Your browser is old and dusty. Try Google Chrome!

Details for slr7005

ORF slr7005
Accession NP_942293.1
Symbol
Category Transposon-related functions
Definition integrase/recombinase
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -129 -143 -0.492064 0.231
NP_440557.1_1 Reverse -212 -231 -0.688862 0.27
NP_441418.1_6 Forward -137 -118 -9.63698 0.0288
NP_441418.1_6 Forward -146 -127 -20.3551 0.111
NP_441418.1_6 Forward -143 -124 -28.5165 0.205
NP_441418.1_6 Reverse -350 -369 -29.9915 0.249
NP_442752.1_4 Forward -137 -130 10.8555 0.0846
NP_442975.1_10 Reverse -124 -138 10.9137 0.0516
NP_442975.1_10 Forward -369 -355 5.80051 0.208
NP_442975.1_10 Reverse -118 -132 1.86729 0.29
NP_440110.1_7 Reverse -350 -369 16.3224 0.212
NP_441054.1_5 Reverse -338 -357 15.7324 0.169
NP_441781.1_7 Forward -372 -353 0.294447 0.246
NP_442375.1_5 Reverse -131 -145 16.2235 0.289
NP_442110.1_5 Reverse -274 -293 17.8957 0.12
NP_442110.1_7 Reverse -122 -136 -0.197071 0.276
NP_440014.1_3 Forward -361 -347 16.5458 0.261
NP_441083.1_5 Reverse -128 -138 -0.0199663 0.251
NP_440209.1_1 Forward -137 -129 5.13263 0.17
NP_441327.1_1 Forward -60 -41 6.03945 0.25
NP_440906.1_5 Forward -318 -311 5.64398 0.292
NP_440906.1_9 Forward -366 -347 17.6982 0.13
NP_441486.1_1 Reverse -65 -79 1.76955 0.0999
NP_441486.1_1 Forward -307 -293 -5.70361 0.254
NP_442634.1_4 Forward -321 -307 -4.62196 0.211
NP_440842.1_4 Forward -98 -79 7.69039 0.115
NP_443018.1_3 Forward -76 -69 11.5438 0.0752
NP_443018.1_3 Forward -136 -129 4.26735 0.267
NP_443018.1_3 Reverse -129 -136 4.07068 0.299
NP_441588.1_4 Reverse -365 -375 8.1415 0.154
NP_441588.1_4 Reverse -130 -140 6.07655 0.214
NP_442530.1_2 Reverse -91 -101 11.5831 0.284
NP_440642.1_10 Reverse -67 -81 3.34225 0.275
NP_442296.1_9 Forward -371 -352 1.0811 0.197
NP_440360.1_10 Reverse -118 -132 11.3077 0.164
NP_442658.1_8 Reverse -119 -138 19.5673 0.0647
NP_442782.1_2 Forward -137 -123 4.91614 0.25
NP_440607.1_8 Reverse -348 -367 0.0977854 0.28
NP_442937.1_5 Forward -142 -123 11.3075 0.141
NP_441127.1_1 Forward -137 -123 14.7492 0.134
NP_442836.1_5 Forward -131 -112 1.27776 0.287
NP_443001.1_7 Forward -149 -130 5.60432 0.279
NP_442690.1_1 Reverse -82 -101 -0.590531 0.126
NP_441580.1_6 Reverse -117 -136 -2.26216 0.217
NP_440153.1_8 Reverse -122 -135 -3.52063 0.295
NP_440369.1_5 Reverse -186 -205 12.3892 0.209
NP_440200.1_3 Reverse -342 -361 5.211 0.298
NP_440200.1_7 Forward -247 -228 6.32247 0.204
NP_441913.1_1 Forward -167 -151 15.1752 0.246
NP_440411.1_2 Forward -351 -332 3.7233 0.263
NP_440377.1_1 Forward -101 -84 14.8491 0.185
NP_441041.1_4 Forward -137 -118 -1.96717 0.106
NP_442396.1_6 Forward -91 -77 17.3912 0.254
NP_441547.1_2 Reverse -345 -363 13.6872 0.0948
NP_439966.1_7 Forward -361 -351 7.25606 0.15
NP_439966.1_7 Reverse -66 -76 6.86274 0.163
NP_439966.1_7 Reverse -126 -136 6.56775 0.177
NP_440202.1_10 Reverse -277 -296 11.5042 0.264
NP_442281.1_1 Forward -377 -363 8.84875 0.075
NP_441079.1_7 Forward -101 -82 -1.18128 0.201
NP_441079.1_7 Reverse -3 -22 -3.24622 0.233
NP_441079.1_7 Forward -24 -5 -3.73788 0.238
NP_442847.1_3 Forward -295 -276 7.07848 0.235
NP_442172.1_1 Reverse -3 -22 11.6148 0.251
NP_441644.1_6 Reverse -128 -138 4.10949 0.249
NP_443049.1_6 Forward -78 -68 11.4458 0.257
NP_442029.1_1 Forward -139 -120 -1.96717 0.163
NP_442671.1_2 Forward -260 -241 1.18675 0.242
NP_439922.1_3 Forward -108 -89 23.0609 0.0123
NP_442554.1_8 Reverse -129 -139 4.50326 0.184
NP_442554.1_8 Forward -76 -66 2.33998 0.274
NP_442142.1_4 Reverse -125 -138 10.6384 0.0697
NP_442292.1_1 Reverse -129 -138 5.80125 0.129
NP_440895.1_5 Reverse -98 -116 17.4229 0.298
NP_443009.1_2 Reverse -130 -149 2.26107 0.216
NP_442301.1_2 Forward -369 -350 6.58682 0.263
NP_442301.1_2 Reverse -118 -137 4.81688 0.272
NP_440379.1_5 Reverse -119 -138 -8.65367 0.253
NP_441468.1_1 Forward -76 -69 4.07068 0.263
NP_441468.1_1 Forward -136 -129 3.97235 0.277
NP_441015.1_10 Forward -136 -117 5.11266 0.116
NP_442811.1_2 Forward -139 -120 0.294447 0.252
NP_441764.1_4 Forward -393 -376 13.8013 0.154
NP_442719.1_2 Forward -242 -224 -10.9946 0.286
NP_441251.1_7 Reverse -48 -61 11.3273 0.27
NP_442559.1_3 Forward -171 -152 7.7676 0.291
NP_442227.1_2 Reverse -121 -140 -3.54046 0.293
NP_442808.1_1 Reverse -127 -137 15.0242 0.0285
NP_441849.1_2 Reverse -378 -397 -0.0481691 0.277
NP_441906.1_2 Reverse -292 -311 0.785326 0.295
NP_441114.1_3 Reverse -70 -79 6.29291 0.285
NP_440162.1_1 Reverse -87 -106 18.364 0.18
NP_441878.1_6 Forward -78 -68 -7.98478 0.285
NP_441590.1_4 Reverse -124 -143 1.57197 0.3
NP_441458.1_8 Forward -103 -84 11.3264 0.229
NP_441458.1_10 Reverse -119 -138 1.47442 0.288
NP_441574.1_1 Forward -149 -130 -0.983855 0.211
NP_441574.1_1 Forward -137 -118 -7.57203 0.292
NP_442632.1_1 Reverse -70 -89 12.585 0.244
NP_442594.1_8 Reverse -351 -370 5.99764 0.236
NP_442594.1_8 Forward -146 -127 3.24438 0.286
NP_442998.1_10 Reverse -130 -137 6.13563 0.181
NP_440299.1_1 Reverse -124 -137 7.19687 0.119
NP_441007.1_10 Forward -142 -129 4.73917 0.182
NP_441270.1_5 Reverse -346 -365 13.775 0.211
NP_441179.1_9 Reverse -126 -136 10.1076 0.28
NP_440537.1_7 Forward -182 -163 14.3711 0.119
NP_441464.1_10 Reverse -343 -357 8.75105 0.27
NP_440702.1_2 Forward -133 -114 -6.39206 0.257
NP_440695.1_5 Forward -137 -118 4.71934 0.192
NP_440677.1_1 Reverse -313 -332 9.73422 0.181
NP_442386.1_9 Reverse -127 -136 6.58748 0.219
NP_441750.1_1 Forward -143 -124 -4.81876 0.204
NP_441750.1_7 Forward -39 -29 14.533 0.254
NP_440586.1_8 Forward -76 -69 10.9535 0.119
NP_440586.1_8 Forward -387 -380 8.98688 0.188
NP_440586.1_8 Forward -136 -129 7.70858 0.227
NP_440684.1_9 Forward -143 -129 11.5043 0.173
NP_441262.1_3 Forward -137 -130 5.25066 0.215
NP_440171.1_2 Forward -312 -298 16.4456 0.258
NP_442887.1_5 Reverse -114 -133 -11.5053 0.264
NP_442384.1_10 Reverse -322 -335 0.215946 0.297
NP_441018.1_7 Forward -141 -122 19.5673 0.0338
NP_442790.1_4 Forward -146 -127 -15.2418 0.289
NP_442262.1_10 Forward -76 -69 11.7405 0.0841
NP_440344.1_10 Reverse -121 -138 -7.92597 0.12
NP_440282.1_3 Reverse -117 -136 -4.81876 0.298
NP_440531.1_6 Forward -312 -293 -1.47551 0.232
NP_441060.1_1 Forward -137 -118 16.3693 0.18
NP_441965.1_10 Reverse -125 -141 3.30346 0.266
NP_440350.1_5 Reverse -241 -260 -7.27704 0.299
NP_442187.1_3 Forward -138 -128 13.5497 0.245
NP_440999.1_9 Forward -214 -200 0.196253 0.191
NP_441268.1_1 Reverse -87 -106 16.5674 0.194
NP_441268.1_1 Forward -28 -9 11.5064 0.273
NP_441543.1_2 Reverse -302 -311 8.94785 0.0968
NP_441543.1_2 Reverse -129 -138 4.91628 0.213
NP_442845.1_2 Forward -143 -129 6.6861 0.205
NP_442845.1_2 Reverse -357 -371 3.34284 0.294
NP_441918.1_7 Forward -138 -119 5.211 0.262
NP_442710.1_7 Reverse -5 -24 1.0427 0.18
NP_442315.1_1 Forward -145 -127 6.31233 0.256
NP_442315.1_2 Forward -142 -130 8.49544 0.293
NP_443064.1_6 Forward -220 -210 9.85209 0.193
NP_442578.1_7 Forward -76 -69 5.15232 0.291
NP_442780.1_3 Reverse -81 -100 11.8883 0.198
NP_440454.1_1 Reverse -237 -256 8.9237 0.27
NP_440516.1_8 Forward -137 -128 7.96454 0.0463
NP_442428.1_5 Forward -76 -69 4.46401 0.267
NP_442428.1_5 Forward -136 -129 4.36568 0.271
NP_440673.1_3 Reverse -70 -77 13.2155 0.0426
NP_440673.1_3 Reverse -130 -137 11.6422 0.0724
NP_441052.1_2 Reverse -128 -138 7.74818 0.0642
NP_442219.1_8 Reverse -118 -137 7.49067 0.267
NP_440436.1_4 Reverse -129 -138 11.0124 0.0655
NP_440314.1_9 Reverse -129 -148 -3.83545 0.192
NP_442414.1_2 Forward -143 -124 16.0274 0.134
NP_441669.1_2 Reverse -86 -100 14.7486 0.28
NP_442577.1_9 Reverse -27 -41 14.6503 0.209
NP_441719.1_4 Forward -76 -69 3.77569 0.285
NP_441004.1_1 Forward -143 -124 2.94938 0.106
NP_441004.1_3 Forward -134 -115 2.16274 0.273
NP_441004.1_5 Forward -141 -127 13.1759 0.223
NP_442139.1_7 Forward -142 -123 15.3391 0.159
NP_442873.1_3 Reverse -127 -146 3.34192 0.29
NP_442873.1_9 Reverse -118 -137 3.24359 0.296
NP_442694.1_4 Reverse -152 -161 11.7011 0.277
NP_440094.1_9 Forward -132 -113 -4.03212 0.251
NP_441668.1_4 Forward -147 -128 2.94938 0.189
NP_441046.1_2 Forward -148 -129 4.42435 0.228
NP_442689.1_8 Reverse -86 -103 -5.1727 0.268
NP_442843.1_1 Forward -136 -117 -9.44032 0.266
NP_440431.1_4 Forward -258 -239 -9.69285 0.288
NP_440588.1_2 Forward -340 -321 -1.27885 0.155
NP_440588.1_2 Forward -140 -121 -5.9004 0.264
NP_441003.1_9 Forward -346 -327 5.211 0.266
NP_441570.1_1 Forward -137 -119 -16.9921 0.26
NP_442729.1_5 Forward -138 -128 17.9746 0.0748
NP_441432.1_8 Forward -138 -129 4.42462 0.213
NP_441432.1_9 Reverse -88 -101 8.50141 0.289
NP_442320.1_9 Forward -141 -127 19.8624 0.0904
NP_442727.1_10 Forward -108 -89 2.45773 0.203
NP_442407.1_2 Forward -399 -380 11.11 0.206
NP_442400.1_10 Forward -393 -380 8.0831 0.279
NP_442489.1_7 Forward -137 -128 -1.6719 0.235
NP_441706.1_1 Reverse -89 -108 -3.3438 0.252
NP_440559.1_1 Reverse -129 -138 4.52295 0.26
NP_442346.1_5 Forward -138 -128 6.07655 0.216
NP_442346.1_5 Forward -78 -68 4.60159 0.281
NP_442346.1_5 Reverse -321 -331 4.50326 0.286
NP_440010.1_10 Forward -149 -130 10.0292 0.209
NP_442732.1_2 Reverse -3 -22 15.8971 0.249
NP_441329.1_1 Forward -29 -10 4.24897 0.296
NP_442140.1_3 Forward -136 -126 7.64985 0.133
NP_441671.1_6 Reverse -288 -307 8.35759 0.179
NP_440227.1_2 Reverse -14 -30 7.53169 0.295
NP_441239.1_9 Reverse -126 -138 4.36554 0.253
NP_442568.1_8 Forward -161 -147 8.75105 0.28
NP_442568.1_8 Forward -261 -247 8.16106 0.292
NP_442643.1_5 Reverse -214 -233 0.982764 0.25
NP_440354.1_7 Reverse -38 -56 10.3439 0.224
NP_440546.1_4 Forward -137 -127 10.4338 0.109
NP_441230.1_6 Reverse -127 -146 16.2241 0.153
NP_440462.1_4 Reverse -356 -370 5.50613 0.29
NP_441249.1_8 Reverse -345 -364 0.982764 0.284
NP_441474.1_1 Forward -370 -351 1.57197 0.247
NP_441474.1_1 Reverse -127 -146 -2.45958 0.277
NP_441848.1_4 Forward -69 -53 8.41009 0.288
NP_442923.1_4 Forward -143 -124 -0.787193 0.214
NP_441959.1_8 Reverse -95 -108 19.8924 0.123
NP_442532.1_7 Forward -137 -123 4.32615 0.174
NP_440914.1_1 Forward -220 -210 6.76087 0.267
NP_441011.1_8 Reverse -148 -157 5.3096 0.271
NP_442533.1_1 Forward -143 -124 -16.0285 0.262
NP_442533.1_1 Reverse -347 -366 -17.1101 0.281
NP_440263.1_1 Reverse -384 -397 16.5324 0.239
NP_441482.1_7 Reverse -122 -136 -11.3085 0.254
NP_442269.1_10 Forward -136 -117 4.03102 0.248
NP_441527.1_4 Forward -261 -242 -5.77769 0.208
NP_441527.1_4 Reverse -3 -22 -8.06949 0.24
NP_441527.1_4 Forward -266 -247 -8.83343 0.251
NP_441527.1_4 Forward -63 -44 -11.8892 0.284
NP_441815.1_2 Reverse -126 -145 15.4366 0.179
NP_439903.1_6 Reverse -125 -144 2.35861 0.227
NP_441286.1_1 Forward -138 -126 1.21895 0.091
NP_442674.1_10 Forward -316 -297 11.7008 0.21
NP_440886.1_7 Reverse -127 -137 8.23937 0.0805
NP_440886.1_7 Reverse -121 -131 6.86274 0.113
NP_440886.1_7 Forward -366 -356 5.09279 0.201
NP_440404.1_9 Forward -256 -237 15.4215 0.142
NP_440326.1_9 Reverse -84 -103 11.6017 0.274
NP_441463.1_3 Forward -398 -379 -0.0988766 0.132
NP_441463.1_3 Reverse -118 -137 -9.63698 0.282
NP_441962.1_4 Reverse -123 -142 -12.5869 0.26
NP_440387.1_1 Forward -372 -356 -4.75968 0.198
NP_442357.1_8 Reverse -108 -127 7.7676 0.241
NP_440766.1_5 Forward -67 -55 6.70087 0.294
NP_441237.1_9 Reverse -129 -139 10.2065 0.241
NP_442930.1_1 Reverse -94 -104 13.4509 0.239
NP_441133.1_1 Reverse -345 -364 13.0775 0.243
NP_442680.1_5 Forward -78 -59 4.4683 0.227
NP_441332.1_4 Reverse -3 -22 5.30933 0.261
NP_442703.1_4 Reverse -322 -341 4.32522 0.283
NP_442638.1_3 Reverse -48 -67 11.8883 0.298
NP_440149.1_8 Forward -137 -118 -3.3438 0.187
NP_441105.1_3 Forward -342 -323 -7.27704 0.25
NP_440416.1_9 Reverse -61 -80 -21.1417 0.291
NP_443052.1_9 Forward -369 -350 -6.39206 0.282
NP_442116.1_6 Forward -101 -84 8.07346 0.254
NP_442116.1_6 Reverse -6 -23 5.87715 0.289
NP_442154.1_1 Forward -145 -127 1.78911 0.0795
NP_442154.1_1 Forward -136 -118 -16.0088 0.229
NP_442154.1_6 Forward -138 -119 2.16274 0.234
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CTTCATCAATATTGCGAACAATTAAATTAGCCATCCACTACCTCCAGCCCAAAACAAACTCTTGGTCTTGGTCATTACTCAAATGATAGCATTGATAGCGCTTGATCATTTGCCTGCCCTGCTTGTGTATGAACGAATCCAACAAGAAAATAAAATCAAGCTAGTACAAATTACACCCTTGAGAATCACCTGTAACCCTCACATTTAACTTTTCAGGTTAACTACATCATTTTCCTAAGCAAAAAGGCATAACAGACGATTTTGGCGATGGTGGTAGCTGTCGGAATTTATCAACTGAGAATAATTAGCAATAATTTATGTTGAGCGATGGAAAGTCGAAAAAATTCCACGATAGAATTAGGGTTGTGGGAGTTATTCAATATTTTATGAATTTTATTGA

CDS

ATGAAAATTAACCGCCAGGGGCAGGCAAAAGTATTAACTGAACAGGAATTACATGACCTGTTCACCGTTGGGTTGCTCACTCCCCGCGATCGCCTCTTGTTTGGCATCTGTCTTTACACTGGTTGCCGCATTGGGGAAGCTTGTTCCCTGGCCTGGGCTGATATCACCACTGATGCGATGACTTTCCGCATTGAAAAAACTAAAACCAAATCCAGTCGCACTGTGGCCATTTCCCCAGCGTTGCAAGTTTTATTTGATGAGTACCGGCAAGCCCAACAATTTGTTAGGTTTCCATCTTCCTATGTCTTTCGGGGCAAACGGGTGGGGTCCCATCTTCATCCTTCCATGGCCCATAAAATTTTGAAGGCCGCCACTGACAGAATTAGCGTTAGGGGGGTATCAACCCATTCTTTCCGCCGCACTGCGTTAACGATGATGTGTCGGAAGGGGATTAATCTGCGGGTTATTCAAAAGATTAGTGGCCACAAGAATTTGAATGTGTTATCCCATTATCTCGAAGTTTCTGAACAGGAAAAGGAACAAGCATTATCAACAATTTCTTTTTAA

Protein

No sequence available