Your browser is old and dusty. Try Google Chrome!

Details for slr7011

ORF slr7011
Accession NP_942299.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441818.1_1 Forward -216 -205 8.61296 0.288
NP_440259.1_4 Forward -355 -341 10.6604 0.262
NP_440996.1_2 Reverse -350 -359 15.241 0.248
NP_441816.1_7 Forward -393 -374 14.1591 0.0574
NP_442173.1_1 Reverse -209 -217 5.13263 0.226
NP_441208.1_9 Reverse -271 -285 9.5377 0.209
NP_439957.1_9 Reverse -342 -361 2.7211 0.3
NP_441434.1_1 Forward -388 -374 7.17351 0.288
NP_441738.1_2 Forward -215 -208 10.0685 0.125
NP_441738.1_2 Reverse -51 -58 8.29857 0.176
NP_441327.1_5 Reverse -348 -357 16.6177 0.111
NP_442111.1_3 Reverse -348 -361 15.9134 0.196
NP_441667.1_5 Forward -53 -39 18.1635 0.217
NP_443018.1_3 Reverse -209 -216 9.77388 0.118
NP_442730.1_8 Forward -342 -323 3.83357 0.273
NP_441077.1_6 Reverse -342 -358 10.9965 0.156
NP_441077.1_6 Reverse -14 -30 10.0324 0.164
NP_440642.1_10 Forward -355 -341 3.24392 0.277
NP_440667.1_2 Forward -130 -111 -8.45701 0.289
NP_442782.1_2 Forward -118 -104 2.35953 0.275
NP_441487.1_9 Reverse -105 -124 1.17943 0.208
NP_442937.1_5 Forward -71 -52 10.0292 0.173
NP_442321.1_4 Forward -292 -273 -0.39387 0.255
NP_441317.1_4 Forward -359 -345 13.8565 0.168
NP_442396.1_5 Reverse -204 -217 5.32916 0.287
NP_441725.1_5 Forward -168 -158 -0.314959 0.246
NP_442941.1_5 Forward -355 -341 14.2385 0.298
NP_442288.1_4 Reverse -15 -29 16.6272 0.279
NP_441860.1_1 Reverse -49 -63 14.6768 0.277
NP_441860.1_2 Forward -332 -313 13.1758 0.262
NP_440469.1_8 Forward -132 -113 7.27595 0.295
NP_440566.1_6 Forward -204 -185 14.6508 0.18
NP_442933.1_2 Reverse -343 -361 9.64667 0.257
NP_442933.1_6 Reverse -18 -37 12.4613 0.288
NP_442671.1_2 Reverse -342 -361 10.2915 0.0597
NP_440382.1_2 Reverse -16 -35 7.07848 0.258
NP_441751.2_8 Forward -216 -202 -6.29359 0.259
NP_440357.1_2 Forward -91 -72 18.584 0.195
NP_441731.1_1 Reverse -190 -208 16.6176 0.258
NP_441731.1_3 Forward -123 -104 -3.3438 0.284
NP_441637.1_9 Reverse -171 -189 -3.02911 0.293
NP_441764.1_8 Reverse -348 -358 12.4592 0.284
NP_442719.1_2 Reverse -40 -58 -3.71814 0.201
NP_441251.1_8 Reverse -342 -355 10.7569 0.278
NP_441911.1_10 Reverse -338 -357 10.4871 0.226
NP_442050.1_5 Forward -219 -209 8.53436 0.23
NP_440334.1_2 Reverse -344 -357 14.0806 0.274
NP_440558.1_2 Reverse -112 -131 -5.21209 0.254
NP_441878.1_6 Reverse -159 -169 -7.19813 0.21
NP_441458.1_8 Forward -398 -379 4.0221 0.267
NP_441458.1_10 Forward -199 -180 1.57275 0.288
NP_442998.1_5 Reverse -348 -358 9.61647 0.238
NP_440899.1_8 Forward -357 -338 12.2908 0.0736
NP_440899.1_8 Forward -356 -337 -9.14533 0.258
NP_441464.1_10 Forward -260 -246 10.816 0.238
NP_442386.1_9 Reverse -186 -195 6.19416 0.23
NP_441340.1_9 Reverse -348 -358 8.25522 0.256
NP_442327.1_3 Forward -36 -17 6.63627 0.26
NP_440327.1_6 Forward -337 -318 2.26107 0.298
NP_442714.1_5 Reverse -344 -363 1.37609 0.242
NP_441262.1_3 Reverse -208 -215 11.6422 0.0477
NP_443051.1_5 Reverse -342 -361 5.30933 0.256
NP_440819.1_5 Reverse -348 -356 7.68924 0.266
NP_440316.1_10 Reverse -159 -169 8.23984 0.24
NP_441877.1_9 Forward -30 -13 2.30045 0.292
NP_442262.1_10 Reverse -209 -216 11.1505 0.115
NP_441689.1_5 Forward -219 -209 5.19112 0.282
NP_440297.1_9 Forward -168 -158 1.06167 0.282
NP_440350.1_5 Forward -360 -341 -6.1954 0.296
NP_442892.1_5 Reverse -320 -338 15.556 0.2
NP_441268.1_1 Reverse -204 -223 11.8883 0.27
NP_440998.1_6 Forward -179 -160 17.9932 0.295
NP_442487.1_6 Forward -113 -94 13.2733 0.196
NP_441884.1_2 Reverse -15 -29 17.9641 0.178
NP_442694.1_4 Forward -57 -48 15.536 0.164
NP_441851.1_10 Reverse -207 -217 9.81313 0.112
NP_442939.1_3 Reverse -16 -30 16.4362 0.257
NP_442843.1_1 Reverse -161 -180 -7.96535 0.252
NP_442843.1_1 Forward -195 -176 -9.83364 0.271
NP_440474.1_8 Forward -216 -202 4.42388 0.279
NP_442006.1_2 Reverse -160 -177 -17.9557 0.285
NP_442348.1_2 Forward -58 -49 17.011 0.055
NP_441732.1_2 Forward -287 -271 -17.4444 0.258
NP_442447.1_1 Reverse -343 -362 9.0459 0.258
NP_442540.1_7 Reverse -220 -238 13.6872 0.0313
NP_440578.1_10 Forward -210 -191 10.3242 0.278
NP_442079.1_7 Reverse -161 -180 -0.000545616 0.287
NP_439956.1_7 Forward -130 -111 1.86774 0.28
NP_441050.1_5 Forward -128 -110 -1.84914 0.271
NP_443040.1_1 Reverse -341 -355 9.99066 0.291
NP_441329.1_6 Reverse -328 -347 4.63094 0.201
NP_441895.1_10 Reverse -345 -364 -18.3884 0.282
NP_442796.1_10 Reverse -147 -166 9.83255 0.249
NP_443026.1_5 Forward -63 -44 -0.4922 0.283
NP_441692.1_2 Reverse -335 -354 6.4893 0.134
NP_441541.1_1 Reverse -374 -392 -4.67712 0.283
NP_440354.1_7 Forward -202 -184 9.95058 0.224
NP_440546.1_6 Forward -185 -166 7.27595 0.277
NP_440055.1_5 Reverse -353 -372 14.0678 0.272
NP_442479.1_9 Forward -136 -117 -14.0619 0.294
NP_442402.1_4 Forward -354 -335 -10.2277 0.298
NP_442679.1_1 Reverse -337 -356 -0.590531 0.221
NP_442679.1_1 Reverse -336 -355 -4.32711 0.276
NP_440207.2_10 Reverse -183 -197 17.8958 0.192
NP_441011.1_8 Reverse -161 -170 5.21127 0.278
NP_440816.1_2 Reverse -339 -358 8.95209 0.235
NP_441028.1_6 Forward -345 -335 5.19112 0.265
NP_441028.1_6 Forward -356 -346 4.7978 0.277
NP_440116.1_5 Forward -235 -218 2.20212 0.279
NP_441527.1_4 Reverse -343 -362 3.38954 0.118
NP_441527.1_4 Reverse -344 -363 -1.09858 0.146
NP_441527.1_4 Reverse -152 -171 -11.1252 0.278
NP_441602.1_3 Forward -129 -110 -5.11376 0.278
NP_439903.1_6 Forward -337 -318 0.293673 0.267
NP_441186.1_4 Reverse -44 -54 15.6142 0.232
NP_442674.1_10 Reverse -211 -230 10.4225 0.246
NP_442058.1_6 Forward -54 -35 3.83436 0.18
NP_440886.1_7 Reverse -56 -66 3.12618 0.296
NP_440841.1_4 Reverse -329 -348 -5.9004 0.209
NP_440841.1_4 Reverse -185 -204 -10.9153 0.29
NP_441463.1_3 Reverse -177 -196 -10.522 0.296
NP_442365.1_7 Forward -344 -325 -6.39206 0.292
NP_441460.1_5 Forward -363 -349 14.1586 0.258
NP_441836.1_2 Forward -75 -56 0.491109 0.202
NP_441993.1_1 Forward -72 -53 7.59921 0.16
NP_440358.1_8 Forward -85 -66 -1.27885 0.274
NP_440311.1_3 Reverse -217 -236 14.6508 0.236
NP_440725.1_4 Reverse -111 -130 9.83255 0.118
NP_440754.1_7 Forward -384 -366 18.7184 0.202
NP_441500.1_2 Reverse -29 -48 14.2574 0.191
NP_440643.1_6 Reverse -149 -168 6.29264 0.214
NP_442930.1_1 Forward -359 -349 9.41933 0.287
NP_440502.1_7 Reverse -185 -204 14.3558 0.268
NP_442680.1_5 Reverse -337 -356 19.5126 0.0362
NP_442680.1_5 Reverse -336 -355 8.86437 0.158
NP_442439.1_8 Reverse -330 -349 11.3075 0.234
NP_442862.1_3 Reverse -203 -220 3.87375 0.299
NP_442703.1_8 Forward -355 -337 13.883 0.253
NP_441173.1_9 Forward -344 -336 11.7204 0.226
NP_442638.1_3 Reverse -375 -394 10.4559 0.298
NP_441207.1_7 Reverse -349 -363 10.9012 0.253
NP_440175.1_4 Forward -142 -123 -14.3569 0.277
NP_442417.1_5 Reverse -368 -382 4.71948 0.291
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACTGGATATTTCAAAATTACTAAATGGCTCGATCAGCGTCTTAATTTTTCCCTTTTTTCTACCCATAGTCATCTTGCTAGCTGTCAACTTATGCTATTAGACCGACTCCAATTAAAAGGACATATCCAACCAGAATTGAGTCGTTGTTTGGGTCGTAGGAAATATCTTGCCTATCTTGTTCCAATCAATCGCAATAATCCTTCTAGCCATTGGGATATTAGTCGCAAATTACGCCTTAGCCCTCTTTTTGGGTTATATCGTCTGACGGATAGTGGCGGGAATGCTTACGGTTGTGCGTTTAACCATGATGCTTTATTGCTTGAAGCTTTGAAGTGGCGGTTAGGGGATTTTTGTAAACAAGCCACCAGTCAATCTTTAATTTTTTAAGGGACTAACAATT

CDS

ATGACAACACTTCTTCAAACTTTGCTGATTCGTACTTTGTCAGAACAAAAAGACTATATTCTTTTGGAATATTTTCAAACTATTTTACCTGCCCTTGAAGAACATTTTGGTAATACTTCAGGCTTAGGTGGTTCATTTATTTCCCATCAAAAACATTTTGGGACACAGGGATATGACACAGAAAAAGCCAAGAAAATGGCTCAAGGTTTTGCAAAAAAAGGAGATCAAACATTAGCGGCTCATATTCTCAATGCGTTACTAACAACATGGAATGTGATGCAAGAATTAGAATTTCCTCTGAATGATATTGAGCGACGCTTACTTTGTTTAGGAATTACTCTCCATGATTACGATAAGCATTGCCATGCTCAAGATATGGCAGCTCCTGAGCCTGATAATATACAGGAAATCATTAATATATGTCTCGAATTAGGTAAGCGATTGAACTTCGATGAGTTTTGGGCAGACTGGCGTGATTATATTGCTGAAATTTCCTATCTTGCACAAAACACTCATGGTAAACAACATACAAATTTAATTTCAAGTAATTGGTCAAATGCAGGTTATCCCTTCACGATTAAGGAACGAAAATTAGATCATCCTCTGCGACATTTACTTACTTTTGGTGATGTGGCAGTTCACTTAAGCAGTCCCCATGATTTGGTAAGTTCTACTATGGGCGATCGCCTGCGTGATTTGTTAAATCGGTTAGGCATTGAAAAAAGATTCGTCTACCACCATTTGCGAGATACAACAGGCATTTTGAGTAATGCGATCCATAATGTCATCCTCAGAACAGTTCAGAAATTAGATTGGAAGCCTCTACTTTTCTTTGCCCAAGGTGTAATTTATTTTGCGCCTCAAGATACTGAAATTCCTGAACGAAATGAAATTAAACAGATAGTTTGGCAGGGCATTAGTCAAGAATTAGGCAAAAAAATGTCTGCTGGTGATGTAGGTTTTAAACGGGATGGGAAAGGCTTAAAGGTTTCTCCCCAAACCTCTGAGTTATTAGCCGCAGCGGATATCGTGCGAATTTTACCTCAGGTTATTTCCGTTAAAGTCAACAATGCGAAAAGTCCAGCCACGCCTAAACGTCTTGAAAAATTAGAATTGGGTGATGCAGAACGTGAAAAACTCTATGAGGTTGCAGATTTGCGGTGCGATCGCCTTGCGGAATTACTTGGTCTTGTACAAAAAGAAATTTTTCTGCTACCTGAACCTTTTATCGAGTGGGTCTTAAAAGATTTGGAGCTAACTTCTGTGATTATGCCGGAGGAAACCCAAGTGCAATCCGGTGGGGTGAATTATGGCTGGTATCGGGTTGCAGCCCATTATGTCGCTAATCATGCGACTTGGGATCTAGAGGAATTCCAAGAATTTTTACAAGGGTTTGGCGATCGCCTTGCGACATGGGCAGAGGAAGAAGGCTATTTTGCAGAACATCAAAGCCCAACACGCCAAATTTTTGAAGATTACCTTGACCGTTATCTAGAAATTCAAGGCTGGGAAAGCGACCATCAAGCTTTTATTCAAGAGTTAGAAAATTACGTTAATGCCAAAACAAAAAAATCCAAACAACCAATTTGTTCTCTAAGTTCTGGTGAGTTTCCTTCAGAGGATCAAATGGATTCAGTTGTGCTGTTTAAACCCCAGCAATACAGTAATAAAAACCCTTTAGGAGGTGGGCAAATCAAGCGTGGTATTTCAAAAATTTGGTCACTGGAAATGCTCTTACGTCAGGCTTTTTGGTCTGTTCCTTCCGGTAAATTTGAGGATCAACAACCTATTTTTATCTATCTCTATCCTGCCTATGTCTATGCGCCTCAAGTAGTAGAAGCAATTCGGGAACTAGTGTATGGTATCGCTTCAGTTAATCTTTGGGATGTTCGTAAGCATTGGGTCAACAACAAGATGGATCTTACTAGTCTTAAGTCTTTGCCTTGGCTTAATGAGGAAGTTGAAGCAGGAACAAATGCTCAACTGAAATACACAAAAGAAGATTTACCTTTTCTTGCCACCGTCTACACCACAACCAGAGAAAAAACGGATACCGATGCTTGGGTGAAACCCGCATTTCTTGCCTTACTTCTGCCCTATTTGTTGGGAGTTAAGGCGATCGCCACCCGAAGCATGGTTCCTCTTTATCGGAGTGATCAAGATTTTCGAGAATCAATTCATCTCGATGGAGTCGCGGGTTTTTGGAGCTTATTGGGTATCCCGACAGATTTACGAGTCGAAGATATTACCCCAGCTCTGAATAAACTTTTGGCGATTTATACCTTACACCTTGCCGCCCGTAGTAGTCCTCCTAAAGCGAGGTGGCAGGATCTGCCCAAAACTGTACAGGAGGTAATGACCGATGTTCTAAATGTATTCGCCCTTGCTGAACAGGGATTGCGACGTGAAAAACGCGATCGCCCCTATGAATCAGAAGTGACTGAATATTGGCAATTTGCTGAACTTTTTTCCCAAGGAAATATTGTTATGACCGAAAAATTGAAACTGACTAAACGTTTGGTTGAGGAATATCGCAGGTTTTATCAAGTGGAACTATCAAAAAAGCCCTCCACTCATGCCATTTTATTGCCTCTTTCTAAGGCATTAGAGCAAATTTTGTCTGTTCCCGATGACTGGGATGAGGAGGAATTAATTTTGCAAGGCTCTGGTCAACTCCAAGCCGCACTAGATCGCCAAGAGGTTTATACCCGACCCATTATTAAAGATAAATCGGTTGCCTATGAAACACGTCAATTGCAGGAACTAGAGGCAATTCAAATCTTTATGACCACTTGTGTAAGGGATCTATTTGGGGAAATGTGCAAAGGCGATCGCGCTATCCTCCAAGAACAACGTAATCGTATCAAGTCCGGTGCAGAATTTGCCTATCGTTTACTAGCTCTAGAAGCACAACAAAACCAAAACTAA

Protein

No sequence available