Your browser is old and dusty. Try Google Chrome!

Details for slr6050

ORF slr6050
Accession NP_942493.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Forward -135 -121 18.5841 0.0193
NP_441061.1_2 Reverse -128 -142 3.53951 0.163
NP_440557.1_1 Forward -135 -116 17.699 0.0473
NP_440795.1_7 Forward -135 -128 14.6904 0.0123
NP_440795.1_7 Reverse -128 -135 14.6904 0.0123
NP_441418.1_6 Reverse -127 -146 -20.65 0.121
NP_441418.1_6 Forward -136 -117 -29.3032 0.221
NP_441418.1_6 Forward -145 -126 -29.9915 0.249
NP_442291.1_5 Reverse -126 -142 6.54838 0.0694
NP_441453.1_4 Reverse -127 -135 16.539 0.00633
NP_441453.1_4 Forward -136 -128 16.539 0.00633
NP_441623.1_1 Reverse -145 -163 -3.6191 0.262
NP_442151.1_6 Reverse -18 -32 7.57108 0.194
NP_442151.1_6 Reverse -127 -141 5.50613 0.274
NP_441818.1_1 Forward -135 -124 9.69459 0.232
NP_441818.1_9 Forward -107 -88 -6.09707 0.259
NP_440226.1_1 Reverse -127 -146 3.04771 0.241
NP_442173.1_1 Forward -135 -127 15.4574 0.00633
NP_442173.1_1 Reverse -128 -136 15.4574 0.00633
NP_442173.1_1 Forward -344 -336 7.59091 0.163
NP_442752.1_4 Forward -136 -129 13.8055 0.0199
NP_442752.1_4 Reverse -127 -134 13.8055 0.0199
NP_443027.1_4 Forward -138 -128 16.2046 0.0437
NP_443027.1_4 Reverse -125 -135 14.828 0.0437
NP_441812.1_3 Reverse -126 -140 16.8142 0.0639
NP_441812.1_3 Forward -137 -123 7.9644 0.254
NP_442975.1_10 Reverse -123 -137 13.7653 0.0459
NP_442975.1_10 Forward -140 -126 4.32555 0.245
NP_440784.1_7 Forward -135 -128 15.9687 0.0123
NP_440784.1_7 Reverse -128 -135 15.9687 0.0123
NP_442062.1_8 Forward -136 -126 19.4496 0.000558
NP_442062.1_8 Reverse -127 -137 10.3048 0.0493
NP_440761.1_4 Reverse -122 -141 -14.2585 0.261
NP_441900.1_2 Reverse -133 -151 -5.1931 0.288
NP_441859.1_3 Forward -304 -285 2.85027 0.254
NP_440304.1_4 Forward -138 -128 19.9412 0.00364
NP_440304.1_4 Reverse -125 -135 10.8948 0.051
NP_442242.1_4 Forward -135 -128 14.3954 0.0124
NP_442242.1_4 Reverse -128 -135 14.3954 0.0124
NP_441208.1_9 Forward -139 -125 6.19444 0.253
NP_441594.1_6 Reverse -118 -137 10.1275 0.134
NP_440370.1_10 Forward -145 -126 8.45592 0.241
NP_442110.1_7 Reverse -127 -141 2.65453 0.222
NP_442110.1_7 Forward -136 -122 1.67122 0.222
NP_441082.1_10 Forward -271 -258 8.37742 0.275
NP_441083.1_5 Forward -136 -126 11.3864 0.0159
NP_441083.1_5 Reverse -127 -137 11.2881 0.0159
NP_442827.1_8 Reverse -119 -138 15.9282 0.032
NP_441434.1_7 Forward -134 -120 5.99778 0.225
NP_441738.1_2 Forward -134 -127 15.28 0.0102
NP_441738.1_2 Reverse -129 -136 15.28 0.0102
NP_441738.1_2 Reverse -260 -267 6.52862 0.261
NP_441558.1_5 Forward -138 -119 3.93269 0.294
NP_440209.1_1 Reverse -127 -135 18.1123 0.00295
NP_440209.1_1 Forward -136 -128 18.1123 0.00295
NP_442889.1_8 Reverse -124 -138 11.4053 0.0733
NP_441713.1_1 Reverse -121 -140 -15.5368 0.265
NP_440178.1_7 Reverse -126 -145 -21.83 0.241
NP_440538.1_10 Reverse -131 -150 10.7175 0.279
NP_441716.1_1 Reverse -127 -141 8.25939 0.145
NP_442111.1_4 Reverse -76 -90 9.5377 0.0606
NP_442111.1_4 Reverse -126 -140 1.76955 0.294
NP_440906.1_5 Forward -135 -128 15.8704 0.0124
NP_440906.1_5 Reverse -128 -135 15.8704 0.0124
NP_440747.1_10 Forward -139 -127 7.80712 0.00223
NP_440747.1_10 Reverse -124 -136 -2.02597 0.0196
NP_442973.1_5 Reverse -118 -137 13.7658 0.16
NP_441486.1_1 Reverse -124 -138 11.6026 0.0153
NP_441486.1_1 Forward -139 -125 1.96621 0.0939
NP_442634.1_4 Reverse -125 -139 7.86607 0.0479
NP_442634.1_4 Forward -138 -124 -2.26202 0.149
NP_442634.1_4 Forward -88 -74 -4.91696 0.223
NP_440403.1_4 Reverse -118 -137 -8.26035 0.251
NP_440403.1_10 Forward -145 -126 3.73603 0.272
NP_440403.1_10 Forward -136 -117 3.44104 0.273
NP_441695.1_4 Forward -134 -116 14.1788 0.188
NP_441014.1_10 Forward -137 -118 3.44025 0.214
NP_442848.1_1 Reverse -121 -135 -3.63866 0.268
NP_443018.1_3 Forward -135 -128 14.8871 0.0123
NP_443018.1_3 Reverse -128 -135 14.8871 0.0123
NP_441316.1_7 Reverse -125 -140 6.27308 0.107
NP_441634.1_8 Forward -138 -124 2.45787 0.167
NP_440376.1_1 Forward -136 -127 19.4693 0.000692
NP_440376.1_1 Reverse -127 -136 19.4693 0.000692
NP_441588.1_4 Forward -134 -124 6.96153 0.178
NP_442687.1_7 Reverse -126 -136 15.8113 0.0125
NP_442687.1_7 Forward -137 -127 9.02648 0.0994
NP_442485.1_3 Forward -147 -128 3.34271 0.201
NP_441422.1_7 Reverse -125 -142 -5.56602 0.247
NP_440533.1_9 Reverse -127 -146 4.71934 0.22
NP_442658.1_1 Reverse -125 -135 15.9091 0.00966
NP_442658.1_1 Forward -138 -128 13.0576 0.04
NP_442782.1_2 Reverse -127 -141 2.2612 0.275
NP_442205.1_9 Reverse -121 -137 7.13836 0.108
NP_442205.1_9 Forward -142 -126 -0.728113 0.264
NP_440656.1_8 Forward -147 -128 3.6377 0.11
NP_442544.1_6 Forward -143 -124 -8.26035 0.298
NP_441487.1_6 Forward -144 -125 -1.57384 0.285
NP_441487.1_9 Reverse -126 -145 0.491109 0.228
NP_439959.1_6 Reverse -152 -171 13.8641 0.145
NP_441958.1_5 Forward -137 -127 21.2195 0.000805
NP_441958.1_5 Reverse -126 -136 12.2714 0.00183
NP_441958.1_5 Forward -87 -77 -0.708283 0.221
NP_441137.1_2 Forward -206 -192 17.4852 0.258
NP_440203.1_5 Reverse -260 -270 9.91099 0.245
NP_439990.1_5 Forward -272 -259 13.884 0.0889
NP_442911.1_2 Forward -146 -127 -9.63698 0.26
NP_440153.1_5 Reverse -128 -142 8.06273 0.149
NP_440153.1_5 Reverse -78 -92 2.06454 0.239
NP_440153.1_5 Forward -85 -71 1.76955 0.245
NP_442119.1_6 Reverse -125 -144 10.4225 0.134
NP_440993.1_2 Forward -141 -125 8.515 0.143
NP_442002.1_9 Reverse -126 -133 10.7572 0.185
NP_440809.1_9 Reverse -68 -86 -0.275845 0.225
NP_442438.1_10 Reverse -122 -136 10.816 0.0484
NP_441000.1_6 Forward -137 -123 -3.34366 0.221
NP_441000.1_6 Reverse -126 -140 -5.40861 0.275
NP_442771.1_1 Reverse -125 -143 -7.06068 0.169
NP_442771.1_1 Forward -138 -120 -8.33898 0.189
NP_440147.1_4 Reverse -334 -347 8.47575 0.0504
NP_440147.1_4 Reverse -125 -138 2.77255 0.202
NP_440147.1_4 Forward -138 -125 2.37923 0.208
NP_441550.1_8 Forward -138 -128 13.0576 0.0273
NP_441550.1_8 Forward -29 -19 7.55106 0.154
NP_441550.1_8 Reverse -125 -135 6.0761 0.214
NP_441916.1_7 Reverse -127 -137 18.9579 0.00144
NP_441916.1_7 Forward -136 -126 18.4663 0.00144
NP_441916.1_10 Forward -144 -125 5.211 0.214
NP_441041.1_7 Reverse -124 -136 10.916 0.0864
NP_441041.1_7 Forward -139 -127 6.34865 0.211
NP_442396.1_5 Reverse -123 -136 6.90245 0.215
NP_442004.1_6 Forward -136 -122 2.06454 0.274
NP_441725.1_4 Forward -141 -127 3.24392 0.279
NP_441725.1_5 Forward -135 -125 11.2881 0.0247
NP_441725.1_5 Reverse -128 -138 11.1898 0.0247
NP_439966.1_7 Reverse -125 -135 18.4657 0.00473
NP_439966.1_7 Forward -138 -128 14.8275 0.0177
NP_439966.1_7 Reverse -256 -266 5.87944 0.204
NP_439966.1_9 Forward -269 -260 3.7363 0.253
NP_439966.1_9 Reverse -125 -134 0.983037 0.253
NP_442941.1_3 Reverse -128 -138 19.9412 0.00262
NP_442941.1_3 Forward -135 -125 11.4848 0.0116
NP_440289.1_2 Reverse -124 -137 14.5723 0.0107
NP_440289.1_2 Forward -139 -126 -2.83231 0.262
NP_441514.1_4 Reverse -324 -343 13.9592 0.25
NP_442281.1_1 Forward -141 -127 17.9935 0.00513
NP_442281.1_1 Reverse -122 -136 17.7968 0.00542
NP_440437.1_1 Forward -142 -123 -0.4922 0.181
NP_440498.1_1 Forward -145 -127 14.3755 0.0377
NP_442982.1_5 Forward -146 -127 5.70265 0.156
NP_441644.1_6 Reverse -127 -137 19.0557 0.000803
NP_441644.1_6 Forward -136 -126 10.1076 0.0628
NP_441644.1_6 Reverse -77 -87 6.27276 0.163
NP_442215.1_1 Forward -140 -121 5.211 0.247
NP_440929.1_1 Reverse -33 -43 16.0122 0.27
NP_440929.1_8 Forward -136 -127 19.2726 0.000701
NP_440929.1_8 Reverse -127 -136 19.2726 0.000701
NP_442933.1_10 Forward -136 -127 17.601 0.00325
NP_442933.1_10 Reverse -127 -136 17.601 0.00325
NP_441751.2_8 Reverse -128 -142 17.6008 0.0079
NP_441751.2_8 Forward -135 -121 13.0776 0.0177
NP_442554.1_8 Reverse -128 -138 16.9913 0.0065
NP_442554.1_8 Forward -135 -125 13.8447 0.0145
NP_442554.1_8 Reverse -19 -29 2.63497 0.265
NP_441762.1_7 Forward -137 -125 2.98891 0.0676
NP_441762.1_7 Reverse -126 -138 2.20226 0.0676
NP_442142.1_4 Forward -139 -126 17.4232 0.0264
NP_442142.1_4 Reverse -124 -137 16.4399 0.0264
NP_442292.1_1 Reverse -128 -137 17.5026 0.00435
NP_442292.1_1 Forward -135 -126 9.63616 0.0183
NP_442292.1_5 Forward -147 -128 -2.75381 0.299
NP_440039.1_9 Reverse -116 -135 18.584 0.253
NP_442381.1_8 Reverse -124 -143 -3.93378 0.126
NP_443009.1_5 Forward -137 -126 19.626 0.00102
NP_443009.1_5 Reverse -126 -137 7.82632 0.118
NP_441865.1_1 Reverse -240 -259 18.0808 0.212
NP_442408.2_1 Reverse -127 -146 -5.40875 0.27
NP_441715.1_4 Forward -135 -125 16.303 0.0117
NP_441715.1_4 Reverse -128 -138 14.238 0.0295
NP_440881.1_3 Reverse -169 -188 13.7649 0.28
NP_441198.1_8 Forward -138 -128 13.2713 0.108
NP_440379.1_5 Forward -108 -89 -6.78538 0.238
NP_441468.1_1 Forward -135 -128 15.8704 0.0124
NP_441468.1_1 Reverse -128 -135 15.8704 0.0124
NP_441020.2_6 Forward -138 -121 9.47861 0.17
NP_441020.2_6 Reverse -125 -142 8.69197 0.191
NP_441020.2_6 Forward -107 -90 6.82368 0.251
NP_441673.1_1 Forward -136 -127 20.8459 0.000698
NP_441673.1_1 Reverse -127 -136 20.8459 0.000698
NP_441826.1_2 Reverse -121 -135 4.12949 0.105
NP_441826.1_2 Forward -142 -128 3.8345 0.105
NP_441330.1_1 Forward -141 -122 -12.4886 0.183
NP_442868.1_6 Forward -138 -128 1.06167 0.205
NP_442868.1_6 Reverse -125 -135 0.963343 0.205
NP_441251.1_2 Forward -340 -322 10.4422 0.262
NP_440785.1_1 Reverse -193 -212 4.52268 0.142
NP_442808.1_1 Reverse -126 -136 18.4657 0.00201
NP_442808.1_1 Forward -137 -127 8.73102 0.0481
NP_440145.1_3 Forward -146 -127 4.22769 0.0894
NP_442542.1_9 Reverse -120 -134 8.75042 0.152
NP_442050.1_5 Forward -138 -128 18.0724 0.00365
NP_442050.1_5 Reverse -125 -135 9.12434 0.193
NP_442050.1_5 Reverse -256 -266 6.76441 0.282
NP_440346.1_7 Reverse -23 -42 5.30933 0.29
NP_440558.1_2 Forward -145 -126 5.89931 0.137
NP_440558.1_2 Reverse -92 -111 -6.78538 0.28
NP_441518.1_3 Reverse -117 -136 2.26107 0.0598
NP_441878.1_6 Forward -137 -127 10.5014 0.0176
NP_441878.1_6 Reverse -126 -136 10.4031 0.0176
NP_441036.1_8 Reverse -126 -136 17.7779 0.000554
NP_441036.1_8 Forward -137 -127 15.713 0.00724
NP_442721.1_3 Forward -195 -176 13.6675 0.261
NP_441557.1_5 Forward -136 -127 19.9609 0.000699
NP_441557.1_5 Reverse -127 -136 19.9609 0.000699
NP_442066.2_9 Reverse -123 -136 9.36073 0.175
NP_441308.1_8 Forward -138 -128 13.353 0.218
NP_441308.1_8 Reverse -125 -135 10.1081 0.22
NP_441458.1_10 Reverse -118 -137 2.55606 0.269
NP_442183.1_1 Forward -136 -122 20.4524 0.00436
NP_442183.1_1 Reverse -127 -141 16.5192 0.0143
NP_441549.1_9 Reverse -123 -141 -5.58572 0.198
NP_442347.1_2 Forward -135 -126 11.1111 0.056
NP_442347.1_2 Reverse -259 -268 3.44131 0.284
NP_442347.1_2 Reverse -128 -137 3.34298 0.284
NP_442645.1_2 Forward -144 -125 -16.7168 0.24
NP_442645.1_2 Forward -138 -119 -21.4367 0.29
NP_440547.1_1 Reverse -262 -281 9.83173 0.237
NP_441037.1_4 Forward -138 -128 7.31769 0.237
NP_441037.1_4 Reverse -125 -135 7.02532 0.237
NP_441633.1_3 Forward -305 -292 0.314277 0.127
NP_441633.1_3 Reverse -125 -138 -3.91395 0.177
NP_441633.1_3 Forward -138 -125 -5.88057 0.236
NP_440136.1_2 Forward -135 -128 15.9687 0.0123
NP_440136.1_2 Reverse -128 -135 15.9687 0.0123
NP_442998.1_10 Forward -134 -127 15.5754 0.0102
NP_442998.1_10 Reverse -129 -136 15.5754 0.0102
NP_440899.1_1 Forward -147 -128 7.91948 0.247
NP_440299.1_1 Forward -140 -127 3.55864 0.241
NP_440299.1_1 Reverse -123 -136 2.18201 0.294
NP_441799.1_1 Forward -140 -126 15.6336 0.0172
NP_441799.1_1 Reverse -123 -137 11.9953 0.0487
NP_441007.1_10 Reverse -122 -135 5.23083 0.182
NP_441007.1_10 Forward -141 -128 1.19926 0.207
NP_442334.1_2 Forward -146 -129 -4.58271 0.2
NP_440256.1_1 Forward -139 -120 10.0292 0.019
NP_440256.1_1 Reverse -333 -352 0.196116 0.0858
NP_440256.1_1 Forward -89 -70 -3.63879 0.137
NP_440087.1_1 Forward -145 -126 0.0977854 0.167
NP_440915.1_6 Reverse -123 -137 5.80112 0.0879
NP_442866.1_1 Reverse -122 -141 -4.91709 0.237
NP_441199.1_6 Forward -140 -121 5.60432 0.151
NP_442993.1_1 Forward -136 -120 17.7581 0.00636
NP_442993.1_1 Reverse -127 -143 9.89163 0.0172
NP_442386.1_3 Reverse -289 -308 14.7491 0.279
NP_442386.1_9 Reverse -126 -135 15.7322 0.0144
NP_442386.1_9 Forward -178 -169 7.2758 0.219
NP_442386.1_9 Forward -137 -128 6.39082 0.219
NP_441340.1_5 Forward -135 -128 15.6737 0.0124
NP_441340.1_5 Reverse -128 -135 15.6737 0.0124
NP_441271.1_5 Reverse -242 -261 12.4875 0.153
NP_441947.1_4 Reverse -116 -135 16.8141 0.112
NP_441947.1_10 Forward -138 -120 0.0191479 0.276
NP_442791.1_5 Reverse -119 -138 -9.24366 0.279
NP_440168.1_4 Forward -75 -56 -1.67217 0.255
NP_442714.1_5 Reverse -379 -398 2.45773 0.238
NP_441160.1_1 Reverse -88 -107 -11.4069 0.292
NP_441134.1_6 Reverse -140 -158 8.17984 0.276
NP_440586.1_8 Forward -135 -128 13.2151 0.026
NP_440586.1_8 Reverse -128 -135 13.2151 0.026
NP_440586.1_8 Reverse -321 -328 8.88855 0.205
NP_442251.1_6 Forward -135 -128 15.2804 0.0124
NP_442251.1_6 Reverse -128 -135 15.2804 0.0124
NP_440684.1_9 Reverse -121 -135 16.6175 0.0691
NP_440684.1_9 Forward -142 -128 7.47274 0.263
NP_441262.1_3 Reverse -127 -134 14.7888 0.0223
NP_441262.1_3 Forward -136 -129 14.7888 0.0223
NP_443051.1_1 Forward -137 -128 19.5676 0.00335
NP_443051.1_1 Reverse -126 -135 10.4228 0.00754
NP_439937.1_8 Forward -138 -119 -5.21209 0.288
NP_439937.1_9 Reverse -94 -111 -10.9749 0.237
NP_440439.1_1 Forward -139 -126 16.2439 0.0128
NP_440439.1_1 Reverse -124 -137 8.08242 0.0559
NP_440439.1_1 Forward -89 -76 -0.275709 0.211
NP_440372.1_2 Forward -135 -128 16.3621 0.0124
NP_440372.1_2 Reverse -128 -135 16.3621 0.0124
NP_440574.1_7 Forward -373 -354 9.24257 0.29
NP_441293.1_2 Forward -133 -114 19.2723 0.197
NP_441803.1_2 Forward -141 -122 4.22769 0.18
NP_439977.1_5 Reverse -252 -271 -3.14714 0.296
NP_440589.1_4 Forward -157 -138 13.4708 0.224
NP_440139.1_1 Forward -142 -123 2.16195 0.237
NP_441572.1_7 Reverse -121 -140 -0.688862 0.182
NP_440267.1_2 Forward -141 -127 18.6818 0.024
NP_442384.1_10 Reverse -127 -140 6.50913 0.0995
NP_442384.1_10 Forward -136 -123 6.50913 0.0995
NP_442384.1_10 Reverse -77 -90 4.05085 0.17
NP_440693.1_8 Forward -91 -72 12.1925 0.283
NP_440364.1_6 Reverse -126 -139 13.6867 0.275
NP_441877.1_7 Reverse -116 -135 3.73524 0.218
NP_442790.1_4 Reverse -118 -137 -6.49039 0.144
NP_442262.1_10 Forward -135 -128 14.1988 0.0123
NP_442262.1_10 Reverse -128 -135 14.1988 0.0123
NP_442262.1_10 Forward -344 -337 7.90559 0.266
NP_441689.1_5 Forward -138 -128 17.8758 0.0158
NP_441689.1_5 Reverse -125 -135 8.53436 0.132
NP_440163.1_10 Reverse -124 -134 15.2213 0.0762
NP_440344.1_10 Reverse -120 -137 1.51381 0.0304
NP_440282.1_10 Forward -146 -127 -9.24366 0.275
NP_440531.1_6 Reverse -119 -138 -2.75381 0.258
NP_441965.1_10 Reverse -124 -140 7.33503 0.15
NP_440297.1_9 Forward -135 -125 9.32148 0.0917
NP_440297.1_9 Reverse -128 -138 9.22315 0.0917
NP_440350.1_5 Forward -372 -353 -4.03212 0.273
NP_441896.1_3 Reverse -118 -137 0.491109 0.225
NP_442067.1_4 Reverse -116 -135 21.6323 0.0172
NP_440999.1_9 Reverse -123 -137 8.55439 0.074
NP_440888.1_2 Forward -136 -122 14.4536 0.0176
NP_440888.1_2 Reverse -127 -141 11.307 0.0705
NP_440888.1_2 Reverse -168 -182 5.40719 0.28
NP_442147.1_7 Forward -154 -135 12.3892 0.233
NP_441543.1_2 Forward -135 -126 18.486 0.00236
NP_441543.1_2 Reverse -128 -137 15.9293 0.00518
NP_442845.1_2 Forward -142 -128 12.1926 0.114
NP_442845.1_2 Reverse -121 -135 9.83269 0.165
NP_441551.1_5 Reverse -123 -139 11.3659 0.174
NP_442710.1_7 Forward -249 -230 -8.56828 0.299
NP_441469.1_8 Reverse -126 -135 16.126 0.00797
NP_441469.1_8 Forward -137 -128 6.5879 0.227
NP_443064.1_6 Reverse -127 -137 10.8217 0.13
NP_442337.1_8 Forward -371 -352 -0.0988766 0.263
NP_442578.1_7 Forward -135 -128 14.5921 0.026
NP_442578.1_7 Reverse -128 -135 14.5921 0.026
NP_440148.1_1 Reverse -283 -302 -6.49039 0.265
NP_441462.1_2 Reverse -127 -137 20.2362 0.000805
NP_441462.1_2 Forward -136 -126 11.5831 0.00406
NP_441462.1_2 Forward -86 -76 -1.19994 0.291
NP_441621.1_7 Reverse -125 -139 4.22782 0.0934
NP_441621.1_7 Reverse -141 -155 -6.58858 0.298
NP_441929.1_6 Reverse -280 -299 9.3409 0.262
NP_443062.1_1 Reverse -127 -145 13.1288 0.0663
NP_441410.1_3 Forward -145 -126 5.30933 0.247
NP_442204.1_1 Forward -140 -129 9.49844 0.0759
NP_442204.1_5 Reverse -117 -136 3.6377 0.186
NP_440255.1_3 Forward -238 -228 14.345 0.298
NP_440516.1_8 Forward -136 -127 16.9127 0.00442
NP_440516.1_8 Reverse -127 -136 16.9127 0.00442
NP_442428.1_5 Forward -135 -128 15.8704 0.0124
NP_442428.1_5 Reverse -128 -135 15.8704 0.0124
NP_442120.1_10 Reverse -121 -140 -4.03212 0.199
NP_440673.1_3 Forward -134 -127 12.4288 0.0426
NP_440673.1_3 Reverse -129 -136 12.4288 0.0426
NP_441052.1_2 Forward -136 -126 10.5014 0.0285
NP_441052.1_2 Reverse -127 -137 10.4031 0.0285
NP_442219.1_9 Forward -135 -126 8.35786 0.0681
NP_442219.1_9 Reverse -128 -137 8.25953 0.0681
NP_440436.1_4 Forward -135 -126 18.1905 0.00233
NP_440436.1_4 Reverse -128 -137 9.24241 0.0871
NP_442864.1_7 Forward -103 -85 7.88563 0.274
NP_440314.1_9 Reverse -128 -147 3.04771 0.0849
NP_442577.1_9 Forward -232 -218 13.7653 0.216
NP_441719.1_4 Forward -135 -128 16.3621 0.0124
NP_441719.1_4 Reverse -128 -135 16.3621 0.0124
NP_441733.1_10 Forward -139 -126 5.91914 0.203
NP_442366.1_3 Reverse -126 -144 11.3272 0.0376
NP_442206.1_4 Reverse -128 -147 9.83255 0.234
NP_442206.1_10 Reverse -127 -142 -0.216765 0.287
NP_442854.1_6 Reverse -127 -146 1.17943 0.285
NP_443054.1_2 Forward -138 -124 12.4876 0.0722
NP_441851.1_10 Reverse -126 -136 16.008 0.00552
NP_441851.1_10 Forward -137 -127 8.53483 0.114
NP_442622.1_5 Reverse -125 -144 -4.13045 0.194
NP_442011.1_1 Reverse -126 -145 -2.65548 0.279
NP_442515.1_1 Forward -137 -123 -4.62196 0.298
NP_440165.1_5 Reverse -126 -145 -7.76869 0.276
NP_441349.1_10 Forward -146 -127 15.3391 0.0131
NP_441349.1_10 Forward -96 -77 -8.35868 0.274
NP_441349.1_10 Reverse -117 -136 -9.047 0.281
NP_441409.1_6 Reverse -121 -140 -4.91709 0.0958
NP_441409.1_6 Forward -142 -123 -15.4385 0.295
NP_440474.1_8 Forward -135 -121 18.3868 0.0432
NP_440474.1_8 Reverse -128 -142 6.39049 0.227
NP_442450.1_5 Forward -138 -128 9.41981 0.115
NP_442450.1_5 Reverse -125 -135 9.32148 0.115
NP_440588.1_2 Forward -145 -126 1.0811 0.139
NP_441873.1_4 Reverse -149 -167 21.062 0.103
NP_441570.1_1 Reverse -127 -145 -0.7675 0.0506
NP_441570.1_1 Forward -136 -118 -5.78238 0.0761
NP_441570.1_1 Forward -86 -68 -11.9772 0.206
NP_441078.1_4 Forward -136 -127 19.6659 0.0007
NP_441078.1_4 Reverse -127 -136 19.6659 0.0007
NP_441078.1_4 Forward -86 -77 -1.47524 0.266
NP_442729.1_8 Reverse -123 -136 9.45906 0.125
NP_441663.1_8 Forward -142 -123 -0.983855 0.235
NP_442443.1_1 Forward -151 -132 -5.31042 0.282
NP_440526.1_3 Reverse -259 -270 4.28642 0.267
NP_440526.1_3 Forward -135 -124 1.92649 0.267
NP_441432.1_8 Forward -137 -128 16.8143 0.00595
NP_441432.1_8 Reverse -126 -135 8.25953 0.0755
NP_441432.1_8 Forward -87 -78 2.94966 0.28
NP_441432.1_9 Forward -298 -285 10.9253 0.235
NP_442320.1_8 Reverse -121 -135 6.6861 0.0257
NP_442320.1_8 Forward -142 -128 -4.7203 0.185
NP_442344.1_7 Reverse -128 -147 -7.57203 0.188
NP_441732.1_2 Forward -140 -124 -7.80794 0.0935
NP_440497.1_6 Reverse -90 -109 -7.4737 0.292
NP_440629.1_6 Forward -142 -123 17.4826 0.078
NP_440760.1_1 Forward -136 -117 -11.8003 0.0882
NP_440199.1_10 Reverse -124 -134 14.533 0.0861
NP_440461.1_10 Forward -326 -307 17.4032 0.277
NP_441057.1_4 Forward -282 -264 -0.570838 0.269
NP_442489.1_7 Forward -136 -127 20.1576 0.000695
NP_442489.1_7 Reverse -127 -136 20.1576 0.000695
NP_441706.1_1 Forward -383 -364 1.76941 0.144
NP_440559.1_1 Forward -135 -126 8.75118 0.0586
NP_440559.1_1 Reverse -128 -137 8.65285 0.0586
NP_441659.2_8 Reverse -127 -137 20.9245 0.000805
NP_441659.2_8 Forward -136 -126 11.9764 0.0147
NP_441022.1_1 Forward -13 -4 11.834 0.273
NP_442913.1_10 Forward -95 -76 0.294447 0.155
NP_442776.1_6 Forward -251 -232 6.78429 0.297
NP_442346.1_5 Forward -137 -127 16.303 0.00248
NP_442346.1_5 Reverse -126 -136 9.02648 0.118
NP_440545.1_3 Forward -140 -123 2.98877 0.0903
NP_440486.1_6 Forward -149 -130 9.93088 0.219
NP_440010.1_4 Forward -140 -121 5.11187 0.208
NP_440010.1_10 Forward -148 -129 9.14423 0.211
NP_440847.1_8 Forward -376 -357 13.1758 0.273
NP_441833.1_4 Forward -135 -128 15.9687 0.0124
NP_441833.1_4 Reverse -128 -135 15.9687 0.0124
NP_442162.1_9 Forward -135 -128 16.2637 0.0124
NP_442162.1_9 Reverse -128 -135 16.2637 0.0124
NP_440671.1_4 Forward -142 -128 17.8958 0.0164
NP_440671.1_4 Reverse -121 -135 11.6026 0.129
NP_442140.1_3 Forward -135 -125 8.33817 0.119
NP_442021.1_3 Reverse -121 -140 -7.08038 0.261
NP_441609.1_1 Reverse -233 -252 -2.45882 0.29
NP_440875.1_9 Forward -134 -124 8.37203 0.233
NP_440875.1_9 Reverse -129 -139 8.27469 0.233
NP_441813.1_5 Reverse -125 -135 17.188 0.00979
NP_441813.1_5 Forward -138 -128 15.9097 0.01
NP_440590.1_4 Forward -135 -122 3.36254 0.0746
NP_440567.1_1 Forward -135 -121 13.9626 0.0194
NP_440567.1_1 Reverse -128 -142 3.73617 0.137
NP_442497.1_10 Reverse -128 -137 17.601 0.00813
NP_442497.1_10 Forward -135 -126 10.4228 0.0087
NP_440821.1_4 Reverse -125 -135 19.0562 0.00399
NP_440821.1_4 Forward -138 -128 11.0914 0.0146
NP_441239.1_9 Forward -138 -126 14.6903 0.0258
NP_441239.1_9 Reverse -125 -137 13.3137 0.037
NP_441239.1_9 Forward -29 -17 3.97222 0.269
NP_441009.1_7 Forward -137 -118 11.1109 0.238
NP_441892.1_1 Reverse -118 -135 -0.846137 0.192
NP_441892.1_1 Forward -145 -128 -2.02611 0.217
NP_441769.1_3 Reverse -233 -252 -5.01617 0.245
NP_440212.1_9 Reverse -327 -346 1.13788 0.28
NP_442138.1_10 Reverse -127 -146 6.19431 0.0842
NP_442138.1_10 Forward -136 -117 -0.197208 0.147
NP_440546.1_4 Reverse -127 -137 13.5365 0.0459
NP_440546.1_4 Forward -136 -126 11.8882 0.0679
NP_440546.1_4 Reverse -305 -315 7.13728 0.257
NP_440462.1_6 Forward -138 -128 16.893 0.00853
NP_440462.1_6 Reverse -125 -135 15.418 0.0142
NP_440868.1_4 Forward -140 -128 12.9203 0.0231
NP_440868.1_4 Reverse -123 -135 10.7571 0.0364
NP_442499.1_3 Reverse -126 -144 5.42735 0.282
NP_440374.1_3 Reverse -325 -343 12.034 0.272
NP_441084.1_6 Forward -138 -124 9.92586 0.257
NP_442039.1_4 Forward -135 -128 15.1821 0.0124
NP_442039.1_4 Reverse -128 -135 15.1821 0.0124
NP_441926.1_3 Reverse -127 -143 17.0698 0.0428
NP_442837.1_3 Forward -135 -128 15.7721 0.0124
NP_442837.1_3 Reverse -128 -135 15.7721 0.0124
NP_442053.1_1 Forward -136 -127 18.3876 0.0007
NP_442053.1_1 Reverse -127 -136 18.3876 0.0007
NP_440505.1_3 Forward -138 -128 15.123 0.014
NP_440505.1_3 Reverse -125 -135 13.8447 0.0247
NP_441203.1_1 Reverse -128 -147 -5.40875 0.0985
NP_440914.1_1 Reverse -127 -137 16.3248 0.00196
NP_440914.1_1 Forward -136 -126 8.6151 0.186
NP_441011.1_8 Forward -135 -126 16.9127 0.00602
NP_441011.1_8 Reverse -128 -137 16.6177 0.00602
NP_441011.1_8 Forward -85 -76 7.57121 0.17
NP_442101.1_10 Forward -144 -125 3.24438 0.0714
NP_442533.1_6 Forward -136 -127 17.2076 0.00137
NP_442533.1_6 Reverse -127 -136 17.2076 0.00137
NP_442533.1_6 Forward -104 -95 3.04799 0.228
NP_442533.1_6 Reverse -77 -86 2.55633 0.25
NP_442232.1_5 Forward -379 -360 8.16093 0.286
NP_442322.1_2 Forward -228 -209 15.1416 0.229
NP_441482.1_7 Forward -142 -128 6.09611 0.0343
NP_441482.1_7 Reverse -121 -135 -9.04686 0.193
NP_439944.1_9 Reverse -128 -138 17.6796 0.00347
NP_439944.1_9 Forward -135 -125 10.3048 0.0887
NP_441697.1_5 Forward -346 -327 -11.2207 0.294
NP_441028.1_6 Forward -205 -195 5.19112 0.265
NP_440115.1_6 Forward -139 -129 7.45319 0.147
NP_440007.1_9 Reverse -123 -137 1.37622 0.285
NP_442673.1_5 Forward -368 -350 13.4905 0.272
NP_441106.1_1 Forward -137 -128 18.486 0.0028
NP_441106.1_1 Reverse -126 -135 18.191 0.0028
NP_439903.1_6 Forward -139 -120 18.7798 0.0527
NP_439903.1_6 Reverse -124 -143 3.24359 0.211
NP_440444.1_9 Reverse -137 -156 14.3549 0.21
NP_442928.1_3 Forward -106 -87 11.2603 0.293
NP_440797.1_2 Reverse -116 -135 13.0568 0.241
NP_441286.1_1 Forward -137 -125 5.05386 0.0259
NP_441286.1_1 Reverse -126 -138 4.8572 0.0272
NP_442674.1_3 Reverse -119 -138 3.24359 0.294
NP_440670.1_8 Forward -136 -127 18.3876 0.000699
NP_440670.1_8 Reverse -127 -136 18.3876 0.000699
NP_440886.1_7 Reverse -126 -136 17.7774 0.0011
NP_440886.1_7 Forward -137 -127 8.04271 0.0805
NP_440886.1_7 Reverse -142 -152 4.10949 0.253
NP_442614.1_2 Forward -136 -122 6.09611 0.293
NP_440799.1_10 Reverse -230 -249 12.0942 0.267
NP_442072.1_9 Forward -137 -119 -22.1053 0.22
NP_440907.2_8 Reverse -128 -138 9.51767 0.103
NP_440907.2_8 Forward -135 -125 7.84605 0.117
NP_442264.1_2 Forward -114 -97 5.9387 0.267
NP_441021.1_8 Forward -141 -123 3.06741 0.237
NP_442459.1_2 Reverse -16 -35 10.6192 0.202
NP_441463.1_3 Forward -146 -127 -9.83364 0.286
NP_441626.1_2 Forward -135 -128 15.7721 0.0124
NP_441626.1_2 Reverse -128 -135 15.7721 0.0124
NP_442615.1_1 Forward -145 -127 -0.7675 0.121
NP_442615.1_1 Reverse -118 -136 -4.70074 0.192
NP_440387.1_1 Reverse -127 -143 16.5781 0.0047
NP_440387.1_1 Forward -136 -120 5.6634 0.0311
NP_440855.1_5 Reverse -185 -204 1.6703 0.295
NP_441993.1_1 Forward -136 -117 6.23481 0.184
NP_440114.1_10 Forward -136 -122 17.3058 0.011
NP_440114.1_10 Reverse -127 -141 10.0294 0.155
NP_442357.1_1 Forward -161 -142 9.63589 0.283
NP_440293.1_3 Reverse -88 -107 -1.67217 0.239
NP_440766.1_4 Forward -140 -126 6.78443 0.0973
NP_439988.1_3 Reverse -91 -105 9.63603 0.247
NP_440422.1_10 Forward -238 -219 8.66165 0.212
NP_442743.1_5 Forward -141 -122 5.30933 0.202
NP_439910.1_2 Reverse -119 -136 -21.299 0.183
NP_440457.1_1 Forward -140 -128 1.41561 0.239
NP_440457.1_1 Reverse -123 -135 -0.0593532 0.25
NP_440798.1_6 Reverse -128 -141 0.60927 0.254
NP_440801.1_8 Reverse -126 -145 5.30933 0.192
NP_440473.1_9 Forward -147 -128 -5.11376 0.206
NP_442509.1_9 Forward -136 -126 16.2041 0.00739
NP_442509.1_9 Reverse -127 -137 8.04271 0.192
NP_440554.1_4 Reverse -128 -138 16.1063 0.0189
NP_440554.1_4 Forward -135 -125 14.6313 0.02
NP_441885.1_5 Forward -136 -126 11.4848 0.00668
NP_441885.1_5 Reverse -127 -137 11.3864 0.00668
NP_441428.1_8 Reverse -119 -138 19.3707 0.0281
NP_442341.1_7 Forward -137 -123 7.57108 0.102
NP_442341.1_9 Reverse -125 -139 13.8636 0.0744
NP_442341.1_9 Forward -138 -124 8.3571 0.171
NP_442395.2_4 Forward -190 -171 3.83357 0.194
NP_440423.1_6 Reverse -119 -138 -7.37537 0.138
NP_440423.1_6 Forward -144 -125 -14.5535 0.229
NP_443000.1_7 Forward -138 -128 17.4829 0.00719
NP_443000.1_7 Reverse -125 -135 8.73149 0.0437
NP_440507.2_3 Forward -145 -126 12.3883 0.155
NP_440552.1_8 Forward -240 -223 9.69683 0.292
NP_440275.1_3 Forward -138 -128 9.12481 0.055
NP_440275.1_3 Reverse -125 -135 8.4365 0.0602
NP_440091.1_1 Reverse -123 -135 10.7571 0.0429
NP_440091.1_1 Forward -140 -128 -0.354346 0.273
NP_441902.1_3 Forward -147 -137 15.4111 0.201
NP_440679.1_10 Reverse -120 -139 -20.3551 0.284
NP_442451.1_2 Reverse -119 -138 -3.3438 0.195
NP_441207.1_7 Forward -251 -237 8.96496 0.282
NP_439962.1_4 Forward -104 -85 -5.21209 0.278
NP_440149.1_8 Forward -136 -117 -2.55715 0.172
NP_441105.1_3 Reverse -116 -135 0.0977854 0.13
NP_440216.1_1 Reverse -77 -91 5.50613 0.0196
NP_440216.1_1 Reverse -127 -141 5.30946 0.0215
NP_440216.1_1 Forward -136 -122 -1.5737 0.034
NP_440172.1_1 Reverse -127 -137 17.5813 0.00421
NP_440172.1_1 Forward -136 -126 8.73149 0.0586
NP_440172.1_1 Reverse -77 -87 2.43831 0.279
NP_440172.1_6 Forward -148 -129 5.11266 0.288
NP_442015.1_10 Forward -140 -127 1.49425 0.204
NP_442015.1_10 Reverse -123 -136 0.805932 0.218
NP_441226.1_7 Forward -135 -128 14.4934 0.0123
NP_441226.1_7 Reverse -128 -135 14.4934 0.0123
NP_441226.1_7 Reverse -264 -271 6.52862 0.253
NP_441111.1_7 Forward -135 -127 18.7023 0.00294
NP_441111.1_7 Reverse -128 -136 18.7023 0.00294
NP_442379.1_10 Forward -143 -126 -2.02611 0.224
NP_440415.1_9 Forward -132 -113 14.4541 0.288
NP_441766.1_2 Forward -136 -127 17.5026 0.00297
NP_441766.1_2 Reverse -127 -136 17.5026 0.00297
NP_442417.1_5 Reverse -127 -141 9.04604 0.138
NP_440416.1_1 Reverse -127 -146 -12.6852 0.272
NP_443052.1_8 Forward -146 -127 -3.93378 0.109
NP_442154.1_1 Forward -107 -89 -17.5821 0.26
NP_440261.1_5 Forward -135 -122 -10.5021 0.201
NP_440261.1_5 Reverse -128 -141 -10.6988 0.203
NP_440261.1_5 Reverse -97 -110 -12.1738 0.272
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATGTCTTAATTGATGTCTTTTCGGACGATTCTACTTGGTTTACTTGGTCACATCAACAGATTGCTTATTTTATTGATCGGTCTGAAACATATCGGCTTGTGATTAACCCTGTTATTTATGCGGAAGTATCCGTTGGGATTGAGTCTACTGAAAAGCTTGATCAACTTTTATTGCCAAAATACTACGACAGAGAATCTTTGCCCTATGAAGCGGCATTTCTAGCAGGAAAGGCTTTTCTGCAATATCGACGCAGTGGGGGAACAAGGCGATCGCCGTTACCGGATTTTTATATCGGGGCCCATGCTCTGACGGCAGGTTATCGGCTTCTGAGTCGTGACAATAAGCGTTACCAAACCTATTTTCCTGATCTTGATCTCATCGCACCTTAAAAGATTTTTTT

CDS

ATGAAATTGAACCGTACAAGTACCCAAAAATATCTTAAGAATTTTGATTTTGAATCTCTTTTTATCGAAGAATTAGGTTGGGATACAACCGACCCAATAGCATTGCCGTTAGAAATTGATGAGGCTATTTTTGAAGCGATTGCCATTGCCCAGAAGCGTGGTTTTACGGCGTATTATTGTTCCACTACTGAGATTCCAGAGCGAAAGGTTAGGTTGGCTCTTGATCGTCAATTATCGGATTATTCTAAATCTCACTTATTAATTTTTGGGGATGAAGCGCAAACAGGACAGGTTTGGCTATGGGTGAGGCAGGAACTTGGAAAACCTTTAGCTCCTAAATTTGAACAATATCGGATTGGTCAATCGCCAGAACGGCTTTTACAGAAATTAGAAGCTTTGGCGATCACCTTTGAAGAGGAAGAATGTTTAACCCTTGTTGAAGTTAATCGGCGTGTTAAAAAAGCGTTTGATGTTGAGAAAACAACGAAGAAATTTTATACAGAGTTTGAAAAGCAGCATAAGCAATTCCTGAAATATATTGACGGTATTAATAATGATTTTGACAGGAGTTGGTATGCTTCTTTAATGCTAAATCGCTTGATGTTTGTTTATTTCATTCAACGAAAAGGATTTTTAAATAGAGATATTGATTATTTACAAAATCGTTTGAAATTGTGTCAAGAGAAATTTGGTAATGATGAGTTTTATTCATTCTATCGGTATTTTCTTATGCAAATATTCCATGAGGGCCTAGGCAAATCAGATCGTAATCAAGAGTTAGATAAATTACTTGGTAATATTCCCTATCTCAATGGTGGTTTTTTTGATGTTCATCAGTTAGAGATTAAATATGAAAATATCCAAATTCCTGATGATGCTTTTGAACAATTATTTGTCTTTTTTGGTAACTGGGATTGGCATTTAGATAATCGTATTACTAAGAATCAGAATGAAATTAATCCTGATATTCTAGGTTATATCTTTGAGAAGTATATTAACCAGAAGCAAATGGGGGCTTACTATACGAAGGAAGATATTACAGAATACATTAGTAAAAATACAATTATTCCTTTTCTATTTGATGCGACGAAGAAGGAATGTGAGGTCACTTTTCGTGCCGATGGGGAAATTTGGTCGCTACTGAAAGAAAACCCAAATCGATATATTTATGATGCGGTTCTAAAAGGTGTTGATGTAGATTTACCGCTAGAAATTGCAGCAGGAATTAATGATGTTTCTCAGCGGCAAGATTGGAATCAATCAGCATCAGACGAATTTGCTCTACCAACTGAAACTTGGCGTGAACATATTGTCCGTCGTCAGCGTTGTTTGGATATTCGGGAAAAACTCAAATCCGGCGAAATGACTAGCATCAATGATCTAATTACCTATAATCTCAATATTCGTCAGTTTGCTCAGGATGTGATTACGGGTTGTGAGGGGTCTGATTTTCTCTTAGCTTTTTATCGGGTGATCGCCTCTGTGTCTGTGCTTGACCCGACCTGTGGTTCTGGGGCGTTTTTGTTTGCGGCGTTAGAAATCCTCGAACCGCTCTATTCTGGTTGTTTGGGAAGGATGCGGGGTTTTGTTGAGGAGGATGATCGTCGGATTCGAGGGACAGATCATAAGCCGAGATATGCTGAATTTCGGGAAATTCTTGCTGAAGTGGAAAAACACCCGAATAAACAGTATTTTGTGCTGAAATCTATCATGTTGAATAACCTCTATGGTGTGGACATTATGGATGAGGCGACGGAGATTTGTAAGTTACGTTTATTTCTAAAGTTGGTTGCTCAGGTTGAACCTAATCCCAAGGCTAAAAATTTAGGTTTAGAGCCTTTACCAGATATTGATTTTAATATTCGGGCGGGTAATACTTTGGTAGGTTTTACATCACGGAATGAGGTTTATCAGTCGATGACTCGTGATGCAACTGGACAAACTAAGTTGTTATTTGATGATAGTTTCTTAAAACGGATTGAACAGGGAGCTATCGCTGTTGATCAGGAGTTTAAGAGGTTTAAGTTTCTACAGACTGAAACTGAGGTAGATGGTCGAGTTTTAGCTGAGGCAAAGGCTCACTTAAATCGATGTCTTGAAGAACTACGAACCGAATTAGACCGATATCTAGCAGAAGAGTATGAGCTAGGTTTATCGAAAAAAGAAAAAGCTTTTCAAGAGTGGAAAGAAAGTCATCAGCCTTTTCATTGGTTTGTAGAGTTTTACGGAATTATTCATTCTGGTGGTTTTGATGTCATTATTGGCAATCCGCCTTATGTGGAATATAGCAAAATTAAGAAGGAATACACTATTAAGGGATATCAAACAGAAAGTTGTGGAAATTTATATGCTTATTCTATGGAACGAGCTTCCAGTATATTAAAATTATCAGGTCATATAGGCTTTATCATTCCAGTTGCTTCAGTCTGTACGGATGGTTATTTACCTTTGCGGAATATCTTAGTAACAAATGGGGATCTAGTTATCAGTAATTTTAATGATCGTCCAAGTAAATTATTTGATGGTATTGAACATATTAGATTATCAATAATTCTCTGGAAAAAGCAGAAACTTACTTCACATTCTATATTCACAACTAGATATAATAAATGGCAAGCAGTCGAACGTTCAATTCTATTTAATTGTCTTACATACAGTAATACAAAACAATTTATTAAGGATGGTTCTATCTCTAAGGTAGCAACTAAAATCGAAAAAAGTATTTTAAAAAAAGTGACATCACAGAAAAAATATTTGGATCTATATATTGACAAAACAGGGACATATCAAATTTTTTATACTCGAAAGTTAAGCGGATTTGTTCAAATATTAGATTTTATTCCTGAAATCTATGATAATAACAATCAAAAACGCGATCCATCTGAGTTGAAGAATTTATCCTTTTCTACAAAGGAAATAAGAGATGCATTTCTAGTTCTTCTTAATTCCAATTTGTTTTACTGGTTCTTAACCATATATTCTGATTGTAGAAATCTAAACAAACGAGAAATTGCTTCGATTGCTCTGGATTTTGAGAATTTGTCTAAGTCCTTACATCAACCTTTATCGGATCTATCAGTAGCTCTTATGGATGACTTTAAAAGTAATTCTAAGCTACTTGAGATGAGCTATAAGAAGCTTGGGAAAATGAAAATTCAATGTATTTATCCAAAATTTTCAAAGCCAATCATTGATGAAATTGATCGTGTATTAGCTAAACATTATGGCTTCACTGATGAAGAACTAGATTTTATTATTAACTATGATATTAAATATCGTATGGGTCGTGATCTTGAGGACTAG

Protein

No sequence available