Your browser is old and dusty. Try Google Chrome!

Details for slr6049

ORF slr6049
Accession NP_942492.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_443027.1_4 Forward -82 -72 5.97822 0.294
NP_441812.1_3 Reverse -208 -222 7.9644 0.254
NP_441225.1_4 Reverse -1 -20 -4.13045 0.261
NP_440784.1_7 Reverse -6 -13 7.51227 0.138
NP_441054.1_2 Forward -70 -51 11.5042 0.267
NP_441476.1_5 Reverse -297 -316 -4.42544 0.25
NP_440908.1_5 Reverse -78 -95 8.59364 0.271
NP_441594.1_6 Forward -287 -268 3.6377 0.226
NP_440447.1_6 Reverse -345 -363 1.88744 0.253
NP_442398.1_1 Reverse -202 -221 9.24257 0.257
NP_440747.1_10 Reverse -2 -14 -12.3507 0.27
NP_441014.1_10 Reverse -4 -23 4.91521 0.194
NP_440642.1_10 Reverse -219 -233 9.53707 0.186
NP_441414.1_6 Reverse -77 -96 -4.6221 0.26
NP_442937.1_5 Forward -325 -306 5.89931 0.295
NP_442690.1_1 Reverse -342 -361 -11.2103 0.225
NP_442002.1_1 Forward -94 -76 -9.91228 0.287
NP_440377.1_1 Forward -103 -86 12.24 0.26
NP_440147.1_4 Reverse -300 -313 4.93583 0.142
NP_440174.1_2 Reverse -380 -399 13.8641 0.244
NP_439966.1_9 Forward -266 -257 3.83464 0.253
NP_442281.1_1 Reverse -66 -80 9.24208 0.0726
NP_442575.1_8 Forward -296 -277 6.98095 0.125
NP_442500.1_8 Forward -203 -189 10.2748 0.272
NP_441087.1_6 Reverse -36 -54 -2.63651 0.296
NP_441556.1_7 Forward -118 -99 2.16195 0.269
NP_441644.1_6 Reverse -71 -81 3.61784 0.272
NP_442215.1_2 Forward -313 -297 1.33684 0.136
NP_440382.1_2 Forward -245 -226 5.50519 0.264
NP_442554.1_8 Reverse -72 -82 7.15819 0.0975
NP_442863.1_10 Forward -284 -265 13.7658 0.233
NP_443009.1_5 Reverse -254 -265 5.56471 0.197
NP_440620.1_4 Reverse -357 -371 13.5715 0.281
NP_441198.1_8 Forward -82 -72 12.783 0.116
NP_441015.1_9 Forward -105 -92 14.8666 0.292
NP_441849.1_2 Reverse -185 -204 2.05265 0.245
NP_442050.1_1 Forward -97 -78 8.75091 0.25
NP_441036.1_3 Forward -226 -207 -0.983855 0.192
NP_441036.1_3 Forward -53 -34 -2.55715 0.235
NP_441445.1_1 Forward -320 -301 3.53937 0.212
NP_441116.1_9 Forward -377 -363 18.5841 0.111
NP_442645.1_2 Forward -82 -63 -21.1417 0.29
NP_441037.1_4 Forward -286 -276 5.95329 0.289
NP_441633.1_3 Reverse -300 -313 -6.76555 0.271
NP_442998.1_5 Forward -54 -44 12.8614 0.158
NP_442998.1_5 Forward -53 -43 10.9931 0.199
NP_441799.1_1 Reverse -265 -279 4.03056 0.269
NP_440456.1_7 Forward -57 -43 12.291 0.281
NP_440915.1_5 Forward -306 -287 15.2983 0.28
NP_440915.1_6 Forward -84 -70 -3.34366 0.293
NP_440748.1_5 Forward -282 -263 -0.688862 0.26
NP_441199.1_7 Forward -237 -218 5.30933 0.231
NP_441232.1_2 Forward -287 -268 8.55425 0.243
NP_439937.1_9 Reverse -274 -291 -11.2699 0.248
NP_442294.1_3 Reverse -40 -54 12.2903 0.29
NP_442783.1_8 Reverse -280 -299 16.1249 0.216
NP_440819.1_5 Forward -55 -47 7.98423 0.228
NP_440819.1_5 Forward -54 -46 7.68924 0.266
NP_441572.1_1 Forward -287 -268 -2.75381 0.212
NP_440267.1_2 Reverse -71 -85 7.57046 0.196
NP_440344.1_10 Reverse -361 -378 -13.3342 0.282
NP_441965.1_10 Forward -83 -67 7.72835 0.142
NP_440999.1_9 Reverse -301 -315 1.76955 0.158
NP_440999.1_9 Reverse -1 -15 -0.590395 0.212
NP_442454.1_2 Forward -245 -226 7.87766 0.291
NP_441543.1_3 Reverse -284 -298 9.83206 0.226
NP_442845.1_2 Forward -86 -72 12.0943 0.116
NP_442315.1_1 Forward -325 -307 4.9357 0.256
NP_441929.1_3 Reverse -267 -286 2.94938 0.266
NP_443062.1_1 Reverse -71 -89 6.01073 0.211
NP_442780.1_1 Reverse -333 -352 8.94757 0.241
NP_442120.1_10 Forward -284 -265 -13.2752 0.282
NP_439949.1_10 Reverse -211 -230 14.255 0.285
NP_441542.1_4 Forward -57 -43 3.34284 0.285
NP_442515.1_1 Forward -213 -199 -1.96703 0.268
NP_441396.1_5 Forward -292 -283 7.37455 0.279
NP_441982.1_6 Forward -56 -47 11.3395 0.288
NP_442729.1_5 Forward -285 -275 9.32148 0.235
NP_442729.1_8 Forward -18 -5 5.03416 0.268
NP_442348.1_2 Reverse -94 -103 6.5879 0.299
NP_440707.1_9 Forward -303 -284 0.982764 0.292
NP_441432.1_9 Reverse -338 -351 8.59837 0.287
NP_441732.1_1 Forward -147 -133 18.5371 0.297
NP_440313.1_6 Forward -284 -265 20.354 0.0809
NP_442540.1_5 Forward -85 -66 13.8633 0.233
NP_442003.1_9 Forward -263 -244 4.916 0.243
NP_442353.1_4 Reverse -296 -315 3.34192 0.219
NP_440913.1_1 Forward -82 -64 4.83737 0.254
NP_439935.1_1 Forward -184 -165 16.0274 0.125
NP_442346.1_5 Forward -81 -71 4.20827 0.296
NP_440352.1_5 Forward -309 -290 13.4344 0.189
NP_441126.1_6 Forward -229 -215 14.4207 0.267
NP_442934.1_1 Reverse -349 -368 14.6508 0.229
NP_442311.1_5 Forward -109 -90 1.67108 0.261
NP_441050.1_5 Reverse -90 -108 -2.73412 0.284
NP_441329.1_1 Reverse -117 -136 4.24897 0.296
NP_441329.1_6 Forward -367 -348 -3.29489 0.3
NP_440671.1_4 Forward -284 -270 5.1128 0.292
NP_442943.1_1 Forward -192 -177 5.97674 0.21
NP_442199.1_7 Forward -111 -92 10.0284 0.13
NP_442021.1_6 Forward -70 -51 7.37428 0.262
NP_442021.1_6 Forward -303 -284 5.11266 0.268
NP_440875.1_9 Forward -83 -73 9.44274 0.233
NP_441239.1_9 Forward -82 -70 7.02048 0.173
NP_442193.1_1 Forward -80 -62 9.36059 0.245
NP_441617.1_3 Forward -355 -336 17.6007 0.0493
NP_440546.1_4 Forward -80 -70 9.65817 0.126
NP_440546.1_6 Forward -291 -272 6.68596 0.296
NP_440705.1_5 Forward -116 -97 14.5516 0.285
NP_442402.1_4 Reverse -38 -57 -5.40949 0.244
NP_442402.1_10 Reverse -45 -55 12.5659 0.206
NP_441848.1_4 Forward -231 -215 10.8929 0.239
NP_440696.1_6 Forward -316 -297 3.53937 0.288
NP_441180.1_2 Forward -300 -281 12.1291 0.287
NP_442837.1_3 Forward -272 -265 6.82395 0.184
NP_442360.1_5 Reverse -88 -98 14.6313 0.201
NP_441701.1_3 Forward -18 -1 11.4452 0.213
NP_442532.1_4 Reverse -86 -104 7.5771 0.296
NP_442101.1_6 Reverse -189 -208 13.0775 0.227
NP_442533.1_1 Forward -70 -51 -16.3235 0.265
NP_442533.1_6 Reverse -71 -80 6.09625 0.118
NP_442533.1_6 Forward -80 -71 4.71961 0.177
NP_440263.1_5 Forward -69 -55 9.83269 0.294
NP_440263.1_5 Reverse -347 -361 9.2427 0.294
NP_442322.1_4 Reverse -283 -300 -9.89323 0.297
NP_442535.1_2 Forward -69 -50 11.6025 0.152
NP_441697.1_5 Reverse -123 -142 -9.69285 0.273
NP_440816.1_2 Forward -154 -135 15.9226 0.132
NP_441028.1_6 Reverse -46 -56 5.48612 0.255
NP_441028.1_6 Reverse -219 -229 5.19112 0.265
NP_441028.1_6 Reverse -218 -228 4.7978 0.277
NP_440007.1_9 Forward -308 -294 1.96621 0.281
NP_442673.1_7 Reverse -98 -117 13.2252 0.238
NP_440429.1_9 Reverse -77 -96 6.98095 0.211
NP_440480.1_10 Forward -105 -91 15.9285 0.224
NP_440028.1_3 Forward -193 -174 16.1755 0.201
NP_440028.1_6 Forward -295 -277 14.6705 0.218
NP_442020.1_1 Reverse -358 -377 -0.39464 0.274
NP_441993.1_1 Forward -284 -265 6.62464 0.178
NP_440114.1_10 Forward -80 -66 7.76774 0.227
NP_440054.1_4 Forward -385 -366 14.4541 0.135
NP_442514.1_5 Reverse -273 -292 -7.86776 0.28
NP_442862.1_3 Reverse -44 -61 4.56207 0.29
NP_441173.1_9 Reverse -47 -55 9.75379 0.284
NP_440191.1_4 Reverse -181 -191 13.1481 0.282
NP_441207.1_7 Forward -224 -210 12.063 0.241
NP_441105.1_3 Forward -91 -72 -8.45701 0.272
NP_442015.1_10 Reverse -1 -14 1.78924 0.204
NP_442116.1_6 Forward -114 -97 5.49518 0.296
NP_442403.1_8 Forward -302 -283 6.4893 0.187
NP_442154.1_1 Forward -322 -304 -15.9105 0.228
NP_442154.1_1 Forward -325 -307 -19.3521 0.298
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

TCCCTAAACCGTGAACTAAAGGCGGGTATTTCTGATGAAGATTTAGCGCAAAAAGTAACTTATCTTATGGAGCATGATGCGTTGTGTGTGGTGACTGCTGATGGAGAATTTGAGGGGGCAAAGGTGATTTGCTCGCTGGGATTATTTCAACGTTAAGATCAAACTATATTAACTGAGGAAAAATCAATGACAATAACAACACAAGCTCAAATTGTTGAAATGCTGGAACAGTTACCAGATGGTGCTTTAGATGAAGTGAAATCATTTTTAGCAGCATTACAAAATCGTTATCCTGCAAAACATGCCCCAAAGTTGAGTGAGGGCATGGCTTATATTGAGCAAGTTCGGGGAAAAATGCAGTGTGATATGACCACCGATGAAATTATGGCGCTGACAAGGG

CDS

GTGAGGATGATTAAAGTTTTGGTAGATAGCAATGTCTTAATTGATGTCTTTTCGGACGATTCTACTTGGTTTACTTGGTCACATCAACAGATTGCTTATTTTATTGATCGGTCTGAAACATATCGGCTTGTGATTAACCCTGTTATTTATGCGGAAGTATCCGTTGGGATTGAGTCTACTGAAAAGCTTGATCAACTTTTATTGCCAAAATACTACGACAGAGAATCTTTGCCCTATGAAGCGGCATTTCTAGCAGGAAAGGCTTTTCTGCAATATCGACGCAGTGGGGGAACAAGGCGATCGCCGTTACCGGATTTTTATATCGGGGCCCATGCTCTGACGGCAGGTTATCGGCTTCTGAGTCGTGACAATAAGCGTTACCAAACCTATTTTCCTGATCTTGATCTCATCGCACCTTAA

Protein

No sequence available