Your browser is old and dusty. Try Google Chrome!

Details for slr7008

ORF slr7008
Accession NP_942296.1
Symbol
Category Transposon-related functions
Definition putative transposase [ISY203k: 4154 - 5327]
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -189 -175 2.5562 0.174
NP_441061.1_2 Reverse -336 -350 -1.8687 0.274
NP_440557.1_1 Forward -343 -324 -1.08219 0.27
NP_440795.1_7 Forward -343 -336 14.6904 0.0123
NP_440795.1_7 Reverse -336 -343 14.6904 0.0123
NP_440795.1_7 Forward -189 -182 14.6904 0.0123
NP_440795.1_7 Reverse -182 -189 14.6904 0.0123
NP_441418.1_2 Forward -75 -57 15.7521 0.0797
NP_441418.1_6 Reverse -335 -354 -9.53865 0.0288
NP_441418.1_6 Forward -356 -337 -21.1417 0.139
NP_442657.1_5 Forward -131 -117 18.3461 0.175
NP_440815.1_5 Forward -190 -171 4.52268 0.286
NP_442291.1_5 Reverse -180 -196 17.9548 0.0165
NP_442291.1_5 Forward -191 -175 6.05672 0.0727
NP_440897.1_6 Reverse -335 -354 -0.984623 0.187
NP_441453.1_1 Forward -351 -333 3.95163 0.263
NP_441453.1_4 Forward -190 -182 16.6374 0.00633
NP_441453.1_4 Reverse -335 -343 16.539 0.00633
NP_441453.1_4 Reverse -181 -189 16.539 0.00633
NP_441453.1_4 Forward -344 -336 16.539 0.00633
NP_442151.1_6 Forward -344 -330 17.0108 0.013
NP_441818.1_1 Reverse -182 -193 16.2827 0.0199
NP_440226.1_1 Reverse -181 -200 22.3206 0.00612
NP_440226.1_1 Forward -344 -325 21.9273 0.00612
NP_440226.1_1 Forward -190 -171 11.7008 0.0509
NP_440226.1_1 Reverse -335 -354 7.66927 0.102
NP_441098.1_3 Forward -21 -2 -0.663914 0.25
NP_441098.1_3 Forward -230 -211 -4.20496 0.28
NP_442744.1_9 Forward -196 -182 13.1262 0.28
NP_442173.1_1 Reverse -182 -190 17.3257 0.00633
NP_442173.1_1 Forward -343 -335 15.4574 0.00633
NP_442173.1_1 Forward -189 -181 15.4574 0.00633
NP_442173.1_1 Reverse -336 -344 15.4574 0.00633
NP_442752.1_4 Forward -344 -337 13.8055 0.0199
NP_442752.1_4 Reverse -335 -342 13.8055 0.0199
NP_442752.1_4 Reverse -181 -188 13.8055 0.0199
NP_443027.1_4 Forward -192 -182 15.5163 0.0437
NP_443027.1_4 Reverse -333 -343 15.3197 0.0437
NP_443027.1_4 Reverse -179 -189 13.1564 0.0521
NP_443027.1_4 Forward -346 -336 11.8781 0.0872
NP_441812.1_3 Forward -345 -331 12.6843 0.197
NP_441812.1_3 Reverse -180 -194 10.7177 0.221
NP_442975.1_10 Forward -348 -334 12.782 0.0459
NP_442975.1_10 Forward -194 -180 12.2903 0.0477
NP_442975.1_10 Reverse -331 -345 10.9137 0.0516
NP_440784.1_7 Forward -343 -336 15.9687 0.0123
NP_440784.1_7 Reverse -336 -343 15.9687 0.0123
NP_440784.1_7 Forward -189 -182 15.9687 0.0123
NP_440784.1_7 Reverse -182 -189 15.9687 0.0123
NP_442909.1_7 Forward -189 -175 9.53707 0.145
NP_440061.1_9 Forward -192 -178 15.5352 0.0426
NP_440061.1_9 Forward -346 -332 10.0287 0.131
NP_441054.1_4 Reverse -325 -343 -0.964162 0.191
NP_440631.1_9 Reverse -378 -397 12.169 0.286
NP_442062.1_8 Reverse -335 -345 19.4496 0.000558
NP_442062.1_8 Reverse -181 -191 17.0896 0.0025
NP_442062.1_8 Forward -190 -180 14.9263 0.0108
NP_442062.1_8 Forward -344 -334 10.3048 0.0493
NP_441859.1_3 Reverse -334 -353 8.16011 0.144
NP_441859.1_3 Forward -357 -338 5.11187 0.206
NP_440304.1_4 Reverse -333 -343 18.9579 0.00406
NP_440304.1_4 Reverse -179 -189 9.91146 0.051
NP_440304.1_4 Forward -346 -336 1.84832 0.299
NP_442242.1_4 Forward -343 -336 14.3954 0.0124
NP_442242.1_4 Reverse -336 -343 14.3954 0.0124
NP_442242.1_4 Forward -189 -182 14.3954 0.0124
NP_442242.1_4 Reverse -182 -189 14.3954 0.0124
NP_440044.1_8 Reverse -182 -201 1.57275 0.17
NP_440044.1_8 Forward -189 -170 -3.04881 0.277
NP_441208.1_9 Reverse -47 -61 8.94771 0.219
NP_441208.1_9 Reverse -332 -346 6.09611 0.253
NP_440370.1_10 Reverse -326 -345 9.73422 0.217
NP_442110.1_7 Forward -344 -330 1.57289 0.222
NP_442110.1_7 Forward -190 -176 0.88457 0.245
NP_440856.1_4 Forward -351 -332 -1.18052 0.193
NP_441083.1_5 Reverse -335 -345 11.3864 0.0159
NP_441083.1_5 Forward -344 -334 11.2881 0.0159
NP_441083.1_5 Forward -190 -180 11.0914 0.0166
NP_441083.1_5 Reverse -181 -191 10.5014 0.0197
NP_442827.1_8 Forward -352 -333 2.6536 0.156
NP_442827.1_8 Reverse -327 -346 -0.886293 0.236
NP_441434.1_7 Forward -342 -328 9.43936 0.205
NP_441434.1_7 Reverse -73 -87 1.57289 0.299
NP_441738.1_2 Forward -342 -335 15.28 0.0102
NP_441738.1_2 Reverse -337 -344 15.28 0.0102
NP_441738.1_2 Forward -188 -181 15.28 0.0102
NP_441738.1_2 Reverse -183 -190 11.5435 0.084
NP_441558.1_5 Forward -346 -327 14.7491 0.0474
NP_441558.1_5 Reverse -333 -352 13.6675 0.0561
NP_440209.1_1 Reverse -335 -343 18.1123 0.00295
NP_440209.1_1 Reverse -181 -189 18.1123 0.00295
NP_440209.1_1 Forward -344 -336 18.1123 0.00295
NP_440209.1_1 Forward -190 -182 8.57422 0.0425
NP_442889.1_8 Forward -347 -333 4.03056 0.27
NP_440447.1_6 Forward -352 -334 16.7354 0.042
NP_441713.1_1 Reverse -175 -194 -16.1268 0.277
NP_440178.1_7 Forward -345 -326 -2.16383 0.0347
NP_440178.1_7 Reverse -180 -199 -15.2418 0.159
NP_440178.1_7 Forward -191 -172 -22.6167 0.268
NP_441716.1_1 Forward -190 -176 7.86607 0.156
NP_441716.1_1 Reverse -335 -349 3.93283 0.259
NP_441327.1_5 Forward -200 -191 16.6177 0.111
NP_442111.1_4 Reverse -334 -348 18.1908 0.0079
NP_442111.1_4 Forward -191 -177 10.9143 0.0518
NP_442111.1_4 Forward -345 -331 2.65453 0.268
NP_442111.1_4 Forward -105 -91 1.86788 0.293
NP_441163.1_9 Forward -353 -334 13.3725 0.236
NP_440343.1_5 Reverse -293 -312 15.8307 0.171
NP_440906.1_5 Forward -343 -336 15.8704 0.0124
NP_440906.1_5 Reverse -336 -343 15.8704 0.0124
NP_440906.1_5 Forward -189 -182 15.8704 0.0124
NP_440906.1_5 Reverse -182 -189 15.8704 0.0124
NP_440747.1_10 Reverse -178 -190 7.4138 0.00422
NP_440747.1_10 Forward -347 -335 7.21714 0.00643
NP_440747.1_10 Reverse -332 -344 -2.02597 0.0196
NP_440747.1_10 Forward -193 -181 -2.22263 0.026
NP_441130.1_10 Forward -346 -332 8.16106 0.14
NP_441486.1_1 Forward -193 -179 12.8809 0.00979
NP_441486.1_1 Reverse -178 -192 4.91614 0.0399
NP_442634.1_4 Forward -346 -332 6.19444 0.0508
NP_442634.1_4 Reverse -179 -193 -2.95034 0.157
NP_442634.1_4 Reverse -333 -347 -3.44199 0.161
NP_442634.1_4 Forward -358 -344 -4.81863 0.22
NP_441014.1_10 Reverse -180 -199 8.84842 0.125
NP_442848.1_1 Reverse -175 -189 15.0442 0.0169
NP_442848.1_1 Forward -196 -182 14.5526 0.0196
NP_443018.1_3 Forward -343 -336 14.8871 0.0123
NP_443018.1_3 Reverse -336 -343 14.8871 0.0123
NP_443018.1_3 Forward -189 -182 14.8871 0.0123
NP_443018.1_3 Reverse -182 -189 14.8871 0.0123
NP_441316.1_7 Forward -346 -331 -3.16669 0.273
NP_441634.1_8 Forward -346 -332 -3.04867 0.295
NP_440376.1_1 Forward -344 -335 19.4693 0.000692
NP_440376.1_1 Reverse -335 -344 19.4693 0.000692
NP_440376.1_1 Forward -190 -181 9.73449 0.0365
NP_440376.1_1 Reverse -181 -190 9.63616 0.0385
NP_441588.1_4 Reverse -183 -193 9.32148 0.14
NP_442687.1_7 Forward -345 -335 15.8113 0.0125
NP_442687.1_7 Reverse -334 -344 9.02648 0.0994
NP_442687.1_7 Reverse -180 -190 7.94484 0.121
NP_442191.1_4 Reverse -336 -350 11.284 0.263
NP_442530.1_3 Forward -146 -132 21.4357 0.0453
NP_440642.1_8 Reverse -337 -356 21.2169 0.0267
NP_441422.1_7 Forward -346 -329 6.43035 0.0992
NP_441422.1_7 Forward -192 -175 -1.23946 0.183
NP_440236.1_2 Forward -46 -28 -4.99573 0.277
NP_442658.1_1 Forward -346 -336 17.0891 0.00615
NP_442658.1_1 Reverse -333 -343 15.9091 0.00966
NP_442658.1_1 Reverse -179 -189 9.616 0.147
NP_442658.1_1 Forward -192 -182 5.87944 0.246
NP_442782.1_7 Reverse -173 -192 -0.000545616 0.255
NP_442205.1_9 Reverse -329 -345 -2.20308 0.268
NP_440656.1_8 Forward -201 -182 -8.16202 0.273
NP_441414.1_9 Reverse -335 -354 -1.7705 0.105
NP_441414.1_9 Forward -344 -325 -2.85214 0.124
NP_441414.1_9 Forward -190 -171 -3.73712 0.141
NP_440184.1_7 Reverse -59 -78 13.5099 0.28
NP_441487.1_9 Reverse -180 -199 3.73603 0.154
NP_441487.1_9 Forward -345 -326 -2.75381 0.293
NP_442321.1_4 Reverse -39 -58 -7.76869 0.284
NP_441317.1_4 Reverse -51 -65 14.143 0.161
NP_441317.1_4 Reverse -53 -67 14.0475 0.161
NP_441958.1_5 Reverse -334 -344 21.2195 0.000805
NP_441958.1_5 Forward -345 -335 12.2714 0.00183
NP_441958.1_5 Reverse -180 -190 10.9931 0.00875
NP_441958.1_5 Forward -191 -181 2.53664 0.0409
NP_442836.1_5 Reverse -175 -194 1.17943 0.287
NP_440203.1_5 Forward -187 -177 9.91099 0.245
NP_439905.1_1 Reverse -336 -349 8.37742 0.234
NP_439905.1_1 Forward -343 -330 7.09911 0.268
NP_440984.1_7 Reverse -330 -344 18.9775 0.0106
NP_441097.1_2 Reverse -274 -291 6.43035 0.257
NP_439990.1_5 Forward -349 -336 13.589 0.0935
NP_442911.1_2 Forward -354 -335 7.47261 0.0245
NP_442911.1_2 Reverse -325 -344 -3.3438 0.111
NP_442911.1_2 Reverse -171 -190 -3.73712 0.117
NP_440153.1_5 Forward -343 -329 13.6676 0.0551
NP_440153.1_5 Forward -189 -175 8.16106 0.149
NP_440153.1_8 Forward -190 -177 4.73917 0.193
NP_443055.1_6 Forward -344 -326 -1.6532 0.281
NP_440993.1_2 Reverse -330 -346 13.6282 0.0656
NP_440993.1_2 Forward -195 -179 8.515 0.143
NP_440993.1_3 Forward -354 -335 10.0284 0.116
NP_440388.1_7 Forward -32 -13 0.491109 0.251
NP_440602.1_8 Reverse -181 -195 17.7975 0.0898
NP_441348.1_3 Reverse -330 -349 16.0274 0.135
NP_441099.1_5 Forward -354 -335 -11.0136 0.27
NP_441099.1_5 Reverse -171 -190 -11.8003 0.29
NP_442002.1_9 Forward -345 -338 10.7572 0.185
NP_440809.1_9 Forward -353 -335 2.0841 0.118
NP_441294.1_7 Forward -194 -180 11.3624 0.147
NP_441646.1_1 Forward -351 -332 4.42435 0.193
NP_441646.1_1 Reverse -174 -193 1.47442 0.231
NP_442438.1_10 Reverse -176 -190 3.24451 0.165
NP_442438.1_10 Forward -195 -181 -1.18038 0.296
NP_441000.1_6 Reverse -334 -348 -2.36035 0.216
NP_441000.1_6 Reverse -180 -194 -5.01529 0.257
NP_441000.1_6 Forward -345 -331 -5.40861 0.275
NP_442771.1_1 Reverse -333 -351 -7.749 0.173
NP_441674.1_6 Forward -326 -307 4.03102 0.261
NP_440147.1_4 Forward -346 -333 18.8005 0.00359
NP_440147.1_4 Reverse -333 -346 10.049 0.0355
NP_440147.1_4 Forward -192 -179 9.45906 0.0401
NP_440147.1_4 Forward -220 -207 0.215946 0.261
NP_440147.1_4 Reverse -179 -192 0.0192843 0.268
NP_441175.1_7 Forward -190 -171 5.60432 0.276
NP_441550.1_8 Reverse -333 -343 17.4824 0.00754
NP_441550.1_8 Reverse -179 -189 16.7941 0.00906
NP_441550.1_8 Forward -346 -336 8.82935 0.112
NP_441550.1_8 Forward -192 -182 7.55106 0.154
NP_441916.1_7 Forward -344 -334 18.9579 0.00144
NP_441916.1_7 Reverse -335 -345 18.4663 0.00144
NP_441916.1_7 Forward -190 -180 10.9931 0.0261
NP_441916.1_7 Reverse -181 -191 8.23984 0.0476
NP_441041.1_4 Reverse -335 -354 -10.1286 0.228
NP_441041.1_7 Reverse -332 -344 8.87526 0.128
NP_441041.1_7 Forward -347 -335 8.48655 0.135
NP_441041.1_7 Reverse -178 -190 5.86276 0.236
NP_442396.1_6 Reverse -151 -165 18.728 0.254
NP_442004.1_6 Forward -190 -176 7.66941 0.157
NP_441725.1_4 Forward -349 -335 3.14559 0.279
NP_441725.1_5 Forward -189 -179 9.02648 0.0553
NP_441725.1_5 Forward -343 -333 8.92815 0.0553
NP_441725.1_5 Reverse -182 -192 2.24165 0.115
NP_441725.1_5 Reverse -336 -346 2.04498 0.115
NP_439966.1_7 Forward -346 -336 17.9741 0.00631
NP_439966.1_7 Reverse -179 -189 14.8275 0.0177
NP_439966.1_7 Reverse -333 -343 13.8442 0.0234
NP_439966.1_7 Forward -192 -182 7.55106 0.15
NP_439966.1_8 Forward -176 -157 9.83255 0.152
NP_439966.1_9 Reverse -333 -342 0.983037 0.253
NP_439966.1_9 Forward -346 -337 0.884706 0.253
NP_439966.1_9 Reverse -179 -188 0.884706 0.253
NP_442941.1_3 Reverse -182 -192 17.3846 0.00735
NP_442941.1_3 Forward -343 -333 10.9931 0.0116
NP_442941.1_3 Forward -189 -179 10.9931 0.0116
NP_442941.1_3 Reverse -336 -346 10.7964 0.0116
NP_440289.1_2 Forward -347 -334 4.34585 0.0673
NP_440289.1_2 Forward -193 -180 4.34585 0.0673
NP_440289.1_2 Reverse -332 -345 -4.50394 0.288
NP_442281.1_1 Forward -195 -181 18.4851 0.0043
NP_442281.1_1 Reverse -330 -344 6.58715 0.122
NP_442281.1_1 Reverse -176 -190 3.8339 0.217
NP_442281.1_1 Forward -349 -335 2.5556 0.263
NP_440437.1_1 Forward -350 -331 -3.3438 0.234
NP_440647.1_9 Forward -346 -328 14.2771 0.113
NP_440498.1_1 Reverse -326 -344 10.0489 0.0786
NP_442982.1_5 Reverse -325 -344 8.45592 0.12
NP_441644.1_6 Forward -344 -334 19.0557 0.000803
NP_441644.1_6 Forward -190 -180 15.0242 0.00766
NP_441644.1_6 Reverse -335 -345 10.1076 0.0628
NP_441644.1_6 Reverse -181 -191 7.94438 0.113
NP_442215.1_2 Reverse -179 -195 -7.61128 0.3
NP_442029.1_6 Reverse -330 -349 2.85105 0.286
NP_442247.1_8 Forward -346 -332 11.2093 0.247
NP_440253.1_2 Reverse -181 -199 13.4905 0.0221
NP_440253.1_2 Reverse -335 -353 11.8189 0.0302
NP_440929.1_8 Forward -344 -335 19.2726 0.000701
NP_440929.1_8 Reverse -335 -344 19.2726 0.000701
NP_440929.1_8 Forward -190 -181 9.93116 0.0249
NP_440929.1_8 Reverse -181 -190 9.83282 0.0254
NP_441346.1_7 Forward -360 -341 8.84924 0.293
NP_442933.1_10 Forward -344 -335 17.601 0.00325
NP_442933.1_10 Reverse -335 -344 17.601 0.00325
NP_442933.1_10 Forward -190 -181 17.601 0.00325
NP_442933.1_10 Reverse -181 -190 17.601 0.00325
NP_441751.2_8 Forward -189 -175 15.9292 0.0109
NP_441751.2_8 Reverse -182 -196 -4.32697 0.17
NP_442554.1_8 Forward -343 -333 19.1546 0.00369
NP_442554.1_8 Forward -189 -179 18.0729 0.00543
NP_442554.1_8 Reverse -336 -346 14.1397 0.0144
NP_442554.1_8 Reverse -182 -192 6.27322 0.123
NP_442554.1_8 Reverse -348 -358 2.43831 0.272
NP_442554.1_9 Reverse -83 -102 13.7411 0.279
NP_441762.1_7 Forward -345 -333 11.7404 0.0142
NP_441762.1_7 Forward -191 -179 4.46387 0.0477
NP_441762.1_7 Reverse -334 -346 3.08724 0.0676
NP_442142.1_4 Reverse -178 -191 11.9167 0.0504
NP_442142.1_4 Forward -193 -180 7.2952 0.143
NP_442142.1_4 Forward -347 -334 6.50855 0.163
NP_442142.1_4 Reverse -332 -345 6.21356 0.17
NP_442292.1_1 Forward -189 -180 18.486 0.00229
NP_442292.1_1 Forward -343 -334 17.5026 0.00435
NP_442292.1_1 Reverse -336 -345 9.63616 0.0183
NP_442292.1_1 Reverse -182 -191 9.53783 0.0183
NP_442476.1_6 Forward -189 -175 14.3559 0.0401
NP_442476.1_6 Forward -343 -329 3.14618 0.161
NP_442381.1_8 Reverse -332 -351 -14.2585 0.28
NP_442381.1_8 Forward -347 -328 -14.4552 0.28
NP_441711.1_4 Reverse -326 -345 15.9291 0.0429
NP_443009.1_2 Reverse -337 -356 0.491109 0.216
NP_443009.1_5 Reverse -334 -345 19.626 0.00102
NP_443009.1_5 Reverse -180 -191 7.82632 0.118
NP_443009.1_5 Forward -345 -334 7.82632 0.118
NP_443009.1_5 Forward -191 -180 4.8764 0.226
NP_441741.1_6 Reverse -43 -62 7.96426 0.249
NP_441715.1_4 Reverse -336 -346 18.8596 0.00741
NP_441715.1_4 Reverse -182 -192 13.5497 0.0431
NP_441715.1_4 Forward -189 -179 7.84651 0.107
NP_441715.1_4 Forward -343 -333 7.25653 0.108
NP_442305.1_6 Forward -318 -308 16.5975 0.202
NP_440881.1_10 Forward -189 -176 14.7689 0.249
NP_440015.1_9 Forward -190 -172 -1.16082 0.272
NP_441198.1_5 Forward -342 -329 12.7034 0.216
NP_441198.1_8 Reverse -333 -343 15.4199 0.0427
NP_441468.1_1 Forward -343 -336 15.8704 0.0124
NP_441468.1_1 Reverse -336 -343 15.8704 0.0124
NP_441468.1_1 Forward -189 -182 15.8704 0.0124
NP_441468.1_1 Reverse -182 -189 15.8704 0.0124
NP_441020.2_6 Reverse -333 -350 11.7402 0.112
NP_441020.2_6 Reverse -345 -362 7.31533 0.235
NP_441015.1_10 Reverse -330 -349 -4.81876 0.212
NP_441673.1_1 Forward -344 -335 20.8459 0.000698
NP_441673.1_1 Reverse -335 -344 20.8459 0.000698
NP_441673.1_1 Forward -190 -181 11.1111 0.0121
NP_441673.1_1 Reverse -181 -190 11.0128 0.018
NP_441826.1_2 Reverse -175 -189 18.7808 0.0115
NP_441826.1_2 Forward -196 -182 1.47456 0.151
NP_441826.1_2 Reverse -329 -343 -3.147 0.283
NP_441330.1_1 Reverse -330 -349 7.37428 0.0252
NP_442490.1_9 Reverse -335 -354 -4.81876 0.273
NP_442490.1_9 Forward -356 -337 -9.047 0.299
NP_442868.1_6 Reverse -179 -189 17.4829 0.012
NP_442868.1_6 Forward -346 -336 10.3048 0.038
NP_442868.1_6 Reverse -333 -343 8.63316 0.0555
NP_442868.1_6 Forward -192 -182 1.06167 0.205
NP_442427.1_8 Reverse -326 -345 7.47261 0.214
NP_442427.1_8 Forward -199 -180 6.88262 0.227
NP_442808.1_1 Forward -345 -335 18.4657 0.00201
NP_442808.1_1 Reverse -334 -344 8.73102 0.0481
NP_441849.1_2 Reverse -7 -26 1.76618 0.245
NP_440145.1_3 Forward -200 -181 17.109 0.00972
NP_440145.1_3 Reverse -171 -190 15.4374 0.0121
NP_440145.1_3 Reverse -325 -344 -6.09707 0.288
NP_442718.1_2 Forward -24 -5 -5.11376 0.292
NP_442542.1_2 Reverse -179 -192 11.1307 0.114
NP_442050.1_5 Reverse -333 -343 17.1874 0.00812
NP_442050.1_5 Reverse -179 -189 15.6142 0.01
NP_442050.1_5 Forward -192 -182 15.6142 0.01
NP_442050.1_5 Forward -346 -336 6.96107 0.27
NP_442903.1_2 Reverse -219 -238 9.7875 0.165
NP_440558.1_2 Reverse -172 -191 -7.08038 0.287
NP_440558.1_2 Forward -199 -180 -7.4737 0.294
NP_441518.1_3 Forward -200 -181 -4.91709 0.121
NP_441518.1_3 Reverse -171 -190 -13.4719 0.264
NP_441878.1_6 Reverse -334 -344 10.5014 0.0176
NP_441878.1_6 Forward -345 -335 10.4031 0.0176
NP_441878.1_6 Forward -191 -181 0.668351 0.139
NP_441878.1_6 Reverse -180 -190 0.57002 0.14
NP_441036.1_8 Forward -345 -335 17.7779 0.000554
NP_441036.1_8 Reverse -334 -344 15.713 0.00724
NP_441036.1_8 Forward -191 -181 8.04317 0.177
NP_441557.1_5 Forward -344 -335 19.9609 0.000699
NP_441557.1_5 Reverse -335 -344 19.9609 0.000699
NP_441557.1_5 Reverse -181 -190 18.6826 0.0015
NP_441557.1_5 Forward -190 -181 10.5211 0.00695
NP_441445.1_1 Reverse -172 -191 1.27776 0.259
NP_442066.2_9 Forward -360 -347 17.2272 0.0329
NP_442066.2_9 Reverse -331 -344 12.114 0.154
NP_442066.2_9 Forward -348 -335 10.8357 0.154
NP_442419.1_2 Forward -349 -330 -2.65548 0.247
NP_440084.1_8 Reverse -39 -53 11.9481 0.241
NP_441308.1_8 Reverse -333 -343 12.4681 0.218
NP_441458.1_8 Forward -113 -94 1.90769 0.295
NP_442919.1_3 Forward -67 -48 32.3539 0.000000334
NP_442183.1_1 Forward -344 -330 9.2427 0.0999
NP_442183.1_1 Reverse -181 -195 8.55439 0.113
NP_442183.1_1 Forward -190 -176 6.58777 0.168
NP_442166.1_7 Reverse -336 -350 9.83269 0.19
NP_441574.1_1 Forward -356 -337 -3.44213 0.238
NP_440157.1_5 Forward -309 -290 16.09 0.265
NP_442347.1_2 Forward -189 -180 12.4878 0.056
NP_442347.1_2 Reverse -336 -345 11.1111 0.056
NP_442347.1_2 Forward -343 -334 3.34298 0.284
NP_442347.1_2 Reverse -182 -191 2.94966 0.292
NP_442645.1_2 Reverse -173 -192 -13.6686 0.162
NP_441037.1_4 Reverse -333 -343 16.5761 0.0168
NP_441037.1_4 Reverse -179 -189 9.55921 0.21
NP_441037.1_4 Forward -346 -336 6.92787 0.237
NP_441633.1_3 Forward -346 -333 15.3589 0.0103
NP_441633.1_3 Forward -192 -179 -3.61896 0.177
NP_441633.1_3 Reverse -333 -346 -5.78224 0.236
NP_440136.1_2 Forward -343 -336 15.9687 0.0123
NP_440136.1_2 Reverse -336 -343 15.9687 0.0123
NP_440136.1_2 Forward -189 -182 15.9687 0.0123
NP_440136.1_2 Reverse -182 -189 15.9687 0.0123
NP_441728.2_4 Reverse -251 -270 11.3154 0.293
NP_442998.1_10 Forward -342 -335 15.5754 0.0102
NP_442998.1_10 Reverse -337 -344 15.5754 0.0102
NP_442998.1_10 Forward -188 -181 15.5754 0.0102
NP_442998.1_10 Reverse -183 -190 5.74231 0.255
NP_440899.1_8 Reverse -8 -27 -10.3253 0.277
NP_440299.1_1 Forward -348 -335 18.5049 0.00393
NP_440299.1_1 Reverse -177 -190 18.2099 0.00451
NP_440299.1_1 Reverse -331 -344 3.46031 0.243
NP_440299.1_1 Forward -80 -67 2.87033 0.269
NP_441799.1_1 Reverse -331 -345 14.0603 0.0274
NP_441799.1_1 Reverse -177 -191 12.6836 0.0415
NP_441799.1_1 Forward -194 -180 9.14375 0.0988
NP_441799.1_1 Forward -348 -334 4.42388 0.25
NP_440977.1_1 Forward -87 -68 37.3652 0.000000188
NP_440977.1_4 Forward -22 -3 37.8569 0.000000502
NP_442802.1_6 Reverse -334 -353 20.649 0.011
NP_441007.1_10 Reverse -330 -343 10.934 0.0646
NP_441007.1_10 Reverse -176 -189 8.9674 0.108
NP_442201.1_10 Forward -355 -336 0.982764 0.114
NP_440256.1_1 Reverse -332 -351 0.491109 0.0829
NP_440256.1_1 Reverse -178 -197 -2.26216 0.115
NP_440256.1_1 Forward -347 -328 -7.4737 0.238
NP_440456.1_7 Forward -202 -188 10.1277 0.294
NP_441559.1_8 Forward -349 -335 12.8809 0.0574
NP_442860.1_7 Forward -67 -49 8.22348 0.283
NP_440915.1_6 Forward -348 -334 21.2391 0.0046
NP_440915.1_6 Reverse -331 -345 3.53951 0.101
NP_440915.1_6 Reverse -343 -357 3.24451 0.104
NP_440915.1_6 Reverse -177 -191 1.17956 0.145
NP_441296.1_4 Reverse -298 -317 14.0608 0.267
NP_440134.1_2 Forward -270 -251 0.0977854 0.298
NP_440695.1_5 Reverse -335 -354 6.68596 0.15
NP_441939.1_3 Forward -343 -324 18.7807 0.0141
NP_442993.1_1 Reverse -181 -197 3.30346 0.0502
NP_442993.1_1 Forward -344 -328 -9.38124 0.185
NP_442386.1_5 Forward -102 -83 6.48849 0.211
NP_442386.1_9 Forward -345 -336 15.7322 0.0144
NP_442386.1_9 Forward -191 -182 14.8472 0.0287
NP_442386.1_9 Reverse -180 -189 13.8639 0.0289
NP_442386.1_9 Reverse -334 -343 6.39082 0.219
NP_441750.1_4 Forward -348 -329 7.27595 0.159
NP_441340.1_5 Forward -343 -336 15.6737 0.0124
NP_441340.1_5 Reverse -336 -343 15.6737 0.0124
NP_441340.1_5 Forward -189 -182 15.6737 0.0124
NP_441340.1_5 Reverse -182 -189 15.6737 0.0124
NP_443028.1_4 Reverse -224 -243 13.537 0.252
NP_440194.1_3 Forward -200 -181 2.94938 0.271
NP_442474.1_1 Forward -59 -40 -4.22878 0.297
NP_442240.1_2 Forward -189 -170 -3.14714 0.0739
NP_440586.1_8 Forward -343 -336 13.2151 0.026
NP_440586.1_8 Forward -189 -182 13.2151 0.026
NP_440586.1_8 Reverse -336 -343 13.2151 0.026
NP_440586.1_8 Reverse -182 -189 13.2151 0.026
NP_442251.1_6 Forward -343 -336 15.2804 0.0124
NP_442251.1_6 Reverse -336 -343 15.2804 0.0124
NP_442251.1_6 Forward -189 -182 15.2804 0.0124
NP_442251.1_6 Reverse -182 -189 15.2804 0.0124
NP_440192.1_4 Reverse -333 -352 10.3678 0.242
NP_441262.1_3 Reverse -335 -342 14.7888 0.0223
NP_441262.1_3 Reverse -181 -188 14.7888 0.0223
NP_441262.1_3 Forward -344 -337 14.7888 0.0223
NP_441262.1_3 Forward -190 -183 13.9038 0.0336
NP_440027.1_3 Reverse -171 -189 3.95163 0.263
NP_443051.1_1 Reverse -334 -343 19.5676 0.00335
NP_443051.1_1 Reverse -180 -189 10.4228 0.00754
NP_443051.1_1 Forward -345 -336 10.4228 0.00754
NP_443051.1_1 Forward -191 -182 1.08137 0.123
NP_443051.1_5 Reverse -273 -292 8.06259 0.235
NP_439984.1_3 Reverse -174 -188 12.782 0.255
NP_439937.1_9 Reverse -334 -351 -8.41828 0.176
NP_442294.1_3 Reverse -185 -199 12.782 0.274
NP_441595.1_5 Reverse -328 -346 7.4923 0.222
NP_440439.1_1 Reverse -332 -345 10.2457 0.0372
NP_440439.1_1 Forward -347 -334 9.85238 0.0418
NP_440439.1_1 Reverse -178 -191 2.08423 0.138
NP_440372.1_2 Forward -343 -336 16.3621 0.0124
NP_440372.1_2 Reverse -336 -343 16.3621 0.0124
NP_440372.1_2 Forward -189 -182 16.3621 0.0124
NP_440372.1_2 Reverse -182 -189 16.3621 0.0124
NP_440819.1_5 Forward -200 -192 7.68924 0.266
NP_439977.1_5 Forward -350 -331 9.63589 0.0932
NP_440267.1_2 Forward -195 -181 11.4053 0.125
NP_442384.1_10 Reverse -335 -348 19.4888 0.00338
NP_442384.1_10 Forward -190 -177 9.85238 0.0484
NP_442384.1_10 Forward -344 -331 0.707601 0.282
NP_442114.1_4 Forward -190 -179 10.2851 0.17
NP_442114.1_4 Reverse -335 -346 9.20345 0.17
NP_440699.1_1 Forward -72 -53 3.10306 0.288
NP_442790.1_4 Forward -353 -334 2.55606 0.0729
NP_442262.1_2 Forward -59 -40 15.3417 0.247
NP_442262.1_10 Forward -343 -336 14.1988 0.0123
NP_442262.1_10 Reverse -336 -343 14.1988 0.0123
NP_442262.1_10 Forward -189 -182 14.1988 0.0123
NP_442262.1_10 Reverse -182 -189 14.1988 0.0123
NP_441689.1_5 Forward -192 -182 17.5808 0.0345
NP_441689.1_5 Reverse -333 -343 8.43603 0.132
NP_441689.1_5 Reverse -179 -189 5.87944 0.197
NP_440344.1_10 Forward -351 -334 1.8088 0.0294
NP_441965.1_10 Reverse -332 -348 2.8118 0.282
NP_442529.1_4 Forward -353 -334 9.14423 0.237
NP_440297.1_9 Reverse -182 -192 0.766681 0.282
NP_440297.1_9 Reverse -336 -346 -0.118297 0.282
NP_440297.1_9 Forward -189 -179 -0.216628 0.282
NP_440297.1_9 Forward -343 -333 -0.314959 0.282
NP_441896.1_3 Forward -353 -334 7.57094 0.0933
NP_442129.1_6 Reverse -252 -271 13.5586 0.269
NP_440999.1_9 Forward -348 -334 9.5377 0.0627
NP_440888.1_2 Reverse -335 -349 17.8952 0.00302
NP_440888.1_2 Forward -344 -330 17.6985 0.00337
NP_440888.1_2 Forward -190 -176 14.2569 0.0193
NP_440888.1_2 Reverse -181 -195 11.012 0.0783
NP_440792.1_5 Reverse -182 -201 6.88262 0.237
NP_442277.1_4 Forward -353 -334 7.27514 0.147
NP_442033.1_10 Forward -346 -327 -7.27704 0.186
NP_442033.1_10 Forward -356 -337 -12.4886 0.271
NP_441543.1_2 Reverse -336 -345 18.486 0.00236
NP_441543.1_2 Forward -189 -180 16.9127 0.00359
NP_441543.1_2 Forward -343 -334 15.9293 0.00518
NP_441543.1_2 Reverse -182 -191 13.8644 0.021
NP_442845.1_2 Reverse -175 -189 5.21113 0.24
NP_442845.1_2 Forward -196 -182 4.03116 0.271
NP_442845.1_2 Reverse -329 -343 3.93283 0.272
NP_442845.1_4 Reverse -179 -198 10.9142 0.178
NP_441551.1_5 Reverse -177 -193 10.6776 0.193
NP_441319.1_6 Reverse -333 -352 13.0775 0.255
NP_441319.1_8 Forward -350 -332 18.0137 0.0597
NP_441469.1_8 Forward -345 -336 16.126 0.00797
NP_441469.1_8 Reverse -334 -343 6.5879 0.227
NP_441469.1_8 Reverse -180 -189 6.48957 0.227
NP_442637.1_1 Forward -53 -34 -3.54046 0.16
NP_442637.1_7 Reverse -3 -22 3.73603 0.166
NP_443064.1_6 Forward -344 -334 10.8217 0.13
NP_443064.1_6 Forward -190 -180 9.75513 0.199
NP_443064.1_6 Reverse -181 -191 8.97947 0.254
NP_442578.1_7 Forward -343 -336 14.5921 0.026
NP_442578.1_7 Forward -189 -182 14.5921 0.026
NP_442578.1_7 Reverse -336 -343 14.5921 0.026
NP_442578.1_7 Reverse -182 -189 14.5921 0.026
NP_442286.1_7 Reverse -188 -207 13.6666 0.255
NP_441462.1_2 Forward -344 -334 20.2362 0.000805
NP_441462.1_2 Reverse -335 -345 11.5831 0.00406
NP_441462.1_2 Reverse -181 -191 10.5998 0.0068
NP_441462.1_2 Forward -190 -180 1.84832 0.081
NP_441621.1_7 Forward -346 -332 4.22782 0.0934
NP_441621.1_7 Reverse -333 -347 -3.147 0.188
NP_443062.1_1 Reverse -335 -353 12.5437 0.0776
NP_443062.1_1 Forward -190 -172 7.37584 0.177
NP_443062.1_1 Reverse -181 -199 6.8883 0.19
NP_443062.1_1 Forward -344 -326 4.45062 0.26
NP_443062.1_6 Forward -352 -333 1.37609 0.276
NP_442204.1_1 Forward -348 -337 2.12362 0.266
NP_442204.1_2 Forward -354 -335 10.6192 0.223
NP_442487.1_5 Forward -355 -336 3.44025 0.284
NP_440516.1_8 Forward -344 -335 16.9127 0.00442
NP_440516.1_8 Reverse -335 -344 16.9127 0.00442
NP_440516.1_8 Reverse -181 -190 9.4395 0.0183
NP_440516.1_8 Forward -190 -181 7.17789 0.0754
NP_441785.1_1 Reverse -181 -195 14.0957 0.17
NP_442428.1_4 Forward -345 -326 11.4058 0.131
NP_442428.1_5 Forward -343 -336 15.8704 0.0124
NP_442428.1_5 Reverse -336 -343 15.8704 0.0124
NP_442428.1_5 Forward -189 -182 15.8704 0.0124
NP_442428.1_5 Reverse -182 -189 15.8704 0.0124
NP_442859.1_2 Forward -189 -170 15.0441 0.068
NP_442120.1_10 Forward -298 -279 -15.6352 0.294
NP_440673.1_3 Reverse -183 -190 14.0021 0.0426
NP_440673.1_3 Forward -342 -335 12.4288 0.0426
NP_440673.1_3 Forward -188 -181 12.4288 0.0426
NP_440673.1_3 Reverse -337 -344 12.4288 0.0426
NP_440865.1_9 Reverse -329 -348 -7.57203 0.247
NP_441052.1_2 Forward -190 -180 11.4848 0.0285
NP_441052.1_2 Reverse -335 -345 10.5014 0.0285
NP_441052.1_2 Forward -344 -334 10.4031 0.0285
NP_441052.1_2 Reverse -181 -191 10.1081 0.0295
NP_442219.1_9 Reverse -182 -191 18.486 0.00718
NP_442219.1_9 Forward -189 -180 17.7976 0.00718
NP_442219.1_9 Reverse -336 -345 8.35786 0.0681
NP_442219.1_9 Forward -343 -334 8.25953 0.0681
NP_440436.1_4 Reverse -336 -345 18.1905 0.00233
NP_440436.1_4 Forward -189 -180 17.2072 0.00233
NP_440436.1_4 Reverse -182 -191 15.9289 0.00508
NP_440436.1_4 Forward -343 -334 9.24241 0.0871
NP_441884.1_8 Forward -345 -326 -10.6203 0.268
NP_440314.1_9 Reverse -336 -355 -8.06369 0.245
NP_441719.1_4 Forward -343 -336 16.3621 0.0124
NP_441719.1_4 Reverse -336 -343 16.3621 0.0124
NP_441719.1_4 Forward -189 -182 16.3621 0.0124
NP_441719.1_4 Reverse -182 -189 16.3621 0.0124
NP_441733.1_10 Reverse -332 -345 15.3589 0.06
NP_441733.1_10 Reverse -178 -191 9.16406 0.124
NP_441004.1_1 Reverse -329 -348 -17.6018 0.292
NP_441004.1_2 Forward -378 -359 3.53937 0.204
NP_439949.1_7 Reverse -99 -113 14.5526 0.225
NP_441034.1_4 Reverse -330 -349 16.0016 0.176
NP_440129.1_10 Forward -351 -337 4.52282 0.185
NP_440296.1_10 Reverse -344 -363 -6.1954 0.225
NP_441115.1_4 Reverse -334 -352 18.4062 0.0145
NP_441115.1_4 Forward -345 -327 12.5064 0.102
NP_442694.1_4 Reverse -48 -57 14.8477 0.164
NP_442694.1_4 Forward -233 -224 11.7011 0.277
NP_442206.1_10 Reverse -181 -196 4.69978 0.178
NP_440328.1_4 Forward -350 -331 -0.983855 0.295
NP_443054.1_2 Forward -346 -332 1.08123 0.251
NP_441851.1_2 Reverse -339 -358 1.47442 0.232
NP_441851.1_10 Reverse -180 -190 16.9913 0.00552
NP_441851.1_10 Forward -345 -335 16.008 0.00552
NP_441851.1_10 Reverse -334 -344 8.53483 0.114
NP_441851.1_10 Forward -191 -181 6.56821 0.161
NP_442001.1_1 Reverse -2 -21 -5.31116 0.276
NP_441354.1_1 Forward -53 -34 4.22769 0.213
NP_442898.1_1 Reverse -294 -312 17.3069 0.198
NP_442515.1_1 Forward -345 -331 5.80112 0.106
NP_442515.1_1 Reverse -180 -194 0.0979218 0.203
NP_442515.1_1 Reverse -334 -348 -3.93365 0.298
NP_441982.1_6 Forward -262 -253 13.8222 0.274
NP_441982.1_6 Forward -201 -192 12.1989 0.288
NP_440165.1_5 Reverse -334 -353 -4.6221 0.22
NP_441046.1_2 Reverse -379 -398 -1.86883 0.292
NP_441349.1_10 Forward -200 -181 -4.13045 0.161
NP_441349.1_10 Reverse -171 -190 -7.08038 0.242
NP_440874.1_2 Reverse -5 -24 20.5519 0.0141
NP_442314.1_3 Reverse -386 -400 12.586 0.277
NP_440432.1_9 Forward -343 -328 14.8279 0.0135
NP_440432.1_9 Forward -189 -174 -2.38005 0.17
NP_440432.1_9 Reverse -182 -197 -4.445 0.209
NP_440474.1_8 Forward -343 -329 7.66879 0.202
NP_440431.1_3 Reverse -334 -353 4.22769 0.09
NP_439950.1_3 Forward -47 -28 3.14605 0.293
NP_440195.1_4 Forward -356 -337 5.89931 0.284
NP_441570.1_1 Reverse -181 -199 0.21581 0.0403
NP_441570.1_1 Forward -190 -172 -7.55234 0.0914
NP_441570.1_1 Forward -344 -326 -8.04399 0.101
NP_441078.1_4 Forward -344 -335 19.6659 0.0007
NP_441078.1_4 Reverse -335 -344 19.6659 0.0007
NP_441078.1_4 Forward -190 -181 9.93116 0.0203
NP_441078.1_4 Reverse -181 -190 9.83282 0.0226
NP_442729.1_8 Forward -348 -335 9.06573 0.125
NP_442348.1_2 Reverse -48 -57 6.68623 0.299
NP_440526.1_3 Forward -189 -178 17.7577 0.0398
NP_440526.1_3 Forward -343 -332 2.41814 0.267
NP_440526.1_3 Reverse -182 -193 0.844851 0.267
NP_441432.1_8 Reverse -334 -343 16.8143 0.00595
NP_441432.1_8 Reverse -180 -189 16.8143 0.00595
NP_441432.1_8 Forward -345 -336 8.25953 0.0755
NP_441432.1_8 Forward -191 -182 7.07956 0.105
NP_441432.1_8 Forward -313 -304 2.55633 0.298
NP_441432.1_9 Reverse -21 -34 11.604 0.221
NP_441432.1_9 Reverse -98 -111 9.08315 0.282
NP_441333.1_1 Reverse -54 -64 12.9245 0.217
NP_442320.1_8 Forward -196 -182 11.406 0.0183
NP_442320.1_8 Reverse -329 -343 5.40779 0.0386
NP_442320.1_8 Forward -350 -336 -1.77037 0.0829
NP_442320.1_8 Reverse -175 -189 -4.03198 0.142
NP_442344.1_7 Reverse -336 -355 -6.39206 0.171
NP_442344.1_7 Forward -343 -324 -8.55534 0.218
NP_441732.1_2 Forward -348 -332 -15.1828 0.145
NP_441732.1_2 Forward -194 -178 -16.4611 0.167
NP_440760.1_1 Forward -344 -325 -11.0136 0.0851
NP_440760.1_1 Reverse -335 -354 -19.7651 0.219
NP_440760.1_1 Forward -190 -171 -23.1083 0.283
NP_440199.1_10 Forward -193 -183 7.05986 0.242
NP_439900.1_1 Reverse -268 -287 15.0441 0.215
NP_440913.1_1 Reverse -179 -197 3.85406 0.288
NP_442230.1_3 Forward -139 -120 18.1907 0.288
NP_442400.1_10 Forward -110 -97 7.9876 0.281
NP_442489.1_7 Forward -344 -335 20.1576 0.000695
NP_442489.1_7 Reverse -335 -344 20.1576 0.000695
NP_442489.1_7 Forward -190 -181 10.4228 0.0151
NP_442489.1_7 Reverse -181 -190 10.3245 0.0193
NP_440386.1_3 Forward -23 -4 -4.72043 0.221
NP_442079.1_7 Reverse -336 -355 9.43923 0.112
NP_442079.1_7 Forward -189 -170 4.52268 0.192
NP_440559.1_1 Reverse -182 -191 17.5026 0.00658
NP_440559.1_1 Forward -189 -180 17.4043 0.00658
NP_440559.1_1 Reverse -336 -345 8.75118 0.0586
NP_440559.1_1 Forward -343 -334 8.65285 0.0586
NP_441659.2_8 Forward -344 -334 20.9245 0.000805
NP_441659.2_8 Forward -190 -180 15.9097 0.00467
NP_441659.2_8 Reverse -335 -345 11.9764 0.0147
NP_441659.2_8 Reverse -181 -191 8.53483 0.0412
NP_442913.1_10 Reverse -326 -345 2.55606 0.124
NP_442913.1_10 Forward -199 -180 -0.885524 0.165
NP_441040.1_2 Forward -384 -365 -7.76869 0.224
NP_440442.1_9 Reverse -326 -345 13.5691 0.242
NP_442346.1_2 Reverse -170 -189 9.0459 0.216
NP_442346.1_5 Reverse -334 -344 16.303 0.00248
NP_442346.1_5 Reverse -180 -190 16.2046 0.00277
NP_442346.1_5 Forward -191 -181 14.533 0.0127
NP_442346.1_5 Forward -345 -335 9.02648 0.118
NP_440545.1_3 Reverse -331 -348 5.54538 0.0608
NP_442934.1_9 Forward -310 -292 13.9821 0.282
NP_441653.1_2 Forward -355 -336 7.2017 0.223
NP_441653.1_2 Reverse -336 -355 3.14308 0.274
NP_441653.1_2 Reverse -324 -343 2.27338 0.295
NP_440010.1_4 Reverse -171 -190 1.08032 0.242
NP_442603.1_7 Reverse -335 -349 10.6187 0.125
NP_441888.1_7 Forward -349 -335 12.8809 0.0743
NP_440449.1_6 Reverse -327 -345 4.46257 0.297
NP_441948.1_4 Forward -351 -333 6.80398 0.0633
NP_441948.1_4 Reverse -328 -346 -3.81576 0.207
NP_441502.1_3 Reverse -333 -352 12.4875 0.21
NP_441833.1_4 Forward -343 -336 15.9687 0.0124
NP_441833.1_4 Reverse -336 -343 15.9687 0.0124
NP_441833.1_4 Forward -189 -182 15.9687 0.0124
NP_441833.1_4 Reverse -182 -189 15.9687 0.0124
NP_441329.1_6 Forward -73 -54 5.1084 0.191
NP_441329.1_6 Forward -71 -52 -3.00842 0.294
NP_440912.1_3 Reverse -51 -70 10.52 0.254
NP_442162.1_9 Forward -343 -336 16.2637 0.0124
NP_442162.1_9 Reverse -336 -343 16.2637 0.0124
NP_442162.1_9 Forward -189 -182 16.2637 0.0124
NP_442162.1_9 Reverse -182 -189 16.2637 0.0124
NP_440671.1_4 Forward -196 -182 13.0776 0.0926
NP_440671.1_4 Reverse -175 -189 7.86607 0.207
NP_442199.1_5 Forward -352 -333 7.17762 0.0719
NP_442140.1_3 Reverse -336 -346 14.238 0.0486
NP_442140.1_3 Forward -189 -179 13.5497 0.0542
NP_442140.1_3 Forward -378 -368 9.41981 0.108
NP_442140.1_3 Forward -343 -333 7.94484 0.124
NP_442140.1_3 Reverse -182 -192 4.10993 0.261
NP_441692.1_2 Forward -42 -23 34.317 0.000000227
NP_440875.1_9 Forward -188 -178 9.3454 0.233
NP_440875.1_9 Forward -342 -332 8.66404 0.233
NP_440875.1_9 Reverse -337 -347 8.46937 0.233
NP_441813.1_5 Forward -346 -336 19.4496 0.00647
NP_441813.1_5 Forward -192 -182 15.123 0.0136
NP_441813.1_5 Reverse -333 -343 8.73149 0.0367
NP_441813.1_5 Reverse -179 -189 8.73149 0.0367
NP_441227.1_5 Forward -355 -336 12.7825 0.287
NP_440590.1_4 Reverse -336 -349 22.1438 0.00377
NP_440590.1_4 Forward -343 -330 1.29759 0.127
NP_440590.1_4 Forward -189 -176 -4.11062 0.258
NP_440567.1_1 Forward -189 -175 10.0294 0.0402
NP_440567.1_1 Forward -343 -329 1.08123 0.219
NP_442497.1_10 Forward -343 -334 17.601 0.00813
NP_442497.1_10 Forward -189 -180 10.4228 0.0087
NP_442497.1_10 Reverse -336 -345 10.4228 0.0087
NP_442497.1_10 Reverse -182 -191 8.55452 0.0294
NP_440821.1_4 Reverse -179 -189 17.9746 0.00497
NP_440821.1_4 Reverse -333 -343 10.7964 0.0146
NP_440821.1_4 Forward -346 -336 10.2065 0.0163
NP_440821.1_4 Forward -192 -182 9.51814 0.0286
NP_441239.1_9 Reverse -333 -345 17.4436 0.0146
NP_441239.1_9 Forward -346 -334 14.1986 0.0288
NP_441239.1_9 Reverse -179 -191 2.98891 0.3
NP_442193.1_8 Forward -193 -174 15.3382 0.211
NP_441017.1_6 Forward -194 -180 14.6503 0.138
NP_441541.1_7 Reverse -143 -161 9.41819 0.294
NP_440949.1_7 Forward -198 -179 12.9783 0.209
NP_440354.1_7 Reverse -329 -347 14.3755 0.167
NP_442138.1_10 Reverse -181 -200 7.07928 0.0711
NP_442138.1_10 Reverse -335 -354 1.67108 0.121
NP_440546.1_4 Forward -344 -334 13.5365 0.0459
NP_440546.1_4 Reverse -335 -345 11.8882 0.0679
NP_440546.1_4 Reverse -181 -191 11.6943 0.0748
NP_440546.1_4 Forward -190 -180 10.8217 0.104
NP_440675.1_4 Forward -278 -259 18.879 0.0974
NP_440462.1_6 Reverse -333 -343 19.4496 0.00371
NP_440462.1_6 Forward -346 -336 17.2863 0.00752
NP_440462.1_6 Reverse -179 -189 10.3048 0.0396
NP_440462.1_6 Forward -192 -182 7.05986 0.0915
NP_440868.1_4 Reverse -177 -189 14.4936 0.0176
NP_440868.1_4 Reverse -331 -343 7.11881 0.0756
NP_440868.1_4 Forward -348 -336 3.48056 0.135
NP_441204.1_1 Forward -353 -334 6.88262 0.261
NP_441848.1_7 Reverse -14 -33 0.195343 0.228
NP_441084.1_6 Reverse -333 -347 11.3802 0.205
NP_442039.1_4 Forward -343 -336 15.1821 0.0124
NP_442039.1_4 Reverse -336 -343 15.1821 0.0124
NP_442039.1_4 Forward -189 -182 15.1821 0.0124
NP_442039.1_4 Reverse -182 -189 15.1821 0.0124
NP_442039.1_7 Reverse -386 -396 15.8113 0.211
NP_441926.1_3 Forward -344 -328 4.87675 0.177
NP_442837.1_3 Forward -343 -336 15.7721 0.0124
NP_442837.1_3 Reverse -336 -343 15.7721 0.0124
NP_442837.1_3 Forward -189 -182 15.7721 0.0124
NP_442837.1_3 Reverse -182 -189 15.7721 0.0124
NP_440160.1_1 Forward -138 -119 8.52366 0.289
NP_442053.1_1 Forward -344 -335 18.3876 0.0007
NP_442053.1_1 Reverse -335 -344 18.3876 0.0007
NP_442053.1_1 Reverse -181 -190 9.24284 0.068
NP_442053.1_1 Forward -190 -181 8.94785 0.07
NP_440505.1_3 Reverse -179 -189 16.598 0.00683
NP_440505.1_3 Forward -346 -336 15.9097 0.00857
NP_440505.1_3 Reverse -333 -343 15.418 0.0114
NP_440505.1_3 Forward -192 -182 6.56821 0.176
NP_441959.1_8 Reverse -7 -20 10.4446 0.286
NP_442532.1_1 Forward -68 -54 11.8628 0.215
NP_442532.1_7 Forward -344 -330 4.12949 0.178
NP_440914.1_1 Forward -344 -334 16.3248 0.00196
NP_440914.1_1 Forward -190 -180 16.3248 0.00196
NP_440914.1_1 Reverse -335 -345 8.6151 0.186
NP_440914.1_1 Reverse -181 -191 8.51751 0.186
NP_441011.1_8 Reverse -336 -345 16.9127 0.00602
NP_441011.1_8 Forward -343 -334 16.6177 0.00602
NP_441011.1_8 Reverse -182 -191 9.53783 0.123
NP_441011.1_8 Forward -189 -180 8.25953 0.144
NP_442101.1_10 Reverse -327 -346 -13.4719 0.293
NP_442533.1_6 Forward -344 -335 17.2076 0.00137
NP_442533.1_6 Reverse -335 -344 17.2076 0.00137
NP_442533.1_6 Reverse -181 -190 15.1427 0.00675
NP_442533.1_6 Forward -190 -181 7.47288 0.0898
NP_440263.1_5 Reverse -253 -267 8.06273 0.294
NP_443016.1_10 Forward -353 -334 15.1424 0.169
NP_441482.1_7 Reverse -175 -189 -1.08205 0.0618
NP_441482.1_7 Forward -350 -336 -2.55701 0.0968
NP_441482.1_7 Reverse -329 -343 -2.95034 0.103
NP_441482.1_7 Forward -196 -182 -11.1118 0.237
NP_439944.1_9 Forward -189 -179 19.1546 0.00329
NP_439944.1_9 Forward -343 -333 17.7779 0.00341
NP_439944.1_9 Reverse -182 -192 17.3846 0.00516
NP_441028.1_6 Reverse -192 -202 4.7978 0.277
NP_440116.1_8 Reverse -336 -355 1.76941 0.0915
NP_440116.1_8 Forward -343 -324 -3.54046 0.154
NP_440116.1_8 Reverse -182 -201 -6.09707 0.202
NP_441527.1_4 Forward -34 -15 0.715766 0.134
NP_441527.1_4 Forward -140 -121 -8.83343 0.251
NP_441527.1_4 Forward -318 -299 -10.5523 0.272
NP_440115.1_6 Reverse -178 -188 18.9579 0.0139
NP_440115.1_6 Reverse -332 -342 7.74818 0.146
NP_441602.1_3 Forward -349 -330 5.60432 0.141
NP_441602.1_4 Reverse -324 -343 15.1424 0.278
NP_442673.1_7 Reverse -53 -72 16.6629 0.13
NP_441972.1_5 Reverse -72 -91 -6.58872 0.233
NP_441106.1_1 Reverse -334 -343 18.486 0.0028
NP_441106.1_1 Forward -345 -336 18.191 0.0028
NP_441106.1_1 Reverse -180 -189 9.63616 0.0311
NP_441106.1_1 Forward -191 -182 8.75118 0.0469
NP_441825.1_4 Reverse -47 -57 13.8447 0.249
NP_442306.1_10 Forward -349 -330 -9.44032 0.11
NP_441286.1_1 Forward -191 -179 12.527 0.00897
NP_441286.1_1 Reverse -180 -192 12.1337 0.0104
NP_441286.1_1 Forward -345 -333 5.15219 0.0259
NP_441286.1_1 Reverse -334 -346 -3.40261 0.145
NP_440670.1_8 Forward -344 -335 18.3876 0.000699
NP_440670.1_8 Reverse -335 -344 18.3876 0.000699
NP_440670.1_8 Reverse -181 -190 8.94785 0.0606
NP_440670.1_8 Forward -190 -181 8.84951 0.0606
NP_440886.1_7 Forward -345 -335 17.7774 0.0011
NP_440886.1_7 Reverse -366 -376 8.43603 0.0805
NP_440886.1_7 Reverse -334 -344 8.04271 0.0805
NP_442072.1_9 Forward -345 -327 -3.32411 0.0355
NP_442072.1_9 Forward -191 -173 -22.4003 0.234
NP_442072.1_9 Reverse -334 -352 -22.892 0.266
NP_441753.1_10 Reverse -326 -345 7.66927 0.186
NP_440907.2_8 Forward -343 -333 19.1541 0.00362
NP_440907.2_8 Forward -189 -179 10.8943 0.0969
NP_440907.2_8 Reverse -336 -346 7.94438 0.117
NP_442264.1_2 Forward -194 -177 7.80699 0.228
NP_440326.1_9 Reverse -5 -24 11.5033 0.274
NP_441463.1_3 Forward -354 -335 -6.09707 0.239
NP_441463.1_3 Reverse -325 -344 -8.94866 0.276
NP_441463.1_6 Forward -192 -178 18.5918 0.114
NP_442842.1_10 Reverse -14 -33 5.22221 0.207
NP_441626.1_2 Forward -343 -336 15.7721 0.0124
NP_441626.1_2 Reverse -336 -343 15.7721 0.0124
NP_441626.1_2 Forward -189 -182 15.7721 0.0124
NP_441626.1_2 Reverse -182 -189 15.7721 0.0124
NP_439958.1_2 Forward -27 -13 17.5025 0.115
NP_441901.1_9 Forward -395 -376 20.7473 0.0247
NP_442365.1_7 Forward -194 -175 -1.7705 0.196
NP_442794.1_1 Forward -348 -336 7.61046 0.136
NP_442794.1_1 Reverse -177 -189 3.2839 0.286
NP_442794.1_5 Reverse -344 -358 11.996 0.275
NP_442615.1_1 Reverse -326 -344 11.3272 0.018
NP_442615.1_1 Forward -353 -335 8.86894 0.0273
NP_442615.1_1 Reverse -172 -190 -5.29072 0.209
NP_442615.1_1 Forward -199 -181 -7.06068 0.273
NP_441962.1_4 Forward -195 -176 -12.2919 0.255
NP_441962.1_4 Reverse -176 -195 -12.4886 0.259
NP_440387.1_1 Forward -190 -174 11.4649 0.0167
NP_440387.1_1 Forward -344 -328 7.92501 0.0282
NP_440387.1_1 Reverse -335 -351 -0.334789 0.137
NP_440387.1_1 Reverse -181 -197 -4.56302 0.19
NP_441431.1_2 Forward -347 -333 7.86545 0.231
NP_441488.1_7 Forward -362 -343 0.786102 0.296
NP_441836.1_2 Reverse -364 -383 4.22769 0.147
NP_441836.1_2 Forward -350 -331 -3.54046 0.239
NP_441993.1_1 Reverse -329 -348 6.0399 0.188
NP_440114.1_10 Forward -344 -330 14.9459 0.0326
NP_440114.1_10 Reverse -181 -195 7.57108 0.231
NP_441425.1_6 Reverse -252 -262 16.008 0.252
NP_442437.1_8 Reverse -336 -355 4.71934 0.256
NP_442698.1_10 Forward -70 -51 7.86593 0.233
NP_441510.2_6 Forward -200 -181 16.5182 0.131
NP_441510.2_7 Forward -196 -182 11.307 0.28
NP_440287.1_6 Forward -353 -334 -0.0988766 0.298
NP_442087.1_7 Reverse -37 -56 -3.73788 0.285
NP_440293.1_9 Forward -273 -259 9.60484 0.285
NP_440766.1_5 Forward -263 -251 8.99268 0.277
NP_441237.1_9 Forward -189 -179 14.9263 0.0242
NP_439910.1_2 Forward -198 -181 -4.09106 0.0692
NP_439910.1_2 Forward -352 -335 -21.4956 0.183
NP_442867.1_8 Forward -382 -363 4.42435 0.283
NP_440457.1_1 Reverse -177 -189 9.18376 0.0949
NP_440457.1_1 Forward -348 -336 6.33216 0.123
NP_440798.1_6 Forward -343 -330 10.5407 0.074
NP_440798.1_6 Forward -189 -176 1.29759 0.224
NP_441801.1_4 Forward -321 -311 2.7333 0.262
NP_442680.1_5 Forward -40 -21 4.07754 0.227
NP_442297.1_10 Forward -38 -19 17.404 0.11
NP_441984.1_3 Reverse -331 -349 8.7706 0.218
NP_440473.1_9 Forward -201 -182 -8.16202 0.246
NP_442509.1_9 Reverse -335 -345 16.2041 0.00739
NP_442509.1_9 Forward -344 -334 8.04271 0.192
NP_441489.1_3 Forward -30 -16 8.79688 0.232
NP_441489.1_3 Forward -265 -251 8.5104 0.235
NP_441610.1_10 Reverse -259 -278 10.1275 0.241
NP_440554.1_4 Reverse -336 -346 16.4996 0.0189
NP_440554.1_4 Forward -343 -333 15.418 0.0199
NP_440554.1_4 Reverse -182 -192 9.12481 0.0646
NP_440554.1_4 Forward -189 -179 6.37155 0.123
NP_442862.1_3 Reverse -383 -400 5.05372 0.28
NP_441885.1_5 Reverse -181 -191 19.6462 0.00179
NP_441885.1_5 Reverse -335 -345 11.4848 0.00668
NP_441885.1_5 Forward -344 -334 11.3864 0.00668
NP_441885.1_5 Forward -190 -180 11.1898 0.00775
NP_440628.1_1 Forward -66 -56 13.6803 0.279
NP_442703.1_8 Reverse -294 -312 13.4897 0.253
NP_442341.1_7 Reverse -334 -348 3.73617 0.214
NP_442341.1_7 Forward -345 -331 2.35953 0.259
NP_441173.1_9 Forward -396 -388 12.1137 0.21
NP_443000.1_7 Forward -192 -182 16.4013 0.0143
NP_443000.1_7 Forward -346 -336 11.5831 0.0344
NP_443000.1_7 Reverse -333 -343 10.7964 0.0345
NP_443000.1_7 Reverse -179 -189 10.4031 0.0345
NP_440275.1_3 Reverse -333 -343 18.6629 0.0082
NP_440275.1_3 Reverse -179 -189 17.6796 0.0102
NP_440275.1_3 Forward -346 -336 15.418 0.0178
NP_440091.1_1 Forward -194 -182 18.7219 0.0114
NP_440091.1_1 Reverse -177 -189 10.8554 0.0429
NP_440091.1_1 Reverse -331 -343 1.51394 0.197
NP_443010.1_10 Forward -193 -176 4.41357 0.23
NP_442451.1_2 Forward -198 -179 -10.4236 0.269
NP_441635.1_2 Forward -48 -29 10.074 0.283
NP_441207.1_7 Forward -23 -9 8.67452 0.282
NP_439962.1_4 Reverse -362 -381 -3.04881 0.245
NP_440175.1_7 Reverse -21 -39 8.97275 0.282
NP_441105.1_3 Forward -355 -336 8.25926 0.0493
NP_440216.1_1 Forward -344 -330 14.8476 0.00436
NP_440216.1_1 Reverse -335 -349 7.37441 0.00942
NP_440216.1_1 Forward -190 -176 -11.0135 0.159
NP_440216.1_1 Reverse -181 -195 -11.7018 0.212
NP_440216.1_9 Forward -316 -307 12.3894 0.241
NP_440216.1_9 Reverse -372 -381 10.6195 0.286
NP_440172.1_1 Forward -344 -334 17.5813 0.00421
NP_440172.1_1 Reverse -181 -191 17.2863 0.00544
NP_440172.1_1 Reverse -335 -345 8.73149 0.0586
NP_440172.1_1 Forward -190 -180 5.28991 0.146
NP_440172.1_1 Forward -356 -346 4.0116 0.208
NP_442015.1_10 Forward -348 -335 12.8023 0.0365
NP_441226.1_7 Forward -343 -336 14.4934 0.0123
NP_441226.1_7 Reverse -336 -343 14.4934 0.0123
NP_441226.1_7 Forward -189 -182 14.4934 0.0123
NP_441226.1_7 Reverse -182 -189 14.4934 0.0123
NP_441111.1_7 Forward -343 -335 18.7023 0.00294
NP_441111.1_7 Forward -189 -181 18.7023 0.00294
NP_441111.1_7 Reverse -336 -344 18.7023 0.00294
NP_441111.1_7 Reverse -182 -190 8.86921 0.0589
NP_442379.1_10 Reverse -174 -191 1.02215 0.223
NP_441177.1_7 Forward -106 -87 15.2399 0.198
NP_441766.1_2 Reverse -181 -190 17.896 0.00297
NP_441766.1_2 Forward -344 -335 17.5026 0.00297
NP_441766.1_2 Reverse -335 -344 17.5026 0.00297
NP_441766.1_2 Forward -190 -181 9.4395 0.0285
NP_442417.1_5 Reverse -335 -349 10.6193 0.11
NP_440416.1_1 Reverse -181 -200 -12.9802 0.278
NP_440416.1_1 Forward -344 -325 -13.6686 0.281
NP_440416.1_9 Forward -351 -332 -13.3736 0.165
NP_443052.1_8 Forward -200 -181 -2.95047 0.0955
NP_442116.1_6 Forward -23 -6 5.87715 0.289
NP_440261.1_5 Forward -343 -330 -1.16069 0.0662
NP_440261.1_5 Forward -189 -176 -1.16069 0.0662
NP_440261.1_5 Reverse -336 -349 -4.40561 0.147
NP_440988.1_10 Forward -192 -178 9.35221 0.205
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TAACTTCTGCCAAGGATTTCTTCCGATGGTTGGCGCACCGTTCAGCAGATCTCTCCGGCGATCGCCTCATGTCTGTTTTAACAACCCAGGCAAGCAGAACTAGAAAACCACAACTTTCTCTGCTTGGTCTGTTGACCTTGCTCAAAAATTCAGTACCTCACTTTTCAGGGCTTGTTTAGATCATCTATCTGTCGGATTGTAGGGAAAAATAGCGATCGCCACGCTTTGATGATTTTCCATATAAATGATTTATCTAAACGAAGGAATGTAAGAAAATATAGCTGGCTTCAATAATTACCAATAACATCAGACCCAGAAGTGTTGAACGATAGTTATAAAGAGAAAAAAAGCCCTTTAAAATGATAGAATAAAGGGCAGAAATATTAGAATAATTGAAGCG

CDS

ATGATATCAAATTTTGGACATATTGTCAAAACTTATCTATCTAATTTTCCTAAAGATGACTACCCAGTATTAGACACATTTAAGTTTGTGAGTATCTGGTTAGGATTAGTGTTAGACCAGAGCCAGACAAGCATGAGGAGTATGTTTAAAAGACTGAACTTACGAGGAGAGACAGTCGATATATCTACATTCTCAAAGGCAAGCAAAAAAAGGGATGTGGGAGTTTTTAGAGAAATAATATTTTCCTTAAAAAAGGAATTGTCGAAAAGGAAGGAAATTAAGCAGGGAGAATTAGAAATATTTCCTCTCGATTCAACCATTGTCAGCATAACTAGTAAGTTGATGTGGAACCTTGGATTTCATCAGGTAAAAGTATTCAGTGGGATTAACTTATCAACAGGGATTCCGGGGGGAATAGTAATTCACTTTGGACAAGGTCATGATAATAAATATGGGAATGAAACAATAGAAGAGACTCCAGAAAATGGAGTAGCAGTAATGGATAGAGGATTTTGTGACTTACAGAGAATCAAGAGATTACAAAAGGAGAATAACAAATATCATGTATTAAGAATAAAGAATAATATAAAGCTAGAAAAATTAGCCAATGATAACTATATGGTTGGAACTGAAAAGAATAAAATAGAGAGTAGAGTGGTAATATTCACCCATGATAATTCAGAGTTTAGATTGGTTACAAATTTACCTATAGAAAGTAAAGAAATAGAAGGAGTTAGTGATGAAAAAATAGCAGAAATTTATAAAAAAAGATGGCAAATAGAATTGTTATGGAAATTCTTAAAAATGCACTTAAAGCTGAATAGACTGATTGCCAAAAATGAGAATGCAATTGGGATTCAAATCTATACCTGTATAATTGCTTATTTAATACTAAAATTACTGGTAATCCCAAAAGAAGCAGGTACAACAATGTTAGACAAACTACGTTATTTACAGGCTTTCATGTGTGAAAAAATAAGCTATGTACACTGGCTAAGGGAGTTAGCACTAAGGTGA

Protein

No sequence available