Your browser is old and dusty. Try Google Chrome!

Details for slr6096

ORF slr6096
Accession NP_942539.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -378 -392 -0.197071 0.223
NP_441418.1_6 Reverse -129 -148 -29.0082 0.215
NP_441418.1_6 Forward -233 -214 -30.0898 0.256
NP_440897.1_6 Forward -224 -205 3.63691 0.143
NP_441960.1_4 Reverse -4 -20 13.3325 0.241
NP_442151.1_6 Reverse -138 -152 7.37441 0.2
NP_440996.1_4 Forward -206 -196 17.5813 0.15
NP_442287.1_5 Forward -332 -322 16.2046 0.218
NP_442752.1_4 Forward -392 -385 7.6106 0.151
NP_440613.1_1 Forward -305 -286 13.7658 0.259
NP_441675.1_4 Forward -24 -5 6.4893 0.236
NP_442861.1_1 Forward -214 -195 11.1109 0.295
NP_440061.1_9 Reverse -93 -107 8.75042 0.164
NP_440110.1_7 Reverse -348 -367 10.0292 0.297
NP_441054.1_2 Forward -21 -2 9.43923 0.295
NP_439979.1_9 Reverse -130 -148 10.6389 0.227
NP_440761.1_4 Forward -31 -12 -4.42544 0.132
NP_441802.1_1 Reverse -193 -212 4.22769 0.296
NP_440916.1_1 Reverse -365 -379 11.0127 0.206
NP_441594.1_6 Forward -227 -208 3.93269 0.224
NP_441925.1_4 Reverse -373 -392 -1.47628 0.156
NP_441925.1_4 Forward -157 -138 -15.2425 0.263
NP_441083.1_5 Reverse -304 -314 5.68323 0.11
NP_441955.1_8 Forward -78 -61 9.57695 0.255
NP_441713.1_1 Forward -110 -91 -15.2418 0.261
NP_441783.1_2 Reverse -217 -226 17.1093 0.108
NP_440053.1_2 Forward -260 -241 11.5042 0.291
NP_442111.1_3 Forward -376 -363 13.3352 0.261
NP_440747.1_10 Reverse -212 -224 -12.2524 0.254
NP_441130.1_10 Forward -226 -212 5.21113 0.242
NP_441854.1_10 Forward -389 -370 10.8159 0.139
NP_440842.1_5 Reverse -38 -57 15.8809 0.269
NP_441014.1_8 Reverse -209 -228 -5.40875 0.269
NP_441634.1_8 Reverse -213 -227 -4.22864 0.295
NP_441634.1_9 Forward -62 -43 13.175 0.191
NP_440376.1_1 Forward -165 -156 2.16301 0.233
NP_442485.1_3 Reverse -127 -146 -1.08219 0.255
NP_442485.1_3 Forward -149 -130 -4.72043 0.285
NP_440781.1_1 Forward -64 -50 10.6193 0.296
NP_441013.1_3 Forward -244 -225 13.4708 0.201
NP_441950.1_7 Forward -110 -91 -5.70374 0.233
NP_441950.1_7 Forward -392 -373 -9.047 0.292
NP_441950.1_7 Forward -229 -210 -9.53865 0.297
NP_442496.1_5 Forward -381 -363 11.8189 0.207
NP_442486.1_4 Reverse -357 -376 13.8641 0.167
NP_442685.1_2 Forward -273 -263 13.648 0.3
NP_440950.1_1 Reverse -364 -383 7.27595 0.144
NP_440153.1_8 Forward -150 -137 -3.71729 0.299
NP_440993.1_3 Reverse -202 -221 2.55527 0.203
NP_441099.1_5 Reverse -373 -392 -1.86883 0.115
NP_441099.1_5 Reverse -213 -232 -9.73531 0.231
NP_442431.1_10 Reverse -132 -150 1.69077 0.249
NP_442431.1_10 Forward -119 -101 -0.669169 0.293
NP_441000.1_5 Reverse -193 -212 4.22689 0.286
NP_440736.1_3 Forward -253 -234 2.45773 0.282
NP_440437.1_1 Reverse -89 -108 -4.72043 0.266
NP_441644.1_6 Forward -224 -214 8.73102 0.0944
NP_441644.1_6 Reverse -116 -126 6.56775 0.154
NP_440253.1_2 Forward -61 -43 -2.63579 0.271
NP_442926.1_3 Reverse -127 -146 3.73603 0.279
NP_442142.1_4 Reverse -212 -225 5.72191 0.186
NP_442142.1_4 Forward -150 -137 2.47701 0.29
NP_441525.1_1 Reverse -211 -224 14.1789 0.228
NP_443009.1_5 Reverse -94 -105 8.80962 0.099
NP_443009.1_5 Forward -105 -94 8.4163 0.109
NP_443009.1_5 Reverse -214 -225 3.8931 0.274
NP_440730.1_4 Forward -224 -205 1.27776 0.237
NP_441198.1_8 Reverse -93 -103 13.2713 0.108
NP_441198.1_8 Forward -106 -96 12.1971 0.15
NP_439939.1_4 Reverse -333 -352 8.65258 0.158
NP_441015.1_10 Reverse -130 -149 -9.93197 0.282
NP_441015.1_10 Forward -223 -204 -10.817 0.288
NP_441096.1_2 Reverse -147 -166 19.2723 0.0249
NP_441016.2_6 Reverse -157 -176 6.39016 0.258
NP_441826.1_5 Reverse -129 -148 14.3558 0.105
NP_441826.1_5 Forward -236 -217 1.47442 0.29
NP_442868.1_6 Reverse -213 -223 0.471689 0.226
NP_442719.1_2 Reverse -345 -363 -11.7812 0.296
NP_441612.1_2 Forward -376 -366 8.83972 0.21
NP_442542.1_2 Forward -226 -213 8.86907 0.145
NP_442542.1_2 Reverse -302 -315 5.42749 0.266
NP_440630.1_1 Reverse -123 -142 8.45592 0.242
NP_441878.1_6 Forward -225 -215 -7.29646 0.217
NP_441534.1_1 Reverse -364 -383 20.1573 0.0248
NP_441445.1_5 Reverse -205 -224 16.5182 0.221
NP_442419.1_2 Reverse -309 -328 3.6377 0.198
NP_442998.1_2 Reverse -207 -226 10.52 0.151
NP_442998.1_5 Forward -376 -366 13.8447 0.157
NP_440899.1_8 Reverse -356 -375 -5.11376 0.231
NP_441362.1_2 Reverse -166 -185 6.13106 0.243
NP_441559.1_8 Reverse -90 -104 3.34284 0.143
NP_440915.1_3 Forward -139 -120 12.7825 0.221
NP_440915.1_6 Reverse -351 -365 -2.06536 0.258
NP_442158.1_4 Forward -113 -103 12.7631 0.242
NP_440026.1_4 Forward -391 -372 10.3242 0.239
NP_440306.1_4 Forward -238 -219 9.63589 0.299
NP_441947.1_3 Forward -379 -361 19.6853 0.128
NP_441676.1_9 Reverse -50 -67 10.7562 0.253
NP_440586.1_8 Reverse -60 -67 7.02027 0.279
NP_440027.1_3 Reverse -208 -226 9.26148 0.186
NP_440027.1_3 Forward -144 -126 6.31156 0.229
NP_439984.1_10 Forward -146 -132 13.372 0.186
NP_439937.1_9 Reverse -51 -68 -11.8598 0.267
NP_441789.1_7 Forward -148 -129 3.9319 0.193
NP_441789.1_7 Reverse -103 -122 -0.984623 0.251
NP_441789.1_7 Reverse -100 -119 -2.26292 0.257
NP_440819.1_5 Forward -376 -368 7.68924 0.266
NP_441803.1_2 Reverse -216 -235 1.96607 0.222
NP_441803.1_2 Forward -146 -127 0.294447 0.255
NP_440364.1_2 Forward -232 -213 15.6875 0.213
NP_441689.1_5 Reverse -93 -103 12.4676 0.132
NP_442187.1_3 Forward -314 -304 14.238 0.207
NP_440999.1_9 Reverse -115 -129 -1.8687 0.252
NP_440888.1_2 Reverse -17 -31 7.76712 0.184
NP_440888.1_2 Forward -104 -90 5.89884 0.258
NP_440575.1_8 Reverse -178 -197 -4.72043 0.268
NP_441469.1_8 Reverse -128 -137 5.21127 0.283
NP_443064.1_6 Reverse -95 -105 8.78555 0.271
NP_440220.1_4 Reverse -10 -29 -0.591301 0.262
NP_442872.1_1 Forward -149 -130 -8.85033 0.241
NP_440516.1_8 Forward -313 -304 7.47288 0.0581
NP_442080.1_8 Reverse -130 -149 7.17762 0.26
NP_441033.1_2 Reverse -42 -61 -5.70374 0.293
NP_440783.1_3 Reverse -342 -361 1.86774 0.266
NP_440673.1_2 Forward -237 -218 9.41407 0.245
NP_440314.1_9 Reverse -216 -235 -10.4236 0.298
NP_441733.1_8 Forward -65 -46 14.5524 0.181
NP_441004.1_1 Reverse -126 -145 -6.09707 0.183
NP_441004.1_1 Forward -380 -361 -17.2085 0.29
NP_439949.1_7 Forward -212 -198 10.7177 0.291
NP_442873.1_5 Forward -145 -126 13.5683 0.189
NP_442873.1_5 Forward -142 -123 11.8967 0.224
NP_440296.1_10 Forward -227 -208 -14.3569 0.269
NP_442694.1_4 Forward -251 -242 12.0944 0.268
NP_442206.1_1 Reverse -145 -164 -14.8485 0.283
NP_442308.1_4 Reverse -46 -65 6.98095 0.267
NP_441851.1_10 Forward -105 -95 13.8447 0.0266
NP_442208.1_5 Forward -389 -370 -0.000545616 0.248
NP_442515.1_1 Reverse -214 -228 -4.81863 0.298
NP_441396.1_5 Forward -112 -103 9.4395 0.205
NP_441982.1_6 Forward -30 -21 12.7718 0.274
NP_441982.1_6 Forward -377 -368 12.4854 0.275
NP_440355.1_2 Forward -215 -196 15.9282 0.0928
NP_440463.1_8 Reverse -128 -147 7.79033 0.264
NP_441046.1_2 Forward -211 -192 -1.86883 0.292
NP_439960.1_10 Reverse -128 -146 -4.40575 0.293
NP_441124.1_5 Reverse -1 -11 10.8118 0.283
NP_440431.1_3 Reverse -16 -35 -7.4737 0.207
NP_440195.1_4 Forward -325 -306 12.4875 0.127
NP_441078.1_4 Forward -224 -215 -1.86856 0.272
NP_442729.1_5 Forward -354 -344 8.1415 0.248
NP_441663.1_8 Forward -145 -126 9.0459 0.0906
NP_440707.1_6 Reverse -193 -212 10.2251 0.285
NP_442443.1_1 Reverse -130 -149 15.0441 0.0758
NP_442443.1_1 Forward -162 -143 -2.36049 0.256
NP_442443.1_1 Reverse -139 -158 -3.73712 0.267
NP_441732.1_2 Reverse -91 -107 -16.5594 0.174
NP_440313.1_1 Reverse -186 -205 17.994 0.162
NP_442797.1_7 Reverse -303 -321 -0.964162 0.291
NP_441945.1_10 Forward -123 -104 9.63589 0.258
NP_440713.1_4 Reverse -85 -104 2.85105 0.256
NP_442489.1_7 Forward -224 -215 -1.37691 0.195
NP_442749.1_5 Forward -22 -5 10.1518 0.192
NP_442749.1_5 Reverse -355 -372 8.41651 0.234
NP_439956.1_7 Forward -64 -45 2.65439 0.273
NP_442008.1_2 Forward -367 -348 9.0459 0.188
NP_440708.1_5 Reverse -231 -250 8.16093 0.169
NP_442346.1_1 Forward -393 -374 10.5209 0.27
NP_442346.1_5 Forward -148 -138 5.78156 0.229
NP_441629.1_3 Reverse -208 -227 -1.96793 0.268
NP_442603.1_7 Reverse -304 -318 12.192 0.102
NP_441948.1_4 Reverse -122 -140 0.707465 0.135
NP_441047.1_1 Reverse -127 -146 4.03102 0.189
NP_441895.1_10 Forward -279 -260 -19.1751 0.282
NP_443026.1_5 Forward -259 -240 0.196116 0.283
NP_440772.1_6 Forward -217 -198 6.58763 0.292
NP_442140.1_3 Reverse -136 -146 5.28991 0.216
NP_440594.1_5 Reverse -5 -24 8.4551 0.293
NP_442472.1_10 Reverse -83 -102 13.175 0.232
NP_442044.1_1 Reverse -90 -109 -5.50708 0.188
NP_440833.1_6 Reverse -198 -212 8.94708 0.267
NP_442402.1_2 Reverse -364 -378 13.077 0.263
NP_442402.1_4 Reverse -359 -378 7.57013 0.119
NP_442402.1_4 Reverse -358 -377 -4.42619 0.225
NP_442402.1_6 Forward -379 -370 14.1594 0.241
NP_442402.1_10 Reverse -367 -377 12.5659 0.206
NP_442402.1_10 Reverse -185 -195 10.5993 0.287
NP_440653.1_6 Forward -147 -128 13.5691 0.236
NP_441811.1_8 Forward -110 -96 11.2093 0.218
NP_440825.1_6 Forward -274 -255 8.25926 0.285
NP_441959.1_5 Reverse -361 -380 14.9458 0.103
NP_442255.1_8 Forward -141 -122 21.0423 0.0452
NP_442101.1_6 Forward -256 -237 16.7157 0.134
NP_442533.1_1 Forward -391 -372 -17.7985 0.295
NP_442533.1_6 Forward -224 -215 3.7363 0.204
NP_441697.1_5 Reverse -254 -273 -9.2154 0.268
NP_441028.1_6 Reverse -368 -378 14.6309 0.158
NP_440116.1_8 Reverse -305 -324 -2.0655 0.125
NP_440007.1_9 Forward -335 -321 7.07942 0.213
NP_439965.1_7 Forward -179 -160 10.2223 0.294
NP_441680.1_4 Forward -143 -124 -0.197208 0.248
NP_440429.1_2 Reverse -216 -235 8.06259 0.274
NP_441286.1_1 Forward -314 -302 -5.46756 0.203
NP_440886.1_7 Forward -148 -138 6.17443 0.141
NP_440828.1_1 Reverse -118 -137 -1.77127 0.293
NP_442614.1_2 Forward -313 -299 13.2743 0.132
NP_442614.1_2 Forward -224 -210 6.19444 0.291
NP_442072.1_9 Reverse -271 -289 -16.1071 0.196
NP_441753.1_10 Forward -233 -214 2.45773 0.234
NP_440028.1_6 Forward -208 -190 16.1454 0.218
NP_440907.2_8 Reverse -96 -106 5.97777 0.182
NP_440907.2_9 Reverse -13 -32 3.63691 0.242
NP_441021.1_2 Reverse -139 -158 4.71934 0.291
NP_441463.1_6 Reverse -93 -107 11.6342 0.224
NP_441836.1_2 Forward -64 -45 -5.99873 0.29
NP_441836.1_2 Forward -316 -297 -6.29373 0.295
NP_440634.1_8 Reverse -304 -323 2.16195 0.285
NP_442323.1_7 Reverse -373 -392 4.32522 0.217
NP_441510.2_6 Reverse -373 -392 11.8967 0.298
NP_440287.1_5 Reverse -148 -167 8.25844 0.286
NP_440293.1_3 Forward -60 -41 -2.65548 0.241
NP_440293.1_10 Reverse -129 -148 -1.67217 0.271
NP_440766.1_5 Forward -377 -365 9.47014 0.275
NP_439988.1_3 Forward -357 -343 3.44117 0.299
NP_442930.1_1 Reverse -264 -274 9.91099 0.28
NP_442867.1_8 Forward -318 -299 4.52268 0.281
NP_440524.1_3 Forward -142 -123 11.9958 0.253
NP_441756.1_5 Forward -228 -209 -2.65548 0.28
NP_441173.1_6 Reverse -210 -229 3.73603 0.292
NP_441173.1_9 Reverse -369 -377 13.1954 0.184
NP_442395.2_4 Forward -365 -346 0.293673 0.274
NP_440275.1_3 Reverse -213 -223 1.455 0.29
NP_440679.1_10 Reverse -131 -150 -8.55534 0.18
NP_443010.1_10 Reverse -92 -109 11.8544 0.0969
NP_442451.1_2 Reverse -87 -106 -0.4922 0.158
NP_439962.1_4 Forward -146 -127 -1.37718 0.214
NP_442373.1_1 Reverse -34 -53 -11.2103 0.29
NP_440216.1_1 Forward -224 -210 -9.93184 0.145
NP_441226.1_7 Forward -312 -305 7.1186 0.218
NP_441226.1_7 Reverse -379 -386 5.64364 0.286
NP_442252.1_4 Forward -392 -373 18.1907 0.175
NP_440416.1_9 Reverse -207 -226 -8.26035 0.112
NP_443052.1_9 Forward -145 -126 11.2092 0.0958
NP_443052.1_9 Reverse -124 -143 0.884433 0.191
NP_442154.1_1 Reverse -127 -145 -6.66736 0.141
NP_442154.1_1 Reverse -130 -148 -12.3706 0.217
NP_442226.1_8 Forward -206 -196 16.6963 0.164
NP_440261.1_5 Reverse -96 -109 -5.19226 0.188
NP_440988.1_10 Forward -315 -301 3.44663 0.293
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TGTATTTTGGTGATGCGTCGGGCTGGGGAAAAACTACCGGAACGTCGGGGCAAGGTGCTATTTATCAATGCGGATGCGGAGTTCTATGCCGGTCGGGCCCAGAATTATTTGAAGCCGGAGCATATCGAAAAAATTGTGAATGCGTTTGAGGCATTTGTGGATATTCCAGGTTATGCGGCGGTGGTCAGTCGGGAAATTTTGGCTGCTGAGGAGAATGATTTTAATTGCAATATTCGGCGTTATGCGGATAATGCGCCACCACCGGAACCGCAGGATGTGACGGCTCATTTGTTGGGGGGGATTCCTTTCGATGAGATAGAAGCACAACGGAATTTGATGGGCAGTCATGGGTTTGACCCGCTGCGAATTTTAGTGGAAAAGGCTTAGGGAGATTTTGGTA

CDS

ATGCAATATTTTGATTTTTTGCCGGAGATTACTGAGAAGTCGCAAATTAAGGATTTTGTGGCGAATGATGCGGGGGTGAAGACCCAGGAGGCAAGGCTCTATGGGGCGTTTGACGAGTGGTGGTGGTTGCATTCGCCGATGTTGAACCAGTTGCCGGAGTCGAAGGGTTTGATGGAGCTGCGGACGGCGTTTTTTGAGTCGTTTATTGCTAGTTTGGAGCCTGTGGGTCTGTTGGATCGGTTTAAGGTGACGGGGGTTATTGCCACTTGGTGGGATGAGGTACGGTATGAGTTGCGGACGTTGGCGGAGTCTGGTTTTTCAGGGTTGGTGGATAGTTGGATTGATACGATTCGGGATGCTCTGGAGGATGACGATGATGATCAGCCTAAGGGTAAAGAGCAGTTTGATCCGTTGAGCCACAAGTTAGTGGTACAGCTTTTGGCGGATTATCTGGAGGAAATTGAAGCGGCGGAAGGTCTGGTGGCGGATCTGGAACAGCAAAAGGTAGCGTTTGAGCAGGGGGATGATGATGCTGAAGAATCAGATGACGATGAGGAGGAAACGGTGAAAAATGTGGCCAAGGCTCTGGACGATCGCCGGAAGGATCTCAAGAATGACATTAAGGATGCTCTGAAACGGATCAAAGTGCTGAAGAGTGGGGCAACGGTGAAGGGGCAGAATTCGATCGCCGCCCAAAGAAAGTTAGGCAATGATACGACGGCACTGGAGCGGGAACTTGTGGAACTGGAGGGGTTTGTGGCTCCGGTGTTGGCTGAGATTGGGGAAATTGAGGCGAGGTTGGAACCCTATAACGAGATTAAGGCTAGTTTGGCGGAGGCCCGGAAGGCTTTACGGGGGTTGAAGGATCAACTTATTGGGCGGTTAGTGGCGGCACGGGCAGAGCTTGGTGAGGAGGGTTGTGAAAAGTTGGTGTTGGCGGCGTTTTATGAGGGGCTAAAGTCCCATCTGGATCGCTATGGGGCGGCGCATTTTCAGCAGGTGGTGGCGGCGGTTGAGAATTGGTGGGATAAGTATCGGGTGACGTTGCGGGATATTGTCAGCGAACGGGACACTGCGGCGGCAAAGTTAGATCAGTTTTTGGAGGGATTGGGATATGTCTAA

Protein

No sequence available