Your browser is old and dusty. Try Google Chrome!

Details for slr7010

ORF slr7010
Accession NP_942298.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -261 -275 -0.393733 0.228
NP_442291.1_5 Forward -141 -125 -1.02311 0.192
NP_441818.1_9 Forward -188 -169 -2.26216 0.203
NP_440348.1_3 Forward -367 -348 17.8957 0.173
NP_442287.1_5 Forward -186 -176 18.2696 0.19
NP_441675.1_4 Forward -86 -67 7.27595 0.236
NP_442062.1_3 Forward -90 -71 -2.95047 0.273
NP_440761.1_8 Forward -123 -104 20.8447 0.0739
NP_440304.1_4 Forward -269 -259 3.42162 0.299
NP_442242.1_4 Forward -139 -132 9.47889 0.251
NP_441208.1_9 Reverse -272 -286 5.99778 0.254
NP_441925.1_2 Reverse -22 -41 3.6377 0.262
NP_441083.1_5 Reverse -317 -327 2.14332 0.195
NP_440056.1_9 Forward -210 -191 14.7509 0.272
NP_442111.1_4 Forward -141 -127 4.91614 0.185
NP_441837.1_5 Reverse -317 -336 20.059 0.0419
NP_442634.1_4 Reverse -345 -359 -4.91696 0.223
NP_441667.1_5 Reverse -370 -384 17.4936 0.217
NP_440057.1_6 Reverse -318 -337 13.1878 0.267
NP_441014.1_5 Forward -211 -193 11.9172 0.256
NP_443018.1_3 Reverse -95 -102 8.49558 0.141
NP_441846.1_10 Forward -285 -266 -21.24 0.256
NP_442658.1_1 Forward -247 -237 7.45273 0.214
NP_442782.1_2 Reverse -191 -205 5.21113 0.246
NP_440184.1_1 Forward -90 -71 10.0539 0.0985
NP_441256.1_1 Forward -203 -184 -6.39206 0.239
NP_442321.1_4 Forward -257 -238 -6.88371 0.284
NP_441958.1_5 Forward -357 -347 -1.78992 0.252
NP_442605.1_4 Forward -323 -304 23.5989 0.0247
NP_442836.1_5 Forward -192 -173 8.75091 0.141
NP_443001.1_7 Forward -368 -349 2.3594 0.279
NP_442690.1_1 Reverse -65 -84 -16.1268 0.283
NP_442064.1_1 Forward -126 -107 -10.6203 0.259
NP_440993.1_2 Forward -341 -325 4.68009 0.249
NP_443044.1_1 Forward -171 -152 4.52268 0.279
NP_440809.1_9 Forward -335 -317 -7.749 0.225
NP_440809.1_9 Reverse -338 -356 -8.14232 0.227
NP_442438.1_10 Reverse -95 -109 2.65453 0.17
NP_440147.1_4 Reverse -181 -194 1.59258 0.224
NP_441041.1_7 Forward -248 -236 7.02889 0.18
NP_440569.1_10 Forward -214 -195 8.54611 0.231
NP_441547.1_2 Forward -126 -108 9.36059 0.2
NP_442004.1_4 Forward -203 -184 12.0933 0.299
NP_441079.1_7 Forward -53 -34 -5.50783 0.266
NP_001035871.2_7 Forward -119 -109 13.943 0.219
NP_442049.1_6 Reverse -86 -105 12.6841 0.188
NP_441644.1_6 Reverse -266 -276 6.66608 0.152
NP_441644.1_6 Reverse -191 -201 5.78111 0.176
NP_441644.1_6 Reverse -347 -357 4.99446 0.216
NP_441751.2_8 Forward -139 -125 -3.44199 0.145
NP_441751.2_8 Reverse -348 -362 -5.90027 0.244
NP_441355.1_6 Reverse -99 -118 15.4366 0.196
NP_441371.1_3 Reverse -189 -207 5.13236 0.293
NP_440357.1_3 Forward -286 -267 0.294447 0.285
NP_441198.1_1 Reverse -177 -196 0.982764 0.238
NP_441020.2_6 Forward -269 -252 9.77361 0.162
NP_441876.1_9 Reverse -262 -272 14.0409 0.267
NP_441330.1_1 Forward -197 -178 -13.1769 0.183
NP_441637.1_9 Reverse -297 -315 -3.6191 0.296
NP_442719.1_2 Reverse -295 -313 -10.6013 0.278
NP_442719.1_2 Reverse -112 -130 -11.5846 0.292
NP_442542.1_2 Forward -277 -264 13.4906 0.114
NP_440558.1_2 Reverse -85 -104 -4.22878 0.243
NP_442789.1_4 Forward -114 -95 -4.32711 0.259
NP_442792.1_5 Reverse -107 -124 12.1336 0.272
NP_441878.1_6 Forward -276 -266 -7.98478 0.285
NP_441590.1_4 Forward -253 -234 5.30853 0.279
NP_440084.1_8 Forward -344 -330 9.27434 0.29
NP_441308.1_8 Forward -358 -348 8.82982 0.244
NP_442508.1_8 Forward -122 -105 9.97027 0.277
NP_440899.1_2 Reverse -101 -120 8.25844 0.203
NP_440899.1_8 Reverse -296 -315 -6.39206 0.231
NP_440899.1_8 Reverse -297 -316 -9.047 0.258
NP_441007.1_10 Forward -280 -267 -0.177378 0.268
NP_441449.1_8 Forward -318 -299 15.244 0.21
NP_440256.1_1 Forward -359 -340 -9.24366 0.275
NP_441270.1_4 Reverse -176 -195 15.1416 0.245
NP_440915.1_6 Forward -279 -265 2.06454 0.126
NP_442785.1_7 Forward -214 -200 10.4227 0.228
NP_442150.1_8 Forward -293 -274 16.1361 0.265
NP_440677.1_6 Forward -365 -346 9.63589 0.27
NP_442386.1_9 Forward -122 -113 6.9808 0.219
NP_440570.1_5 Reverse -108 -127 -2.36049 0.278
NP_441340.1_9 Forward -172 -162 14.8109 0.194
NP_440161.1_3 Reverse -226 -245 9.0459 0.259
NP_440586.1_8 Reverse -267 -274 5.8403 0.283
NP_440819.1_5 Forward -305 -297 7.8859 0.266
NP_440316.1_10 Forward -276 -266 13.648 0.208
NP_442887.1_5 Reverse -189 -208 -11.8003 0.27
NP_442262.1_10 Reverse -95 -102 8.59391 0.22
NP_442262.1_10 Reverse -251 -258 7.6106 0.274
NP_440282.1_7 Forward -190 -172 16.3421 0.176
NP_440531.1_6 Reverse -104 -123 -5.21209 0.294
NP_442129.1_6 Forward -212 -193 13.9464 0.246
NP_440999.1_9 Reverse -179 -193 -1.96703 0.254
NP_442845.1_2 Forward -362 -348 6.3911 0.21
NP_442710.1_7 Forward -54 -35 -6.26165 0.294
NP_442578.1_7 Forward -139 -132 9.28223 0.152
NP_442204.1_1 Forward -360 -349 7.53183 0.127
NP_441560.1_8 Reverse -83 -102 14.9213 0.129
NP_440516.1_8 Forward -275 -266 -0.196935 0.185
NP_442694.1_4 Reverse -237 -246 11.1111 0.279
NP_441966.1_7 Forward -125 -106 1.86696 0.2
NP_440508.1_4 Forward -362 -343 25.3688 0.00641
NP_440389.1_5 Reverse -373 -392 15.0183 0.213
NP_440389.1_5 Reverse -105 -124 11.9332 0.277
NP_440432.1_9 Reverse -267 -282 -4.05167 0.196
NP_442006.1_2 Forward -284 -267 -17.5624 0.279
NP_442006.1_3 Forward -281 -263 2.0841 0.238
NP_440526.1_3 Reverse -267 -278 9.49793 0.0826
NP_441432.1_8 Reverse -244 -253 4.22796 0.235
NP_441432.1_8 Forward -116 -107 4.22796 0.235
NP_442447.1_1 Forward -311 -292 4.32602 0.281
NP_441659.2_8 Reverse -347 -357 3.61828 0.154
NP_441659.2_8 Reverse -266 -276 1.25834 0.245
NP_442749.1_5 Forward -312 -295 6.77759 0.291
NP_441092.1_3 Forward -138 -119 0.491109 0.269
NP_441786.1_3 Forward -120 -101 8.84924 0.238
NP_440459.1_2 Forward -106 -89 9.97027 0.212
NP_440010.1_10 Reverse -188 -207 2.45773 0.277
NP_442311.1_5 Reverse -191 -210 -0.4922 0.292
NP_440847.1_3 Reverse -267 -281 13.077 0.224
NP_441050.1_5 Forward -124 -106 -3.12744 0.286
NP_443040.1_1 Forward -171 -157 10.2806 0.291
NP_441112.1_8 Forward -147 -128 5.99764 0.23
NP_442140.1_3 Reverse -267 -277 7.45319 0.14
NP_442254.1_1 Reverse -82 -101 -5.99873 0.297
NP_441239.1_9 Reverse -264 -276 5.34885 0.223
NP_442193.1_3 Forward -126 -107 14.5362 0.299
NP_440212.1_9 Reverse -36 -55 2.96396 0.235
NP_440212.1_9 Forward -54 -35 2.57952 0.244
NP_441617.1_6 Reverse -295 -314 21.1406 0.0161
NP_442809.1_1 Forward -368 -349 8.84842 0.299
NP_440546.1_4 Reverse -347 -357 6.45857 0.296
NP_441230.1_5 Forward -132 -113 -0.983855 0.295
NP_440024.1_8 Reverse -75 -94 15.5349 0.284
NP_442340.1_3 Reverse -96 -115 -9.93197 0.277
NP_442499.1_1 Forward -253 -234 8.55425 0.203
NP_442402.1_4 Reverse -92 -111 -9.44104 0.29
NP_441084.1_6 Reverse -109 -123 9.34412 0.287
NP_442039.1_7 Reverse -114 -124 15.3197 0.211
NP_442891.1_5 Forward -297 -287 15.8718 0.293
NP_441252.1_6 Forward -208 -201 14.3954 0.168
NP_441697.1_5 Reverse -35 -54 3.38954 0.177
NP_441286.1_1 Reverse -255 -267 -7.04085 0.3
NP_440083.1_8 Reverse -153 -172 11.1109 0.19
NP_441463.1_3 Reverse -96 -115 -6.58872 0.246
NP_442794.1_1 Reverse -127 -139 4.16888 0.276
NP_440114.1_10 Forward -275 -261 10.521 0.146
NP_442357.1_8 Forward -248 -229 7.66927 0.241
NP_441332.1_6 Reverse -265 -275 11.4531 0.26
NP_442130.1_9 Forward -211 -192 7.96426 0.267
NP_440473.1_9 Forward -286 -267 -11.0136 0.288
NP_442509.1_9 Forward -245 -235 8.3377 0.192
NP_442341.1_7 Reverse -316 -330 1.96621 0.274
NP_441173.1_9 Forward -124 -116 13.2937 0.17
NP_440423.1_6 Forward -283 -264 -12.0953 0.184
NP_440275.1_3 Forward -277 -267 4.40493 0.196
NP_442451.1_7 Forward -314 -295 9.83255 0.248
NP_442495.1_4 Forward -285 -275 10.8948 0.296
NP_442214.1_1 Reverse -232 -251 12.1925 0.226
NP_442373.1_10 Reverse -100 -119 7.17762 0.2
NP_440216.1_9 Reverse -114 -123 7.57121 0.286
NP_440216.1_9 Forward -101 -92 7.17789 0.286
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATCTTGAAGTTGACTAGCTTGTTGAGAAAAACCCATTTGTTCAAGGAGATGGGTTGCTAAATAAAGAGCTTGACGCTGATCTGCGGAGAGAATAACGGGAAAATTTGACTTCTTGAGGACATAGGGACGATGGGGCGCACTCTCAATCTCAAAGCCACAATCCCGCAGTTTTCGGATAGTACGAGTCAGCTTTTGGGCAACATCATCGGCAGGTTGCTGATGCTGTTCTAGAAAAAGTTCTAATTGCTCTGTGAGATTTTTGCGATAACAAGGCTCTTTTGCCAAGGCTTTGAGGACTTCAATGGCAAAGGTTAAGGAATTGTATTGAAATTTCATACTAGTCTTCAAACAAATATTATCTATTTTAGACTACAACTTTAATTTGAGAGGGTTTAAAATT

CDS

ATGTCATTGCCCAAAGTAGGTGCTATGAAAGTTCAAGTTAAGCCTCTCTATGCCAAGCTCAATGAGGGTTTAGGTCAATGCCCGTTAGGTTGTCAGTCGGTTTGTACGGTTAGGGAGCAAGCTCCTGAAATGCAACCTCCCGATGGCTGTAGTTGTCCTCTTTATGACCACCAAGCCCAAACCTATGCTCTTACAACCGCAGGTGATACAGATATTATCTTTAACCGTGTGGCGACAGGTGGCGGTAAATCTTTGGGAGCAACACTGCCTGCTTTGCTCCCTAAAGTTCATCCAGATTTTCGAGTGATGGGACTCTATCCAACGATTGAGTTAGTAGAGGATCAGTACCGACAGCAGCAGCAATATCATCAGATGTTTGGTCTGAATGCAGAAAAACGAGTTGATCGCCTTTATGGTGCAGAGTTAGCCCGACGGATTAGCGAAAAAGATAGTAATCGGTTTCAAGAATTATTGAAATCTATTGAACAAAAACCTGTCATTCAGACAAATCCAGATATTTTTCACTACATTACTCATTTTCGGTATCGAGATAATGCTCGCAGTCAATCTGAATTACCAATGGTCATGGCTAAGTTTCCTGATCTATGGGTTTTTGATGAATTTCATATTTTTGGAGAACATCAAATGGCAGCGGCGTTGAATAGTTTGTTATTGATTCGTCATGCAACCCAAAGTAAGCGCAAGTTTTTGTTTACTTCTGCGACACCGAAAACAAGTTTTGTAGAGAGCTTAAAAAATAGTGGATTTAAGATTGCAGAGATTCAGGGTGAATATAGCGATCGCCCCCAGCAAGGGTATCGACAAATCTTACAGAATATTAATCTAGAATTTGTTCATTTAAAAGATACTGATACAGAAAGTTGGCTATTAGCACAATCTCAAAACCTGCGAGATCTATTACATCAAGAAAAAAATGGTCGGGGCTTAATTATTGTTAATTCCGTCGCTGCGGCAGGTCATTTGTGTCGAAATCTATCAAAAATATTACCTGATGTGGAAGTTAGAGAAATTAGCGGTAGATGCGATCGCCAAGAACGTCAGCAAACCCAAACTTATTTGCAGAAGTCAGAAAAATCTGTCCTAGTCGTTGCAACATCGGCAGTGGATGTAGGTGTTGATTTTAAAATTCATGTACTCATTTGTGAAAGTAGTGATTCCGCAACGGTTATTCAAAGATTAGGGCGTTTAGGTCGTCATGGAGGCTTTCAACAGTATCAAGCTTATGTCTTAATTCCATCCCAAACCCAATGGGTAATAGCTAGTCTTAAAGAGGAATTAGAAGAGGACTCTTCAATTGATAGATTGGAATTAAGCACAGTCATTGAAACAGCATTTAATGCACCACAGGAATTTAAACAGTATCAAAAAATATGGGGAGAATTACAAGCACAGGGAATGTTATACCAAATGGTTTATGGCGGTTCTAGAAGTGAGTCTAAAGATAATTTAGCTGTTACTCAAGATTTGCGCGATCGCATGATTGAAAGTCTAGAAAAAATTTATCAAAAACAAATTAATGGTTTTGGTAGATGGTGGGGTTTAAGTAATGACGCTGTAGGTAAAGCTACTCAAGAGGAATTGCTCCGATTTAGAGGGGGATCTTCTTTACAGTCAGGGATTTGGGATGGCGATCGCTTGTATTCCTATGACCTTTTAAAAGTTTTAACCTATGCCACTGTTGAAGTCATTGACCGAGAAATATTTCTCGAAGCAGCTCAAAAATTGAACCATGGAATAGAAGAATTTCCCGAACAATACCTAACTGGATATTTCAAAATTACTAAATGGCTCGATCAGCGTCTTAATTTTTCCCTTTTTTCTACCCATAGTCATCTTGCTAGCTGTCAACTTATGCTATTAGACCGACTCCAATTAAAAGGACATATCCAACCAGAATTGAGTCGTTGTTTGGGTCGTAGGAAATATCTTGCCTATCTTGTTCCAATCAATCGCAATAATCCTTCTAGCCATTGGGATATTAGTCGCAAATTACGCCTTAGCCCTCTTTTTGGGTTATATCGTCTGACGGATAGTGGCGGGAATGCTTACGGTTGTGCGTTTAACCATGATGCTTTATTGCTTGAAGCTTTGAAGTGGCGGTTAGGGGATTTTTGTAAACAAGCCACCAGTCAATCTTTAATTTTTTAA

Protein

No sequence available