Your browser is old and dusty. Try Google Chrome!

Details for slr6066

ORF slr6066
Accession NP_942509.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -240 -226 3.53951 0.163
NP_441061.1_2 Forward -255 -241 1.27789 0.192
NP_441061.1_7 Forward -237 -218 11.9958 0.282
NP_441418.1_6 Reverse -339 -358 -10.522 0.0362
NP_441418.1_6 Forward -348 -329 -30.4831 0.28
NP_442291.1_5 Forward -188 -172 10.0883 0.0469
NP_441453.1_4 Reverse -339 -347 6.80426 0.121
NP_441453.1_4 Forward -348 -340 6.11594 0.121
NP_442151.1_6 Reverse -184 -198 6.58777 0.228
NP_442838.1_7 Forward -192 -173 -11.4069 0.277
NP_441818.1_9 Reverse -364 -383 -4.03212 0.234
NP_440226.1_1 Reverse -116 -135 4.03102 0.206
NP_440226.1_1 Forward -348 -329 3.14605 0.237
NP_442287.1_5 Reverse -231 -241 15.5163 0.218
NP_443002.1_5 Forward -207 -189 13.588 0.212
NP_442173.1_1 Forward -347 -339 12.0158 0.0316
NP_442173.1_1 Reverse -340 -348 4.83764 0.241
NP_442752.1_4 Reverse -339 -346 13.8055 0.0199
NP_442752.1_4 Forward -187 -180 10.8555 0.0846
NP_442752.1_4 Forward -155 -148 5.64398 0.176
NP_441225.1_1 Reverse -192 -211 -9.24366 0.295
NP_441225.1_4 Forward -254 -235 -4.72043 0.27
NP_440784.1_7 Reverse -340 -347 6.23397 0.241
NP_440784.1_7 Forward -347 -340 6.13563 0.241
NP_440061.1_9 Reverse -87 -101 7.3738 0.209
NP_440878.1_9 Forward -319 -300 -3.14714 0.289
NP_442062.1_8 Forward -187 -177 4.69992 0.201
NP_441859.1_3 Forward -200 -181 8.55343 0.138
NP_441859.1_3 Reverse -338 -357 4.42355 0.222
NP_440304.1_4 Reverse -245 -255 6.66654 0.149
NP_440304.1_4 Reverse -239 -249 4.69992 0.252
NP_441781.1_7 Forward -187 -168 1.67108 0.223
NP_441781.1_7 Reverse -58 -77 -1.37718 0.272
NP_441620.1_3 Reverse -102 -121 11.4058 0.287
NP_441935.1_10 Reverse -58 -77 16.2241 0.287
NP_441594.1_6 Reverse -56 -75 9.24257 0.145
NP_442110.1_7 Forward -262 -248 0.0979218 0.267
NP_441402.1_4 Forward -334 -315 19.2723 0.0842
NP_441083.1_5 Forward -348 -338 8.73149 0.0307
NP_441083.1_5 Reverse -339 -349 7.05986 0.067
NP_441083.1_5 Forward -241 -231 3.12662 0.182
NP_441083.1_5 Forward -301 -291 2.83163 0.191
NP_441434.1_3 Reverse -318 -337 -1.37718 0.246
NP_441738.1_2 Forward -346 -339 15.28 0.0102
NP_441558.1_5 Forward -350 -331 11.4058 0.0814
NP_440209.1_1 Reverse -339 -347 8.57422 0.0425
NP_440209.1_1 Forward -348 -340 5.52596 0.0821
NP_441713.1_3 Reverse -285 -304 6.68596 0.249
NP_442570.1_3 Forward -258 -239 0.0977854 0.208
NP_442570.1_3 Reverse -223 -242 -3.93378 0.225
NP_442111.1_4 Forward -349 -335 10.816 0.0518
NP_441163.1_1 Forward -215 -198 11.7395 0.183
NP_440906.1_5 Reverse -340 -347 6.23397 0.234
NP_440906.1_5 Forward -347 -340 6.13563 0.241
NP_440747.1_10 Reverse -336 -348 -2.32097 0.0331
NP_440747.1_10 Forward -351 -339 -2.51763 0.0509
NP_442634.1_4 Forward -350 -336 -3.63866 0.161
NP_442760.1_4 Forward -245 -226 12.7825 0.222
NP_440842.1_10 Reverse -238 -252 9.93102 0.251
NP_441014.1_8 Forward -200 -181 -7.96535 0.282
NP_442848.1_1 Forward -309 -295 0.0979218 0.263
NP_443018.1_3 Forward -347 -340 11.7405 0.0655
NP_443018.1_3 Forward -198 -191 8.20058 0.153
NP_443018.1_3 Reverse -340 -347 5.44732 0.193
NP_441316.1_7 Forward -350 -335 -1.00341 0.221
NP_440376.1_1 Reverse -339 -348 5.99792 0.111
NP_440376.1_1 Forward -348 -339 -0.196935 0.285
NP_441588.1_4 Forward -123 -113 5.09324 0.297
NP_442687.1_7 Forward -349 -339 5.97822 0.179
NP_442687.1_7 Reverse -350 -360 4.60159 0.243
NP_442687.1_7 Reverse -115 -125 3.81494 0.286
NP_442687.1_7 Reverse -35 -45 3.71661 0.292
NP_440066.1_5 Forward -241 -222 6.39016 0.281
NP_440642.1_10 Forward -252 -238 12.6836 0.134
NP_441013.1_3 Reverse -34 -53 5.89931 0.281
NP_441422.1_7 Forward -201 -184 -9.20427 0.294
NP_441950.1_7 Reverse -193 -212 -8.06369 0.283
NP_442296.1_5 Forward -134 -115 3.73603 0.251
NP_440360.1_5 Reverse -213 -232 1.47442 0.297
NP_440360.1_10 Forward -205 -191 1.67122 0.294
NP_442658.1_1 Reverse -239 -249 12.0743 0.0643
NP_442658.1_1 Reverse -245 -255 7.45273 0.214
NP_442658.1_1 Forward -236 -226 7.0594 0.214
NP_442496.1_5 Reverse -233 -251 12.0155 0.207
NP_442544.1_2 Forward -242 -228 0.392915 0.217
NP_442937.1_5 Forward -79 -60 7.07928 0.263
NP_442321.1_9 Reverse -116 -135 12.0942 0.278
NP_441958.1_5 Reverse -338 -348 9.81313 0.0174
NP_441958.1_5 Forward -349 -339 0.865012 0.12
NP_441958.1_5 Forward -156 -146 -1.49493 0.241
NP_440203.1_5 Forward -325 -315 11.8776 0.171
NP_439905.1_1 Forward -347 -334 9.36073 0.221
NP_440984.1_7 Reverse -334 -348 9.43936 0.127
NP_441097.1_4 Reverse -233 -252 14.1591 0.0624
NP_439990.1_5 Forward -308 -295 6.50913 0.234
NP_442064.1_4 Forward -260 -241 5.30853 0.271
NP_440993.1_4 Reverse -241 -258 8.10198 0.216
NP_441099.1_5 Forward -358 -339 1.86774 0.0602
NP_442002.1_9 Forward -188 -181 10.7572 0.185
NP_441654.1_7 Forward -32 -13 12.146 0.27
NP_442440.1_6 Reverse -169 -188 19.174 0.206
NP_442431.1_7 Reverse -264 -283 11.8975 0.175
NP_441000.1_6 Forward -349 -335 -3.73699 0.225
NP_441000.1_6 Reverse -177 -191 -4.32697 0.237
NP_440484.1_1 Reverse -96 -115 9.53674 0.244
NP_440147.1_4 Reverse -337 -350 7.09911 0.0755
NP_441550.1_8 Reverse -337 -347 14.5325 0.0141
NP_441550.1_8 Forward -350 -340 13.5492 0.0238
NP_441916.1_7 Forward -348 -338 1.06167 0.294
NP_441916.1_10 Reverse -239 -258 5.80098 0.208
NP_440206.1_4 Forward -353 -334 -1.37794 0.29
NP_441041.1_4 Reverse -178 -197 -11.4069 0.246
NP_441041.1_4 Forward -234 -215 -11.8986 0.254
NP_441041.1_7 Reverse -336 -348 8.77809 0.131
NP_441725.1_5 Forward -249 -239 5.09324 0.115
NP_441725.1_5 Forward -186 -176 0.176696 0.206
NP_441725.1_5 Reverse -340 -350 0.0783647 0.215
NP_439966.1_7 Forward -350 -340 8.3377 0.14
NP_439966.1_7 Forward -189 -179 6.17443 0.191
NP_439966.1_7 Reverse -337 -347 4.60114 0.265
NP_442941.1_3 Forward -347 -337 9.41981 0.0319
NP_442941.1_3 Reverse -179 -189 -0.609952 0.264
NP_440289.1_2 Forward -351 -338 -4.60227 0.29
NP_440289.1_2 Forward -190 -177 -4.60227 0.29
NP_440289.1_2 Reverse -336 -349 -4.9956 0.294
NP_440983.1_5 Reverse -235 -254 -3.04881 0.233
NP_440260.1_8 Forward -259 -241 9.55725 0.151
NP_442281.1_1 Forward -353 -339 11.012 0.0511
NP_442281.1_1 Forward -192 -178 9.24208 0.0726
NP_442281.1_1 Forward -212 -198 2.16228 0.276
NP_441334.1_7 Forward -96 -77 -16.7168 0.275
NP_440395.1_9 Reverse -196 -215 18.1907 0.212
NP_442256.1_2 Forward -350 -332 1.88744 0.107
NP_440437.1_1 Reverse -172 -191 8.45592 0.0559
NP_440647.1_9 Forward -350 -332 9.85225 0.188
NP_442012.1_6 Forward -393 -374 18.6823 0.132
NP_442049.1_4 Reverse -199 -218 0.196116 0.256
NP_441087.1_6 Forward -215 -197 -3.22649 0.296
NP_441457.1_7 Reverse -245 -264 0.392778 0.287
NP_440375.1_8 Reverse -191 -210 1.27776 0.252
NP_442068.1_4 Forward -249 -230 13.8633 0.137
NP_442068.1_4 Forward -207 -188 5.40686 0.261
NP_441644.1_6 Forward -348 -338 16.1058 0.0048
NP_443049.1_6 Reverse -338 -348 12.3241 0.24
NP_442029.1_6 Reverse -193 -212 4.42435 0.268
NP_442247.1_6 Reverse -225 -244 19.174 0.11
NP_440929.1_8 Forward -348 -339 7.07956 0.0713
NP_441751.2_8 Reverse -340 -354 -4.03198 0.158
NP_441751.2_8 Forward -124 -110 -4.03198 0.158
NP_441751.2_8 Forward -347 -333 -4.52363 0.174
NP_441751.2_8 Forward -186 -172 -5.21195 0.199
NP_442554.1_8 Forward -347 -337 7.45319 0.092
NP_442554.1_8 Reverse -295 -305 4.79825 0.173
NP_442554.1_8 Reverse -340 -350 3.22496 0.235
NP_442142.1_4 Forward -351 -338 7.88518 0.127
NP_442142.1_4 Forward -325 -312 2.47701 0.29
NP_442142.1_4 Reverse -222 -235 2.37867 0.294
NP_442292.1_1 Forward -347 -338 7.66954 0.0634
NP_442381.1_8 Reverse -336 -355 -14.6519 0.284
NP_442406.1_9 Reverse -240 -259 -0.590531 0.291
NP_441715.1_4 Forward -347 -337 6.96153 0.121
NP_440881.1_1 Forward -212 -193 11.2092 0.123
NP_440379.1_5 Reverse -238 -257 -2.0655 0.194
NP_441468.1_1 Reverse -295 -302 7.41394 0.121
NP_441468.1_1 Reverse -340 -347 6.13563 0.209
NP_441468.1_1 Forward -347 -340 6.0373 0.223
NP_441618.1_3 Forward -348 -329 14.9458 0.0511
NP_441015.1_10 Reverse -185 -204 -3.04881 0.184
NP_441015.1_10 Reverse -193 -212 -7.4737 0.267
NP_441673.1_1 Reverse -339 -348 1.37636 0.114
NP_441673.1_1 Forward -348 -339 1.1797 0.163
NP_441731.1_3 Reverse -331 -350 -5.60541 0.284
NP_441876.1_9 Forward -245 -235 13.0576 0.267
NP_441426.1_3 Forward -214 -195 10.52 0.257
NP_441826.1_2 Reverse -110 -124 8.75105 0.0691
NP_441826.1_2 Forward -394 -380 -1.5737 0.25
NP_442868.1_6 Forward -350 -340 8.4365 0.057
NP_442868.1_6 Reverse -337 -347 0.668351 0.213
NP_442719.1_2 Forward -38 -20 3.95163 0.155
NP_441056.1_1 Reverse -339 -358 -7.57203 0.274
NP_442227.1_2 Reverse -332 -351 -1.47551 0.262
NP_442227.1_2 Forward -248 -229 -3.54046 0.293
NP_441911.1_10 Reverse -241 -260 11.5476 0.21
NP_442808.1_1 Forward -349 -339 9.71433 0.0481
NP_442808.1_1 Forward -242 -232 4.60114 0.195
NP_442808.1_1 Forward -208 -198 2.83119 0.254
NP_440031.1_10 Reverse -221 -240 3.83436 0.256
NP_442542.1_2 Reverse -337 -350 5.52582 0.262
NP_442542.1_9 Reverse -332 -346 12.2903 0.11
NP_442050.1_5 Forward -350 -340 10.501 0.147
NP_440558.1_2 Forward -376 -357 -2.95047 0.232
NP_440558.1_2 Reverse -291 -310 -2.95047 0.232
NP_440558.1_2 Forward -259 -240 -5.01543 0.251
NP_442789.1_4 Reverse -63 -82 -7.27704 0.292
NP_441518.1_3 Forward -197 -178 -8.94866 0.202
NP_441878.1_6 Reverse -293 -303 0.963343 0.128
NP_441878.1_6 Reverse -197 -207 0.668351 0.139
NP_441878.1_6 Forward -349 -339 0.57002 0.14
NP_441878.1_6 Reverse -240 -250 -7.0998 0.204
NP_441036.1_8 Forward -156 -146 8.23984 0.176
NP_441557.1_5 Reverse -339 -348 1.08137 0.0794
NP_441557.1_5 Forward -348 -339 0.589713 0.134
NP_442419.1_2 Forward -212 -193 -4.91709 0.295
NP_442419.1_2 Reverse -185 -204 -5.11376 0.295
NP_442183.1_1 Forward -187 -173 7.37441 0.143
NP_440356.1_2 Forward -113 -94 -0.0988766 0.266
NP_442347.1_2 Reverse -179 -188 3.93297 0.284
NP_441037.1_4 Reverse -239 -249 7.02532 0.237
NP_442594.1_8 Reverse -196 -215 1.96607 0.295
NP_441633.1_3 Forward -252 -239 -6.37223 0.248
NP_441633.1_3 Forward -293 -280 -6.56889 0.259
NP_440136.1_2 Reverse -340 -347 6.23397 0.171
NP_440136.1_2 Forward -347 -340 6.13563 0.193
NP_442590.1_10 Reverse -146 -165 5.11266 0.267
NP_442590.1_10 Forward -74 -55 4.62101 0.273
NP_442590.1_10 Forward -262 -243 3.83436 0.283
NP_442998.1_10 Forward -346 -339 15.5754 0.0102
NP_442998.1_10 Reverse -180 -187 6.0373 0.205
NP_440299.1_1 Forward -53 -40 11.4251 0.0489
NP_441799.1_1 Forward -352 -338 8.16044 0.122
NP_441799.1_4 Forward -294 -275 -4.03212 0.203
NP_441007.1_10 Reverse -334 -347 1.39592 0.203
NP_442756.1_2 Forward -356 -337 5.50599 0.27
NP_440915.1_6 Reverse -335 -349 7.17775 0.074
NP_442866.1_1 Reverse -334 -353 -3.73712 0.221
NP_441464.1_8 Forward -303 -289 10.3243 0.181
NP_441464.1_10 Reverse -230 -244 8.94771 0.267
NP_441113.1_3 Reverse -238 -252 15.1419 0.27
NP_441939.1_3 Forward -347 -328 6.78429 0.222
NP_441199.1_6 Forward -211 -192 2.16274 0.198
NP_442386.1_9 Forward -235 -226 9.14408 0.172
NP_442386.1_9 Reverse -224 -233 5.11253 0.266
NP_442386.1_9 Forward -349 -340 4.52254 0.297
NP_441750.1_1 Reverse -226 -245 2.85105 0.128
NP_441340.1_5 Reverse -340 -347 13.5105 0.0314
NP_441340.1_5 Forward -347 -340 5.84064 0.208
NP_441947.1_10 Reverse -50 -68 0.707465 0.276
NP_442484.1_2 Reverse -328 -347 -1.96717 0.3
NP_442791.1_5 Forward -36 -17 -10.9153 0.282
NP_442791.1_5 Forward -242 -223 -11.1119 0.287
NP_440168.1_9 Forward -350 -331 2.75272 0.231
NP_440327.1_6 Reverse -181 -200 2.94938 0.285
NP_441254.1_2 Forward -35 -16 9.53756 0.211
NP_442506.1_2 Reverse -328 -347 5.211 0.269
NP_440161.1_10 Reverse -235 -254 13.2677 0.295
NP_440586.1_8 Forward -347 -340 9.47853 0.146
NP_440586.1_8 Forward -198 -191 9.08521 0.178
NP_440586.1_8 Reverse -340 -347 5.74197 0.283
NP_440684.1_9 Reverse -110 -124 11.5043 0.173
NP_441262.1_3 Reverse -339 -346 14.7888 0.0223
NP_440027.1_3 Reverse -30 -48 4.83661 0.25
NP_443051.1_1 Reverse -338 -347 16.6177 0.00754
NP_443051.1_1 Forward -349 -340 -1.18024 0.297
NP_439984.1_3 Forward -355 -341 13.4703 0.223
NP_439937.1_8 Forward -201 -182 -0.983855 0.247
NP_440439.1_1 Reverse -336 -349 9.65572 0.0447
NP_440372.1_2 Reverse -340 -347 13.8055 0.0214
NP_440372.1_2 Forward -347 -340 6.52896 0.188
NP_441789.1_7 Forward -54 -35 3.63691 0.194
NP_441789.1_7 Forward -300 -281 1.37531 0.245
NP_440316.1_10 Reverse -338 -348 12.4681 0.214
NP_440316.1_10 Reverse -246 -256 5.78156 0.281
NP_441803.1_2 Reverse -220 -239 2.55606 0.209
NP_440139.1_1 Forward -193 -174 0.785326 0.281
NP_441572.1_7 Reverse -333 -352 -5.60541 0.265
NP_442384.1_10 Forward -348 -335 4.93583 0.142
NP_442384.1_10 Forward -360 -347 4.8375 0.145
NP_442384.1_10 Forward -125 -112 1.10092 0.268
NP_441877.1_7 Reverse -236 -255 1.27698 0.242
NP_442262.1_10 Forward -347 -340 13.2155 0.0213
NP_442262.1_10 Forward -198 -191 9.38056 0.202
NP_441689.1_5 Reverse -337 -347 5.78111 0.197
NP_440344.1_10 Forward -194 -177 -10.7776 0.19
NP_440531.1_6 Reverse -331 -350 1.86774 0.166
NP_442123.1_3 Reverse -178 -197 14.6508 0.135
NP_440297.1_9 Forward -186 -176 -0.216628 0.282
NP_442187.1_3 Reverse -338 -348 13.4514 0.245
NP_442280.1_10 Forward -259 -241 8.37644 0.258
NP_442553.1_7 Forward -274 -260 15.8309 0.255
NP_442078.1_3 Forward -140 -121 -1.37794 0.277
NP_440999.1_2 Reverse -242 -261 8.55425 0.288
NP_440888.1_2 Forward -256 -242 11.2087 0.0729
NP_440888.1_2 Forward -348 -334 8.3571 0.163
NP_440888.1_2 Forward -262 -248 5.40719 0.28
NP_442147.1_6 Forward -350 -336 17.2068 0.205
NP_442277.1_2 Forward -251 -237 19.9608 0.0731
NP_442033.1_10 Forward -390 -371 -9.14533 0.212
NP_441543.1_2 Forward -347 -338 6.09625 0.153
NP_442845.1_2 Reverse -226 -240 6.19444 0.215
NP_442845.1_2 Reverse -307 -321 4.91614 0.249
NP_441551.1_5 Forward -352 -336 12.6442 0.15
NP_440982.1_1 Forward -241 -222 6.78348 0.294
NP_441469.1_8 Forward -235 -226 11.5045 0.165
NP_441469.1_8 Forward -188 -179 6.19458 0.231
NP_442637.1_1 Reverse -217 -236 -2.95047 0.16
NP_443064.1_6 Reverse -390 -400 9.17338 0.242
NP_442578.1_7 Reverse -340 -347 6.0373 0.18
NP_442578.1_7 Forward -186 -179 5.25066 0.251
NP_441462.1_2 Reverse -339 -349 16.1063 0.00406
NP_441462.1_2 Forward -348 -338 0.57002 0.144
NP_443062.1_1 Reverse -116 -134 6.40076 0.202
NP_443062.1_1 Reverse -178 -196 6.20575 0.206
NP_441601.1_4 Forward -284 -265 -5.9004 0.295
NP_442204.1_1 Reverse -335 -346 11.2684 0.0565
NP_442204.1_1 Reverse -96 -107 0.353664 0.281
NP_442204.1_2 Reverse -329 -348 11.3075 0.223
NP_442204.1_5 Reverse -231 -250 0.687771 0.256
NP_442487.1_3 Reverse -227 -246 16.2241 0.204
NP_440516.1_8 Reverse -339 -348 18.9776 0.00442
NP_440516.1_8 Forward -348 -339 5.01461 0.118
NP_442428.1_5 Reverse -340 -347 6.13563 0.209
NP_442428.1_5 Forward -347 -340 6.0373 0.212
NP_441443.1_1 Reverse -238 -257 -5.70374 0.298
NP_441443.1_2 Forward -215 -196 -5.9004 0.29
NP_442823.1_9 Reverse -122 -141 13.615 0.277
NP_440673.1_3 Forward -346 -339 12.4288 0.0426
NP_441052.1_2 Forward -388 -378 3.22496 0.182
NP_441052.1_2 Forward -348 -338 1.16001 0.25
NP_441052.1_2 Reverse -65 -75 0.57002 0.256
NP_442219.1_9 Forward -387 -378 2.55633 0.252
NP_440648.1_1 Forward -348 -329 7.17762 0.189
NP_441719.1_4 Reverse -340 -347 6.82395 0.0855
NP_441719.1_4 Forward -347 -340 6.52896 0.188
NP_441733.1_10 Reverse -336 -349 4.73917 0.244
NP_441004.1_1 Reverse -192 -211 0.982764 0.111
NP_441004.1_1 Forward -240 -221 -11.2103 0.234
NP_441004.1_1 Reverse -235 -254 -12.8819 0.251
NP_441004.1_1 Reverse -321 -340 -18.2901 0.299
NP_441004.1_3 Forward -231 -212 7.57094 0.204
NP_441004.1_9 Reverse -38 -56 11.7989 0.257
NP_442366.1_3 Reverse -350 -368 2.67408 0.125
NP_442366.1_3 Reverse -39 -57 -3.22577 0.244
NP_442366.1_3 Reverse -177 -195 -4.11075 0.264
NP_442176.1_4 Reverse -227 -246 6.39097 0.298
NP_442873.1_3 Forward -215 -196 4.91521 0.262
NP_440296.1_10 Forward -351 -332 -12.8819 0.269
NP_440296.1_10 Reverse -195 -214 -14.3569 0.269
NP_442206.1_10 Forward -348 -333 3.42148 0.185
NP_442854.1_6 Reverse -339 -358 4.22769 0.252
NP_442854.1_7 Reverse -182 -201 21.0423 0.0119
NP_440328.1_4 Forward -354 -335 3.83436 0.172
NP_443054.1_2 Reverse -245 -259 -0.0987402 0.284
NP_442308.1_4 Forward -80 -61 2.85105 0.267
NP_440508.1_4 Reverse -103 -122 14.3558 0.229
NP_441851.1_10 Forward -188 -178 10.0098 0.106
NP_441851.1_10 Forward -100 -90 6.8632 0.153
NP_441851.1_10 Reverse -177 -187 4.79825 0.247
NP_441851.1_10 Forward -400 -390 4.3066 0.277
NP_442622.1_3 Forward -299 -280 2.45773 0.215
NP_442515.1_1 Forward -304 -290 -4.7203 0.298
NP_441396.1_5 Reverse -191 -200 17.2076 0.141
NP_440593.1_3 Forward -60 -41 6.58763 0.112
NP_440463.1_8 Forward -257 -238 15.2449 0.165
NP_440432.1_9 Forward -347 -332 -3.36336 0.179
NP_440474.1_8 Reverse -179 -193 4.32555 0.284
NP_440943.1_5 Reverse -124 -138 10.7177 0.29
NP_442006.1_2 Reverse -241 -258 -7.13932 0.169
NP_442006.1_2 Reverse -71 -88 -18.8407 0.296
NP_440483.1_1 Reverse -334 -353 -3.44213 0.215
NP_440483.1_1 Reverse -227 -246 -4.13045 0.218
NP_440078.1_10 Reverse -198 -217 6.68596 0.218
NP_441078.1_4 Reverse -339 -348 0.196389 0.205
NP_441078.1_4 Forward -348 -339 -0.000272808 0.205
NP_442729.1_4 Reverse -256 -275 20.1564 0.0596
NP_441663.1_8 Forward -354 -335 16.2241 0.0374
NP_441663.1_8 Reverse -333 -352 10.7175 0.0741
NP_442348.1_2 Forward -224 -215 6.8829 0.298
NP_442443.1_1 Forward -230 -211 -5.99873 0.289
NP_441432.1_8 Reverse -338 -347 14.0611 0.0258
NP_441432.1_8 Reverse -246 -255 5.60459 0.147
NP_442320.1_8 Forward -193 -179 -4.4253 0.168
NP_442344.1_7 Reverse -179 -198 -9.53865 0.257
NP_440313.1_5 Reverse -150 -168 11.0314 0.286
NP_442003.1_9 Reverse -226 -245 3.73603 0.279
NP_440759.1_6 Reverse -240 -259 0.884433 0.28
NP_442815.1_2 Reverse -41 -59 6.41066 0.212
NP_442797.1_6 Forward -254 -235 18.0177 0.17
NP_442797.1_6 Reverse -180 -199 9.09765 0.246
NP_440199.1_10 Reverse -113 -123 16.1063 0.0861
NP_442178.1_1 Forward -249 -230 14.5524 0.152
NP_442489.1_2 Forward -198 -179 4.32602 0.22
NP_442489.1_7 Forward -348 -339 0.688044 0.152
NP_442489.1_7 Reverse -339 -348 0.688044 0.152
NP_440559.1_1 Reverse -340 -349 6.39124 0.134
NP_441659.2_8 Forward -348 -338 8.23984 0.0462
NP_441659.2_8 Reverse -146 -156 2.7333 0.19
NP_441659.2_8 Reverse -339 -349 0.275027 0.27
NP_442008.1_2 Reverse -336 -355 8.06259 0.202
NP_442008.1_2 Forward -351 -332 3.93269 0.245
NP_442776.1_1 Reverse -328 -347 3.73603 0.279
NP_442346.1_5 Reverse -115 -125 9.22315 0.118
NP_442346.1_5 Reverse -197 -207 4.99491 0.267
NP_442346.1_5 Forward -349 -339 4.3066 0.291
NP_440545.1_3 Forward -254 -237 -1.73112 0.173
NP_440545.1_3 Forward -352 -335 -6.05768 0.268
NP_441629.1_3 Forward -283 -264 -3.44288 0.277
NP_441629.1_9 Forward -239 -220 20.3531 0.111
NP_440459.1_2 Reverse -238 -255 7.512 0.288
NP_441653.1_2 Forward -359 -340 4.01279 0.264
NP_440010.1_10 Reverse -229 -248 2.3594 0.279
NP_442551.1_4 Reverse -196 -211 -3.75668 0.295
NP_442603.1_7 Reverse -339 -353 5.99717 0.264
NP_441833.1_4 Forward -347 -340 6.52896 0.0924
NP_441833.1_4 Reverse -340 -347 6.23397 0.163
NP_442162.1_8 Forward -268 -249 -3.63879 0.291
NP_442162.1_9 Forward -347 -340 12.9205 0.0282
NP_442162.1_9 Reverse -340 -347 12.9205 0.0282
NP_441044.1_4 Forward -210 -192 5.03403 0.227
NP_442199.1_7 Forward -144 -125 1.96529 0.269
NP_442140.1_3 Reverse -340 -350 4.10993 0.261
NP_440875.1_9 Forward -346 -336 16.5483 0.0145
NP_441813.1_5 Forward -350 -340 15.2213 0.0118
NP_441813.1_5 Reverse -337 -347 8.4365 0.0432
NP_440590.1_4 Reverse -34 -47 -1.94734 0.233
NP_440590.1_4 Reverse -295 -308 -5.48725 0.28
NP_442497.1_10 Forward -347 -338 7.76787 0.0731
NP_442497.1_10 Reverse -340 -349 1.08137 0.115
NP_440821.1_4 Reverse -176 -186 6.27322 0.0921
NP_440821.1_4 Forward -189 -179 -0.511621 0.269
NP_441239.1_9 Forward -350 -338 11.052 0.0672
NP_441239.1_9 Reverse -292 -304 8.88877 0.12
NP_441239.1_9 Forward -47 -35 3.67722 0.279
NP_441239.1_9 Reverse -196 -208 3.48056 0.285
NP_440400.1_1 Forward -382 -363 1.6703 0.263
NP_441892.1_1 Forward -393 -376 -5.27103 0.276
NP_442270.1_9 Reverse -221 -240 -8.85033 0.226
NP_442052.1_8 Reverse -239 -249 12.4681 0.268
NP_440546.1_4 Reverse -339 -349 14.9908 0.0459
NP_440546.1_4 Forward -348 -338 8.20381 0.199
NP_440546.1_4 Reverse -232 -242 7.52511 0.235
NP_440675.1_1 Reverse -189 -208 2.16274 0.278
NP_440462.1_6 Reverse -337 -347 9.22315 0.049
NP_440462.1_6 Forward -350 -340 5.78156 0.138
NP_440462.1_6 Forward -189 -179 2.33998 0.29
NP_442611.1_1 Reverse -227 -246 -1.57384 0.282
NP_440868.1_4 Reverse -335 -347 14.4936 0.0176
NP_440868.1_4 Forward -352 -340 0.0389777 0.234
NP_442499.1_1 Forward -249 -230 1.86774 0.3
NP_442787.1_7 Reverse -169 -188 16.0824 0.227
NP_441084.1_6 Forward -127 -113 10.4106 0.241
NP_440696.1_3 Forward -260 -242 -1.65248 0.264
NP_440696.1_3 Forward -266 -248 -2.73412 0.279
NP_442039.1_4 Reverse -340 -347 11.6422 0.0747
NP_442039.1_7 Reverse -192 -202 10.4031 0.257
NP_441811.1_1 Forward -250 -231 11.7008 0.257
NP_442837.1_3 Reverse -179 -186 9.18389 0.144
NP_442837.1_3 Forward -347 -340 6.0373 0.25
NP_442837.1_3 Reverse -340 -347 6.0373 0.25
NP_440160.1_9 Reverse -64 -83 13.3725 0.204
NP_442053.1_1 Forward -348 -339 14.4544 0.0114
NP_442053.1_1 Reverse -339 -348 7.86621 0.0863
NP_440505.1_3 Reverse -337 -347 15.6147 0.0106
NP_441959.1_10 Reverse -196 -214 15.4772 0.178
NP_441408.2_7 Reverse -239 -258 5.99764 0.172
NP_440914.1_1 Forward -348 -338 11.8356 0.0767
NP_440914.1_1 Forward -125 -115 11.738 0.079
NP_440914.1_1 Reverse -241 -251 9.10306 0.186
NP_441011.1_8 Reverse -340 -349 9.24284 0.131
NP_441011.1_8 Forward -347 -338 6.78456 0.184
NP_442533.1_1 Reverse -265 -284 -17.1101 0.281
NP_442533.1_6 Forward -207 -198 6.29291 0.113
NP_442533.1_6 Forward -348 -339 4.42462 0.179
NP_441089.1_10 Reverse -328 -347 17.0107 0.0424
NP_442322.1_4 Forward -214 -197 0.0381458 0.21
NP_441482.1_7 Forward -354 -340 -4.7203 0.156
NP_441028.1_6 Forward -246 -236 10.3043 0.203
NP_442202.1_10 Forward -349 -335 3.34284 0.278
NP_440115.1_6 Reverse -336 -346 14.0414 0.0615
NP_440007.1_9 Reverse -335 -349 4.12949 0.267
NP_441106.1_1 Reverse -338 -347 8.75118 0.0469
NP_441420.1_2 Forward -250 -231 12.8808 0.268
NP_439903.1_6 Forward -376 -357 0.785326 0.256
NP_441286.1_1 Reverse -338 -350 -4.38592 0.156
NP_441286.1_1 Forward -251 -239 -6.2542 0.254
NP_442674.1_2 Reverse -305 -324 6.68596 0.298
NP_440670.1_8 Reverse -339 -348 8.75118 0.0606
NP_440670.1_8 Forward -348 -339 6.19458 0.124
NP_441930.1_2 Reverse -225 -235 11.6814 0.278
NP_440886.1_7 Forward -349 -339 6.76441 0.114
NP_440886.1_7 Forward -242 -232 3.91283 0.26
NP_440828.1_4 Forward -56 -37 -2.26292 0.214
NP_441001.1_10 Reverse -284 -303 4.81767 0.292
NP_442717.1_1 Reverse -130 -149 -2.0655 0.285
NP_440223.1_7 Reverse -235 -249 12.8809 0.231
NP_440907.2_8 Forward -347 -337 7.84605 0.117
NP_441021.1_8 Reverse -173 -191 3.75572 0.226
NP_441463.1_3 Forward -197 -178 -1.08219 0.135
NP_441463.1_3 Forward -358 -339 -6.58872 0.246
NP_441463.1_3 Reverse -284 -303 -6.58872 0.246
NP_441626.1_2 Reverse -340 -347 12.2322 0.0511
NP_441626.1_2 Forward -347 -340 5.93897 0.231
NP_442365.1_5 Forward -249 -230 15.3391 0.092
NP_441589.1_5 Reverse -39 -58 16.2725 0.262
NP_441460.1_5 Forward -34 -20 20.3534 0.053
NP_442794.1_1 Forward -197 -185 4.75886 0.249
NP_441962.1_4 Forward -308 -289 -14.4552 0.288
NP_440855.1_1 Reverse -373 -392 -0.983855 0.267
NP_441431.1_3 Reverse -192 -211 3.34271 0.268
NP_441488.1_7 Reverse -168 -187 3.14605 0.234
NP_441488.1_8 Reverse -334 -348 8.25877 0.199
NP_441836.1_1 Forward -85 -66 12.3759 0.259
NP_441993.1_1 Forward -88 -69 3.79838 0.228
NP_441993.1_1 Reverse -376 -395 2.1416 0.262
NP_440143.1_1 Reverse -43 -62 13.0775 0.284
NP_442352.1_8 Forward -202 -188 16.2235 0.242
NP_440114.1_10 Reverse -339 -353 6.09611 0.285
NP_442323.1_7 Reverse -79 -98 2.35861 0.266
NP_442323.1_7 Reverse -153 -172 1.96529 0.276
NP_440293.1_3 Forward -258 -239 -6.58872 0.291
NP_440766.1_4 Reverse -186 -200 10.9143 0.0811
NP_442743.1_1 Forward -217 -198 9.04509 0.262
NP_440457.1_1 Reverse -174 -186 4.16888 0.171
NP_440457.1_1 Reverse -335 -347 2.89058 0.205
NP_440798.1_6 Forward -347 -334 1.10092 0.234
NP_441801.1_4 Reverse -330 -340 2.53664 0.292
NP_440142.1_7 Reverse -242 -261 6.4893 0.259
NP_441984.1_3 Reverse -290 -308 6.80398 0.264
NP_441984.1_3 Reverse -69 -87 6.11567 0.275
NP_441332.1_6 Forward -242 -232 15.4224 0.121
NP_442040.1_5 Forward -215 -196 14.9449 0.26
NP_441436.1_6 Reverse -225 -244 8.16093 0.26
NP_440473.1_9 Reverse -230 -249 3.93269 0.0985
NP_442509.1_9 Forward -357 -347 13.3526 0.0571
NP_442509.1_9 Forward -399 -389 13.2542 0.0598
NP_442509.1_9 Reverse -339 -349 13.1559 0.061
NP_440554.1_4 Forward -347 -337 15.0247 0.02
NP_441845.1_6 Forward -199 -181 -0.275845 0.274
NP_441885.1_5 Reverse -339 -349 -0.0199663 0.186
NP_441885.1_5 Forward -155 -145 -1.78992 0.284
NP_442341.1_9 Reverse -337 -351 14.6503 0.0643
NP_442341.1_9 Forward -157 -143 5.1122 0.279
NP_441756.1_5 Forward -352 -333 10.6192 0.117
NP_443000.1_7 Reverse -337 -347 10.5998 0.0345
NP_441842.1_10 Forward -194 -180 6.88276 0.271
NP_440275.1_3 Reverse -337 -347 13.5497 0.0268
NP_440679.1_10 Forward -346 -327 -17.7001 0.275
NP_443010.1_10 Forward -190 -173 6.73278 0.179
NP_441190.1_2 Reverse -67 -86 0.786102 0.263
NP_439962.1_4 Forward -352 -333 -3.14714 0.246
NP_442495.1_4 Forward -344 -334 12.3697 0.229
NP_441105.1_3 Forward -261 -242 -7.96535 0.263
NP_440216.1_1 Forward -348 -334 5.01447 0.0225
NP_440216.1_1 Reverse -339 -353 -4.03198 0.096
NP_440216.1_9 Forward -134 -125 14.0611 0.184
NP_440216.1_9 Reverse -243 -252 6.78456 0.289
NP_440172.1_1 Reverse -339 -349 7.55152 0.0761
NP_440172.1_1 Forward -348 -338 4.79825 0.166
NP_441718.1_4 Reverse -335 -354 11.2084 0.299
NP_442015.1_10 Forward -352 -339 2.67422 0.187
NP_441226.1_7 Reverse -340 -347 12.7234 0.0312
NP_441226.1_7 Forward -347 -340 11.5435 0.0757
NP_441226.1_7 Forward -240 -233 6.52862 0.253
NP_441111.1_7 Forward -347 -339 8.86921 0.0589
NP_441766.1_2 Forward -348 -339 14.7494 0.00772
NP_441766.1_9 Reverse -331 -350 -2.45882 0.281
NP_440416.1_9 Forward -257 -238 -6.68705 0.0929
NP_440416.1_9 Reverse -332 -351 -7.86702 0.108
NP_440416.1_9 Forward -251 -232 -15.6352 0.196
NP_440416.1_9 Reverse -224 -243 -17.7001 0.245
NP_440416.1_9 Forward -284 -265 -18.1918 0.253
NP_440416.1_9 Reverse -374 -393 -20.945 0.289
NP_443052.1_9 Forward -239 -220 5.30933 0.149
NP_442403.1_8 Reverse -180 -199 4.62101 0.226
NP_440591.1_9 Forward -355 -337 8.37728 0.18
NP_440261.1_5 Forward -347 -334 6.31247 0.038
NP_440261.1_5 Forward -249 -236 -12.2721 0.277
NP_440261.1_5 Reverse -340 -353 -12.4687 0.297
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

GGGGGAACCCGCCGTGATCCATACCGAAACCATTTACCTCGACGATGAACCGCCCGATCGCCTGGAGGGTTACATCAACCCCATGACTTTTATCAGTGGCCAGCTCACCATTGATGACCCCACTATGCTCCGCCTGGAACAGTCCGCCTTTGCCTTTGCCCCCATCCGCAATGCCGGAGGATTTGTCACCCTCGACCATGCCCCCATCGAAACGGCGATCCAACTTCTCCAAGACCAATACGTTAGGGGGTCGGTAACTATCAAAACCATTGAAAAACGATGACCATTCTCCTTTATCTCCTGGGAATCCAATGCTTTGCCGCCCTGTTGATAGTCCATGCCATTTACCTTAACCACCGCTGACCCTTGATAACTGTTCCCTGAAACCTGATACCTGATT

CDS

ATGTTTGCCTCCAATCCAAAACCTAGACCCCTAGTTAACCGTTTAGCCCATACCCAAACCCCTAGTAATTTTCCAGTAGTCAACCGGGAGGGAGTGTTAATCGGTGAGCAGATTTATTGGAACCCCGCCACCGTGGCCAATCCCCATGGGTGCATCATTGGCGGTTCCGGGGCCGGTAAAACCCAAACCCTGAAGGCGATCGCCTGGGAGGTGAGCAAGTTGGTGGAGGTGGCCATCATTGATTTCCATGGCGACCAGGAGCTACCGGGGGAAAAGGTTTACCACATCAATATGACCAGCAACTCTGGCATTAATCCCCTAGTAATTAACCTCGACCAGGAAGGGGGCGGCCCCAATCTGCGGGCCATTGAGCTGGCCATGCTATTCGCCAAAACCCTACGGTTGGGCAGTAATCAACAGGGCAAACTACTAGATGCGTTCAAACATTGCTATTTCCGTCGGGGCATCTCCCAGGAATCCCCCCAGAGTTGGTTGAAAGTACCCCCTAACTTTTCTGACTTGGAAGCTTTGCTGGAGGAAATGGCCGAGGAAGACAAGGAAGCGGAAAAGCTGAGACTAAAGCTATCCACCATGTTTGAGTACGGCATTTTCAACAAAACCCAGCCCCCCTATGAAAGGTTAACCCGTTGGAATCTTGCCAAACTTCCCCCCCAATTGCAGGCGATCGCCGGGGATGCTTTAGCGTCCCAGTTGATGAGTCACCACCGTTTACTAGGGGAATCGACTCTCAGGACGGTTTTGTTCATTGATGAAGCTAAGGAGTTGGGCCATTCCAAAGCGTTGGACAGAATTGCGGCGGACGGCAGAAAGTATGGGCTGGGCCTGTGGGTGGCTTCCCAGTCTTCCCGCCATATTTCCAAGGATGTGCTAACCAATACGTTCACTAAGCTGATTCTGCCGGTTGATTCTTCCGAGTTACCCCTAACTGCCCGCACCTTTAGGTTTTCCGAGGAGGCGATCGCCAATTTGAATCCCCTGGAATCATTGGTACGCTTTGGCAAAAATGCCAATAAAGTTAACATTGTCCCCTTTTACCAAAGGAATACACCATGA

Protein

No sequence available