1_2 Reverse -159 -166 15.7721 0.0124
NP_442615.1_1 Forward -176 -158 -3.71743 0.168
NP_440387.1_1 Reverse -158 -174 -1.61309 0.143
NP_440387.1_1 Forward -167 -151 -1.90808 0.145
NP_441431.1_2 Reverse -356 -370 5.50552 0.298
NP_441488.1_8 Forward -172 -158 9.53707 0.15
NP_441993.1_1 Reverse -152 -171 3.21363 0.239
NP_441993.1_1 Forward -173 -154 2.04414 0.265
NP_440114.1_10 Forward -167 -153 13.8643 0.0481
NP_440114.1_10 Reverse -158 -172 11.996 0.0955
NP_441272.1_7 Reverse -143 -153 12.9597 0.287
NP_440293.1_3 Reverse -310 -329 -1.86883 0.239
NP_440766.1_4 Forward -171 -157 15.8309 0.0269
NP_441979.1_5 Reverse -152 -171 -12.1936 0.228
NP_439910.1_2 Reverse -150 -167 -21.4956 0.183
NP_440457.1_1 Forward -171 -159 7.11881 0.105
NP_440457.1_1 Reverse -154 -166 0.23564 0.25
NP_440213.1_4 Forward -211 -192 16.4202 0.217
NP_442509.1_6 Forward -371 -352 10.2259 0.294
NP_442509.1_9 Forward -167 -157 15.9091 0.00953
NP_442582.1_3 Reverse -18 -32 13.094 0.284
NP_441253.1_8 Forward -178 -164 14.4365 0.128
NP_440554.1_4 Reverse -159 -169 16.1063 0.0189
NP_442862.1_3 Forward -127 -110 9.47861 0.219
NP_441885.1_3 Reverse -66 -85 19.6867 0.0522
NP_441885.1_5 Forward -167 -157 2.24165 0.0822
NP_441885.1_5 Reverse -158 -168 1.55333 0.109
NP_442341.1_9 Forward -169 -155 10.5204 0.133
NP_441173.1_9 Reverse -176 -184 12.507 0.206
NP_442395.2_4 Reverse -157 -176 2.85027 0.214
NP_440191.1_4 Reverse -168 -178 14.2146 0.266
NP_443000.1_7 Forward -169 -159 17.4829 0.00719
NP_441842.1_10 Forward -174 -160 14.2576 0.0632
NP_440275.1_3 Forward -169 -159 9.12481 0.055
NP_440275.1_3 Reverse -156 -166 1.35667 0.29
NP_440091.1_1 Forward -171 -159 1.41561 0.197
NP_441359.1_5 Reverse -155 -174 1.27776 0.29
NP_442638.1_2 Forward -364 -345 14.2574 0.142
NP_441105.1_3 Forward -178 -159 10.5209 0.0405
NP_440216.1_1 Forward -167 -153 -4.4253 0.111
NP_440216.1_1 Reverse -299 -313 -11.2101 0.169
NP_440216.1_1 Reverse -158 -172 -11.7018 0.212
NP_440216.1_9 Reverse -330 -339 9.4395 0.286
NP_440172.1_1 Forward -167 -157 17.2863 0.00544
NP_440172.1_1 Reverse -158 -168 7.74818 0.0738
NP_440172.1_1 Reverse -299 -309 6.96153 0.0959
NP_441226.1_7 Forward -166 -159 14.4934 0.0123
NP_441226.1_7 Reverse -159 -166 14.4934 0.0123
NP_441757.1_3 Forward -111 -92 -2.16383 0.273
NP_441111.1_7 Reverse -159 -167 18.7023 0.00294
NP_441111.1_7 Forward -166 -158 8.96754 0.0463
NP_442379.1_10 Reverse -149 -166 0.137172 0.223
NP_441766.1_2 Reverse -158 -167 18.2893 0.00297
NP_441766.1_2 Forward -167 -158 9.14451 0.0337
NP_443052.1_8 Reverse -148 -167 1.17943 0.0612
NP_443052.1_8 Forward -339 -320 -11.5053 0.231
NP_442116.1_6 Reverse -7 -24 13.421 0.172
NP_440591.1_9 Reverse -151 -169 4.73903 0.273
NP_442226.1_8 Forward -381 -371 14.1397 0.26
NP_440261.1_5 Forward -307 -294 -11.0921 0.237
NP_440988.1_5 Reverse -168 -187 14.0305 0.235
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TTTCTAAGGCATTAGAGCAAATTTTGTCTGTTCCCGATGACTGGGATGAGGAGGAATTAATTTTGCAAGGCTCTGGTCAACTCCAAGCCGCACTAGATCGCCAAGAGGTTTATACCCGACCCATTATTAAAGATAAATCGGTTGCCTATGAAACACGTCAATTGCAGGAACTAGAGGCAATTCAAATCTTTATGACCACTTGTGTAAGGGATCTATTTGGGGAAATGTGCAAAGGCGATCGCGCTATCCTCCAAGAACAACGTAATCGTATCAAGTCCGGTGCAGAATTTGCCTATCGTTTACTAGCTCTAGAAGCACAACAAAACCAAAACTAACTTCAGATATCAGACATCAGTGTTCAGATATCAATTCTCTTCATTATTTCTAGGAATTTTTCATT

CDS

ATGTTAGATAGTCTCAAGTCTCAATTTCAGCCTTCTTTTCCTCGCCTTGCATCCGGTCACTATGTTCATTTTCTGATGTTGCGCCACTCTCAATCTTTTCCGGTGTTTCAAACGGATGGAGTTTTGAATACAACCCGAACCCAAGCCGGACTATTGGAAAAGACAGATCAACTCAGTCGTTTGGTGATGTTTAAGCGAAAACAAACCACTCCAGAACGTTTAGCAGGTCGTGAACTTCTGCGTAATTTAGGTTTGACAAGTGCCGATAAAAGCGCGAAAAACCTTTGTGAATATAACGGGGAAGGTTCCTGTAAACAATGTCCTGATTGTATTCTCTATGGTTTTGCAATCGGGGATAGTGGCTCAGAACGTTCAAAAGTCTATTCTGATTCTGCTTTTTCCCTAGGAGCTTACGAACAATCCCATCGTAGTTTTACATTTAATGCACCCTTTGAAGGGGGAACAATGAGCGAAGCTGGGGTAATGCGGAGTGCGATTAATGAACTCGACCACATTTTGCCAGAAGTTACTTTTCCCACGGTCGAGTCATTGCGAGATGCAACCTATGAAGGGTTTATCTATGTATTAGGTAATCTACTCCGCACAAAACGTTATGGGGCGCAGGAATCTCGTACAGGTACGATGAAAAACCATTTGGTTGGGATTGTTTTTGCTGACGGAGAAATTTTTAGTAATCTGCATTTAACCCAAGCTCTTTATGACCAGATGGGAGGGGAATTGAATAAACCGATTTCTGAACTTTGCGAGACAGCTGCAACCGTTGCCCAAGATCTTTTAAATAAAGAGCCAGTCCGTAAATCTGAGTTAATTTTTGGTGCACATTTGGACACATTACTCCAAGAAGTGAATGACATTTACCAAAATGATGCCGAGCTAACAAAGTTGCTGGGTTCTCTGTATCAACAAACCCAAGATTATGCGACAGAGTTTGGTGCTTTATCTGGTGGTAAGAAGAAGGCAAAGTCTTAG

Protein

No sequence available