Your browser is old and dusty. Try Google Chrome!

Details for slr6087

ORF slr6087
Accession NP_942530.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441418.1_6 Reverse -140 -159 -21.3384 0.147
NP_441453.1_7 Forward -42 -35 12.9205 0.23
NP_441623.1_1 Reverse -56 -74 -0.0791831 0.228
NP_440226.1_1 Reverse -152 -171 3.34271 0.229
NP_441098.1_3 Forward -383 -364 -6.50185 0.28
NP_441054.1_2 Reverse -230 -249 9.73422 0.284
NP_442062.1_3 Forward -204 -185 -3.14714 0.274
NP_441035.1_3 Reverse -59 -78 1.96607 0.227
NP_440370.1_10 Forward -247 -228 8.25926 0.243
NP_441925.1_5 Reverse -51 -65 19.1741 0.0437
NP_441434.1_1 Forward -295 -281 14.3354 0.233
NP_441738.1_2 Forward -236 -229 10.0685 0.125
NP_442889.1_1 Forward -145 -126 -11.1119 0.217
NP_442889.1_10 Forward -387 -368 14.4603 0.149
NP_440178.1_7 Reverse -111 -130 -23.01 0.287
NP_442706.1_5 Reverse -368 -387 16.1309 0.233
NP_441327.1_4 Forward -357 -343 17.9942 0.282
NP_440851.1_5 Reverse -214 -233 9.7334 0.281
NP_440438.2_8 Forward -339 -320 7.47261 0.153
NP_441924.1_9 Forward -250 -231 13.7649 0.266
NP_440747.1_1 Reverse -63 -81 6.90232 0.253
NP_440470.1_5 Reverse -181 -200 6.92274 0.279
NP_440842.1_10 Reverse -24 -38 2.35953 0.274
NP_440057.1_6 Reverse -337 -356 9.2578 0.299
NP_442530.1_2 Reverse -103 -113 11.9764 0.282
NP_440042.1_1 Reverse -236 -255 7.86593 0.238
NP_441029.1_5 Forward -347 -328 15.3038 0.233
NP_442321.1_4 Forward -354 -335 -5.01543 0.284
NP_442025.1_4 Forward -392 -373 10.5209 0.291
NP_442816.1_7 Reverse -52 -71 10.9334 0.213
NP_442690.1_1 Reverse -94 -113 2.3594 0.0955
NP_442690.1_1 Reverse -366 -385 -6.68705 0.169
NP_442690.1_1 Forward -309 -290 -11.4069 0.229
NP_440153.1_8 Forward -52 -39 3.16588 0.21
NP_440496.1_6 Forward -109 -90 8.75091 0.281
NP_441099.1_10 Forward -330 -320 15.9091 0.254
NP_441712.1_1 Forward -389 -370 11.5502 0.251
NP_442438.1_10 Reverse -60 -74 -1.08205 0.291
NP_441000.1_6 Forward -239 -225 -4.91696 0.254
NP_441550.1_8 Forward -240 -230 5.68278 0.236
NP_440345.1_3 Reverse -368 -382 10.7067 0.273
NP_441725.1_5 Reverse -230 -240 5.48657 0.115
NP_439966.1_7 Forward -240 -230 4.01116 0.295
NP_439966.1_9 Reverse -227 -236 6.39124 0.253
NP_442941.1_2 Forward -378 -359 11.1244 0.295
NP_442941.1_5 Reverse -332 -346 19.0131 0.0751
NP_442941.1_5 Forward -330 -316 14.6205 0.279
NP_441514.1_1 Forward -12 -2 16.5414 0.274
NP_441678.1_2 Reverse -236 -255 9.43923 0.238
NP_442281.1_1 Forward -243 -229 4.62054 0.187
NP_441079.1_7 Reverse -316 -335 -6.68779 0.283
NP_001035871.2_2 Forward -389 -370 14.3829 0.296
NP_442500.1_8 Forward -336 -322 10.082 0.272
NP_442012.1_1 Reverse -71 -90 -0.4922 0.259
NP_442012.1_1 Forward -41 -22 -1.7705 0.297
NP_442982.1_5 Forward -160 -141 4.62101 0.171
NP_442215.1_2 Forward -89 -73 -0.728113 0.171
NP_442933.1_3 Reverse -184 -203 16.8539 0.225
NP_440576.1_7 Reverse -63 -82 20.1573 0.0999
NP_442970.1_1 Reverse -270 -284 11.6616 0.269
NP_442381.1_9 Forward -138 -119 10.7175 0.202
NP_440183.1_9 Forward -50 -31 -11.5053 0.251
NP_441015.1_10 Reverse -23 -42 -3.93378 0.195
NP_441876.1_9 Forward -67 -57 12.4676 0.267
NP_441426.1_8 Forward -339 -321 11.5239 0.204
NP_442745.1_6 Forward -252 -233 12.4875 0.258
NP_442868.1_6 Forward -240 -230 3.42162 0.199
NP_442719.1_2 Forward -344 -326 -1.25988 0.175
NP_441251.1_7 Reverse -321 -334 9.85238 0.298
NP_443058.1_7 Reverse -70 -89 1.76941 0.294
NP_441101.1_10 Forward -40 -21 -3.93378 0.267
NP_440918.1_2 Reverse -138 -157 12.8808 0.259
NP_442050.1_5 Forward -240 -230 9.321 0.193
NP_442342.1_9 Forward -240 -224 6.45005 0.218
NP_440346.1_6 Forward -132 -122 14.6332 0.251
NP_440676.1_3 Reverse -228 -247 6.98095 0.278
NP_441655.1_10 Reverse -126 -144 3.06741 0.273
NP_441819.1_5 Forward -388 -369 14.5621 0.195
NP_441819.1_5 Reverse -366 -385 13.9891 0.195
NP_441574.1_1 Reverse -22 -41 -0.0988766 0.198
NP_441574.1_1 Reverse -202 -221 -5.70374 0.267
NP_442347.1_2 Forward -183 -174 5.70292 0.226
NP_441411.1_9 Forward -253 -234 25.3688 0.00718
NP_442590.1_9 Forward -53 -34 10.7175 0.23
NP_441728.2_4 Forward -385 -366 12.2703 0.273
NP_441799.1_1 Forward -242 -228 5.40719 0.21
NP_442504.1_5 Forward -150 -132 10.8356 0.3
NP_440087.1_2 Reverse -17 -36 11.4058 0.191
NP_440215.1_6 Reverse -306 -325 23.598 0.00797
NP_440695.1_6 Reverse -182 -196 13.611 0.236
NP_440695.1_6 Reverse -287 -301 11.9627 0.265
NP_441199.1_3 Reverse -30 -48 -1.84914 0.27
NP_441199.1_7 Forward -326 -307 1.57275 0.272
NP_441340.1_5 Reverse -230 -237 3.97235 0.274
NP_442950.1_1 Forward -123 -104 -4.81876 0.244
NP_442959.1_5 Reverse -266 -285 12.6841 0.222
NP_441262.1_3 Reverse -229 -236 11.6422 0.0477
NP_439937.1_9 Reverse -265 -282 -11.2699 0.248
NP_442384.1_7 Reverse -53 -67 17.7975 0.198
NP_442121.1_4 Forward -44 -25 -1.47551 0.226
NP_441877.1_9 Forward -340 -323 2.39878 0.29
NP_441877.1_9 Reverse -333 -350 2.39878 0.29
NP_441018.1_7 Reverse -136 -155 6.4893 0.286
NP_440531.1_6 Reverse -148 -167 -4.13045 0.276
NP_440531.1_8 Reverse -129 -148 4.03102 0.269
NP_441060.1_1 Reverse -317 -336 12.1811 0.294
NP_440894.1_7 Reverse -328 -347 9.34008 0.244
NP_440060.1_1 Reverse -77 -96 11.5042 0.278
NP_440491.1_1 Reverse -25 -44 9.84073 0.206
NP_440491.1_1 Forward -90 -71 9.35345 0.218
NP_440491.1_1 Reverse -62 -81 7.01447 0.28
NP_439969.1_1 Reverse -27 -46 -4.72043 0.288
NP_440739.1_8 Reverse -217 -236 2.26107 0.299
NP_441548.1_8 Forward -240 -222 18.702 0.0736
NP_442204.1_1 Forward -232 -221 6.64685 0.157
NP_440544.1_5 Reverse -371 -378 13.8024 0.28
NP_442537.1_3 Forward -52 -33 14.6508 0.239
NP_440516.1_8 Reverse -229 -238 -0.68859 0.297
NP_440592.1_8 Forward -258 -239 10.8159 0.281
NP_441884.1_9 Reverse -22 -41 -21.7317 0.261
NP_441086.1_3 Forward -201 -182 13.1525 0.117
NP_442312.1_1 Reverse -195 -214 11.3075 0.275
NP_441851.1_10 Forward -150 -140 5.87989 0.196
NP_442208.1_5 Reverse -26 -45 2.16274 0.248
NP_442814.1_5 Forward -82 -63 15.1416 0.196
NP_440495.1_2 Reverse -214 -233 8.75091 0.126
NP_441046.1_2 Forward -117 -98 -1.67217 0.292
NP_442689.1_8 Reverse -98 -115 0.825489 0.191
NP_442689.1_8 Reverse -369 -386 -8.71262 0.296
NP_442314.1_1 Reverse -32 -50 -5.29072 0.272
NP_439960.1_10 Forward -44 -26 -2.53746 0.255
NP_441124.1_5 Forward -290 -280 15.3 0.196
NP_441124.1_5 Reverse -323 -333 13.3901 0.215
NP_441124.1_5 Forward -339 -329 11.4803 0.254
NP_440431.1_7 Reverse -348 -367 1.27776 0.215
NP_442450.1_5 Forward -151 -141 6.07655 0.204
NP_442237.1_4 Forward -325 -307 14.1134 0.228
NP_442006.1_2 Reverse -34 -51 -8.31929 0.194
NP_442038.1_1 Forward -384 -365 10.0292 0.127
NP_442348.1_2 Reverse -130 -139 7.17789 0.285
NP_440707.1_9 Reverse -23 -42 -0.39387 0.299
NP_442443.1_1 Forward -147 -128 -3.24547 0.265
NP_441091.1_7 Forward -114 -95 18.9773 0.24
NP_441432.1_9 Reverse -322 -335 8.79228 0.287
NP_440629.1_5 Forward -346 -327 7.17762 0.29
NP_442797.1_7 Forward -44 -26 -0.472507 0.283
NP_440352.1_5 Forward -369 -350 9.83295 0.289
NP_441629.1_1 Forward -157 -138 6.4893 0.258
NP_441653.1_3 Reverse -50 -64 11.996 0.279
NP_442311.1_6 Forward -321 -302 13.4708 0.117
NP_442799.1_8 Forward -387 -368 12.7645 0.172
NP_441329.1_6 Forward -375 -356 -1.38506 0.293
NP_441329.1_6 Forward -378 -359 -2.62645 0.294
NP_441329.1_6 Forward -387 -368 -3.10391 0.296
NP_441895.1_10 Forward -342 -323 -19.8634 0.282
NP_442162.1_9 Reverse -230 -237 9.28223 0.0694
NP_440671.1_4 Reverse -223 -237 14.9459 0.0532
NP_442199.1_7 Reverse -272 -291 10.52 0.118
NP_442199.1_7 Forward -353 -334 3.34192 0.245
NP_441239.1_9 Forward -240 -228 9.47875 0.105
NP_441951.1_9 Forward -42 -23 1.86774 0.254
NP_442568.1_8 Forward -367 -353 8.16106 0.292
NP_440624.1_5 Reverse -318 -336 11.5236 0.192
NP_441892.1_1 Reverse -34 -51 -0.354483 0.182
NP_442669.1_1 Forward -202 -183 3.73603 0.149
NP_442105.1_9 Reverse -34 -48 16.2933 0.263
NP_441769.1_3 Reverse -269 -288 -6.78612 0.282
NP_441541.1_1 Reverse -364 -382 -4.77261 0.285
NP_441617.1_8 Reverse -335 -354 9.83173 0.289
NP_442138.1_5 Forward -249 -230 10.0292 0.276
NP_442340.1_3 Forward -50 -31 -3.3438 0.205
NP_442479.1_9 Reverse -47 -66 -10.9153 0.273
NP_442479.1_9 Forward -346 -327 -13.9635 0.294
NP_441848.1_4 Reverse -328 -344 13.5667 0.195
NP_442039.1_4 Reverse -230 -237 10.8555 0.109
NP_442829.1_2 Forward -386 -370 7.56129 0.297
NP_441959.1_8 Forward -294 -281 11.4087 0.286
NP_442532.1_4 Reverse -380 -398 15.7215 0.159
NP_442533.1_6 Forward -149 -140 2.55633 0.25
NP_440263.1_5 Reverse -321 -335 7.37441 0.294
NP_440263.1_5 Forward -282 -268 7.37441 0.294
NP_441697.1_5 Forward -310 -291 -8.45146 0.26
NP_441697.1_5 Reverse -1 -20 -8.45146 0.26
NP_441697.1_5 Forward -357 -338 -9.2154 0.268
NP_441697.1_5 Forward -335 -316 -9.69285 0.273
NP_441028.1_6 Forward -67 -57 3.51951 0.292
NP_441527.1_4 Forward -378 -359 -7.59203 0.235
NP_441527.1_4 Forward -372 -353 -9.31089 0.256
NP_441527.1_4 Forward -375 -356 -12.6531 0.292
NP_441972.1_5 Reverse -27 -46 -8.26035 0.26
NP_441286.1_1 Reverse -228 -240 -6.84419 0.283
NP_442382.1_9 Forward -41 -22 7.66846 0.29
NP_440841.1_4 Forward -82 -63 -8.35868 0.25
NP_441463.1_3 Reverse -249 -268 -6.68705 0.247
NP_442020.1_1 Forward -344 -325 -0.29631 0.272
NP_440358.1_8 Forward -280 -261 -1.57384 0.276
NP_440766.1_4 Reverse -225 -239 11.7993 0.0611
NP_439988.1_3 Forward -46 -32 8.75105 0.249
NP_441237.1_9 Reverse -230 -240 11.2881 0.189
NP_442930.1_1 Forward -327 -317 11.9759 0.242
NP_440458.1_7 Reverse -252 -271 4.91521 0.218
NP_442867.1_8 Forward -50 -31 8.06259 0.24
NP_440987.1_4 Forward -387 -368 15.0441 0.111
NP_440987.1_4 Forward -287 -268 6.78429 0.181
NP_441801.1_4 Reverse -30 -40 2.63497 0.29
NP_441489.1_3 Forward -383 -369 10.6112 0.232
NP_441489.1_3 Forward -198 -184 9.36983 0.232
NP_441489.1_3 Forward -341 -327 9.08335 0.232
NP_442582.1_3 Forward -335 -321 12.6166 0.284
NP_440554.1_4 Forward -237 -227 3.42162 0.23
NP_440022.1_4 Reverse -345 -364 14.8474 0.274
NP_442703.1_9 Forward -260 -242 5.13236 0.244
NP_442369.1_6 Forward -370 -360 16.0639 0.186
NP_441173.1_9 Reverse -332 -340 11.0321 0.228
NP_441173.1_9 Forward -109 -101 9.85212 0.275
NP_440750.1_5 Forward -128 -114 9.04604 0.211
NP_440552.1_8 Forward -340 -323 12.5616 0.226
NP_440560.1_5 Reverse -269 -288 9.32929 0.276
NP_440312.1_2 Reverse -107 -126 16.5182 0.288
NP_442275.1_1 Forward -149 -130 0.687771 0.285
NP_442638.1_3 Reverse -322 -341 13.6072 0.298
NP_442638.1_3 Forward -340 -321 10.6469 0.298
NP_441207.1_7 Reverse -278 -292 10.3203 0.263
NP_441207.1_7 Forward -387 -373 7.99683 0.293
NP_439962.1_4 Forward -51 -32 -0.197208 0.197
NP_442495.1_5 Reverse -23 -42 8.55425 0.291
NP_441045.1_1 Forward -387 -368 13.2741 0.26
NP_440416.1_9 Reverse -70 -89 -9.14533 0.127
NP_442116.1_6 Reverse -340 -357 16.7632 0.0991
NP_442116.1_6 Forward -386 -369 13.612 0.172
NP_442116.1_6 Reverse -369 -386 12.6571 0.172
NP_442116.1_6 Forward -198 -181 10.2698 0.223
NP_442116.1_6 Reverse -381 -398 10.0788 0.227
NP_442116.1_6 Forward -333 -316 5.3042 0.299
NP_442046.1_9 Forward -198 -184 17.3058 0.244
NP_440261.1_5 Reverse -26 -39 -12.0754 0.27
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCAAGCTATTCTAGAAAATTTGGAAGAAAATTAATGAAAGAAGAAACATTTTCAAGAGAATTTGCAAAAATTCTCAAAATTCACTGGACTAAAGAACTTCACCTTGAATTTATCAAAATTTCGGAGGAAATTATCAATGACAATATGGAACAGCAAAAACGGCCCAATCGCAGTTGATGACATGACAGAATCCCACGCTAAGAATGTCTTAAAAATGTTGATCCGAAACAACATGATCAAACGACCAGAAGGGCGAGTCCTAGAAATGCCCCAAGAGGTTGAAGACGAACTTTTAGCAAAGATGATTGAACGTGAAGAATCCCAATGGGGATATTAACCCCTAGTAAAATCCTTGGCCCCCCTGGGGGCTTCCACCACTCAAATACTTAGGAAAATTATC

CDS

ATGACAACCACCACTAAAACCACCGGCAAAACCCCTAAACTTTGGGAACTGTCCGACGAAATAACAAATCTTGAAGACCAAATTGCAGACATTCAAGACCGGGAAGATCTAAGCGAGTCTGAAAAAGACCAGTTAATGGGAGAAATTCTAGAAACTTGGTTATCCACTGGTAAAGAATTTGATGCTAAAGCCTGTAATGTTGCCGCTTATATCAAGCACCTGGAAGCAATCACAGAAGCTCGTAAAAATGAATACCGACGCTTGCGAGATTTAGCAGAACAATCAGAAAATCAATCCCAGCGACTACGCAATTACCTTGTTAGCAATATGCAGAAGTTGGGCAAAAAGAAAGTTAATGGAGTATCGGTAAATTTATCACTACGGAAGAAACCGGCAAAAGTCGTTCTTAATTGCCCCTTGGAAGATTTACCAGCCGCATTTATGAAAGTCGAAATTACACCTCGCCTATCGGAACTTAAAAAGCACCTTCAGAGCAACGCTGATTGTTCCTTTGCTCAATTGGCGGATGTTGAAGAATATTCAGTGATGATCAAGTAA

Protein

No sequence available