Your browser is old and dusty. Try Google Chrome!

Details for slr6047

ORF slr6047
Accession NP_942490.1
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440557.1_1 Forward -199 -180 0.786102 0.265
NP_442151.1_6 Forward -87 -73 5.1128 0.294
NP_441818.1_9 Forward -73 -54 -8.06369 0.274
NP_442173.1_1 Forward -105 -97 4.93597 0.241
NP_442975.1_10 Reverse -18 -32 7.66879 0.122
NP_442975.1_10 Reverse -74 -88 6.58715 0.17
NP_441337.1_4 Forward -268 -249 3.04771 0.275
NP_442074.1_3 Forward -322 -309 17.9149 0.285
NP_441859.1_3 Reverse -96 -115 8.4551 0.139
NP_440304.1_4 Reverse -95 -105 5.28991 0.218
NP_441594.1_6 Reverse -100 -119 0.196116 0.291
NP_441083.1_5 Reverse -256 -266 3.32329 0.173
NP_441163.1_9 Reverse -53 -72 12.0942 0.288
NP_440906.1_5 Reverse -288 -295 5.64398 0.292
NP_442973.1_5 Reverse -182 -201 12.6841 0.199
NP_441880.2_10 Reverse -98 -116 9.45892 0.239
NP_442634.1_4 Forward -267 -253 0.196253 0.149
NP_441014.1_8 Reverse -54 -73 -9.83364 0.299
NP_441012.1_4 Reverse -117 -130 5.62415 0.291
NP_443018.1_3 Forward -105 -98 10.7572 0.0907
NP_443018.1_3 Reverse -98 -105 4.56234 0.241
NP_442687.1_7 Reverse -120 -130 8.4365 0.107
NP_442687.1_7 Forward -12 -2 3.71661 0.292
NP_441422.1_7 Reverse -261 -278 -2.91109 0.225
NP_442658.1_1 Reverse -95 -105 12.5659 0.0526
NP_441487.1_9 Reverse -67 -86 3.14605 0.163
NP_441127.1_1 Reverse -377 -391 13.8643 0.164
NP_439905.1_1 Reverse -369 -382 7.29578 0.263
NP_442690.1_1 Forward -292 -273 -16.6185 0.29
NP_440153.1_5 Forward -264 -250 9.73436 0.113
NP_440153.1_5 Forward -251 -237 7.47274 0.161
NP_440369.1_5 Forward -31 -12 8.16093 0.296
NP_442064.1_4 Forward -300 -281 4.81688 0.284
NP_443055.1_3 Forward -233 -214 14.1783 0.142
NP_442853.1_10 Reverse -56 -75 11.8967 0.168
NP_441099.1_5 Reverse -108 -127 -8.752 0.203
NP_441294.1_7 Reverse -187 -201 9.73057 0.229
NP_441646.1_1 Forward -157 -138 3.73603 0.206
NP_440811.1_6 Forward -66 -47 19.9606 0.0746
NP_441175.1_10 Forward -313 -295 8.37728 0.264
NP_441916.1_10 Reverse -343 -362 0.392778 0.285
NP_441041.1_7 Forward -41 -29 5.76558 0.241
NP_441725.1_4 Forward -319 -305 2.75226 0.279
NP_439966.1_7 Forward -108 -98 4.69947 0.263
NP_439966.1_9 Forward -108 -99 6.98123 0.253
NP_440177.1_1 Reverse -54 -72 5.62401 0.272
NP_441457.1_7 Reverse -95 -114 -0.4922 0.293
NP_441644.1_6 Forward -200 -190 7.55106 0.123
NP_441644.1_6 Reverse -263 -273 3.91283 0.256
NP_442029.1_6 Forward -135 -116 5.40766 0.25
NP_440929.1_8 Reverse -243 -252 2.94966 0.246
NP_440382.1_2 Reverse -297 -316 3.34192 0.274
NP_442075.1_1 Forward -72 -53 7.07928 0.269
NP_441762.1_7 Reverse -96 -108 -3.10761 0.0911
NP_442142.1_4 Forward -109 -96 11.8184 0.0518
NP_442142.1_4 Reverse -58 -71 5.82024 0.182
NP_443009.1_5 Reverse -190 -201 8.21964 0.114
NP_440881.1_4 Forward -337 -318 -0.885524 0.265
NP_441448.1_1 Forward -69 -50 4.12936 0.279
NP_442076.1_8 Forward -40 -21 6.39097 0.262
NP_441198.1_8 Reverse -95 -105 12.9783 0.116
NP_440464.1_10 Reverse -79 -89 15.8729 0.169
NP_440464.1_10 Reverse -288 -298 12.9127 0.176
NP_441468.1_1 Reverse -98 -105 4.07068 0.263
NP_441015.1_10 Forward -66 -47 -3.73712 0.191
NP_441876.1_9 Reverse -80 -90 13.4509 0.267
NP_442719.1_2 Forward -395 -377 -11.6829 0.294
NP_441612.1_2 Forward -87 -77 6.61303 0.283
NP_440145.1_3 Forward -210 -191 -2.45882 0.17
NP_442050.1_5 Reverse -241 -251 9.41933 0.193
NP_442135.1_3 Reverse -60 -79 3.93269 0.281
NP_442347.1_2 Reverse -79 -88 8.1612 0.108
NP_442645.1_2 Forward -39 -20 -22.0267 0.29
NP_442317.1_6 Reverse -101 -120 17.5024 0.0832
NP_442317.1_6 Forward -111 -92 7.86593 0.22
NP_441728.2_4 Reverse -273 -292 11.2199 0.293
NP_442998.1_5 Reverse -384 -394 13.353 0.158
NP_442998.1_10 Reverse -24 -31 10.2655 0.0946
NP_441799.1_1 Reverse -93 -107 4.12889 0.266
NP_442334.1_2 Forward -64 -47 2.59545 0.2
NP_441957.1_1 Reverse -89 -108 5.50599 0.279
NP_440709.1_1 Reverse -274 -293 4.03023 0.205
NP_442756.1_8 Forward -336 -317 14.5524 0.0344
NP_440717.1_2 Forward -70 -51 -0.885524 0.227
NP_440717.1_3 Reverse -259 -273 6.88214 0.291
NP_442993.1_1 Reverse -215 -231 -10.2662 0.214
NP_442386.1_9 Forward -107 -98 6.68581 0.219
NP_441340.1_5 Forward -105 -98 3.97235 0.274
NP_442484.1_2 Reverse -54 -73 2.0644 0.226
NP_442791.1_5 Reverse -183 -202 -10.1286 0.279
NP_441254.1_1 Reverse -348 -361 10.2451 0.295
NP_442714.1_7 Reverse -288 -307 6.4893 0.16
NP_440211.1_4 Reverse -342 -352 14.533 0.286
NP_440586.1_9 Forward -68 -49 5.60432 0.288
NP_442294.1_3 Forward -120 -106 16.2235 0.165
NP_442294.1_3 Forward -160 -146 12.782 0.274
NP_440408.1_1 Forward -122 -103 5.50599 0.227
NP_440439.1_6 Forward -286 -267 3.34271 0.242
NP_440316.1_10 Reverse -96 -106 5.48657 0.295
NP_440948.1_4 Reverse -261 -280 13.0775 0.175
NP_441877.1_9 Forward -285 -268 6.33202 0.284
NP_441631.1_7 Forward -114 -95 19.9606 0.281
NP_441018.1_7 Forward -91 -72 6.4893 0.286
NP_442262.1_10 Forward -105 -98 9.87221 0.164
NP_441965.1_10 Reverse -75 -91 7.63002 0.144
NP_440894.1_10 Reverse -123 -142 5.89931 0.227
NP_440999.1_9 Reverse -64 -78 -2.45868 0.27
NP_440888.1_2 Forward -106 -92 6.19383 0.243
NP_440600.1_1 Reverse -277 -296 18.4773 0.0949
NP_442033.1_10 Forward -108 -89 -7.76869 0.186
NP_442033.1_10 Forward -31 -12 -13.6686 0.287
NP_442315.1_2 Forward -91 -79 8.6921 0.293
NP_443064.1_8 Reverse -134 -144 15.2208 0.286
NP_442286.1_8 Forward -374 -356 14.5132 0.294
NP_441621.1_7 Forward -108 -94 -4.91696 0.248
NP_441929.1_2 Forward -366 -347 12.8808 0.216
NP_441033.1_2 Reverse -12 -31 5.30933 0.0914
NP_442428.1_5 Reverse -98 -105 4.46401 0.267
NP_442120.1_10 Reverse -103 -122 -4.91709 0.199
NP_440673.1_3 Forward -104 -97 10.5605 0.123
NP_441052.1_2 Reverse -78 -88 13.1564 0.0285
NP_442219.1_9 Reverse -79 -88 1.76968 0.298
NP_441884.1_9 Reverse -49 -68 -22.3217 0.277
NP_441004.1_1 Forward -47 -28 -11.7019 0.241
NP_440328.1_4 Forward -271 -252 0.58944 0.246
NP_440611.1_6 Reverse -89 -108 11.0125 0.222
NP_440593.1_3 Forward -135 -116 -6.29373 0.272
NP_441051.1_2 Forward -27 -8 18.4857 0.0517
NP_441409.1_6 Forward -302 -283 -11.8986 0.224
NP_440474.1_8 Reverse -98 -112 5.89884 0.237
NP_440474.1_8 Reverse -119 -133 4.8172 0.266
NP_443047.1_10 Forward -308 -291 16.5584 0.28
NP_441570.1_1 Forward -87 -69 -17.7788 0.291
NP_440707.1_9 Forward -66 -47 0.884433 0.292
NP_441432.1_2 Forward -228 -214 18.9775 0.251
NP_441432.1_8 Reverse -96 -105 5.3096 0.17
NP_441432.1_8 Forward -297 -288 2.75299 0.287
NP_441732.1_5 Reverse -249 -263 10.816 0.224
NP_442797.1_1 Reverse -54 -73 0.491109 0.216
NP_441057.1_4 Forward -140 -122 -3.12744 0.283
NP_440713.1_4 Forward -91 -72 6.39097 0.19
NP_442489.1_7 Forward -200 -191 -1.96689 0.28
NP_440757.1_6 Reverse -102 -121 10.7175 0.28
NP_441659.2_8 Forward -224 -214 -0.118297 0.287
NP_441040.1_2 Forward -72 -53 -15.6352 0.286
NP_440250.1_4 Forward -291 -272 21.3364 0.0222
NP_440010.1_10 Forward -73 -54 3.44104 0.257
NP_441888.1_1 Reverse -239 -258 11.2092 0.198
NP_440946.1_6 Forward -388 -369 7.07928 0.294
NP_440788.1_8 Reverse -87 -106 13.6675 0.265
NP_442140.1_3 Reverse -98 -108 8.63316 0.119
NP_442140.1_3 Forward -69 -59 3.91327 0.271
NP_442778.1_10 Forward -369 -351 8.37728 0.259
NP_441813.1_5 Forward -254 -244 -0.609952 0.261
NP_440227.1_10 Reverse -72 -91 11.2084 0.235
NP_441239.1_9 Reverse -95 -107 3.97222 0.269
NP_441239.1_9 Reverse -254 -266 3.2839 0.289
NP_441239.1_9 Forward -108 -96 3.18557 0.292
NP_442897.1_1 Forward -156 -137 25.4266 0.00145
NP_441892.1_1 Reverse -88 -105 -1.92778 0.215
NP_442629.1_3 Forward -72 -53 0.196116 0.294
NP_440546.1_7 Forward -70 -60 14.533 0.279
NP_442402.1_4 Reverse -70 -89 -2.65624 0.2
NP_441084.1_6 Reverse -95 -109 9.15021 0.292
NP_440505.1_3 Reverse -213 -223 5.5849 0.222
NP_442101.1_9 Reverse -218 -237 17.0449 0.227
NP_440068.1_1 Reverse -368 -387 -1.27885 0.249
NP_442322.1_4 Reverse -46 -63 -10.0899 0.298
NP_441527.1_4 Reverse -352 -371 2.05265 0.131
NP_441527.1_4 Reverse -371 -390 -10.9342 0.277
NP_441106.1_1 Reverse -96 -105 4.71961 0.21
NP_441106.1_9 Forward -361 -351 15.3197 0.289
NP_440429.1_2 Forward -105 -86 7.86593 0.279
NP_440670.1_6 Reverse -76 -95 15.0441 0.292
NP_440886.1_10 Forward -388 -369 8.65176 0.248
NP_440828.1_1 Reverse -54 -73 5.2102 0.207
NP_442072.1_9 Forward -266 -248 -22.597 0.246
NP_441626.1_2 Forward -251 -244 4.759 0.258
NP_442794.1_1 Reverse -18 -30 5.44718 0.221
NP_442794.1_1 Reverse -74 -86 3.18557 0.286
NP_441431.1_2 Forward -109 -95 10.9137 0.15
NP_441836.1_2 Forward -73 -54 -5.01543 0.269
NP_441174.1_2 Reverse -94 -108 16.4209 0.0763
NP_440114.1_10 Reverse -97 -111 7.37441 0.236
NP_440766.1_5 Reverse -383 -395 16.3456 0.158
NP_441801.1_4 Reverse -112 -122 3.02829 0.231
NP_440473.1_1 Reverse -55 -74 14.8245 0.135
NP_442582.1_3 Reverse -273 -287 13.3805 0.273
NP_442514.1_5 Reverse -53 -72 -2.55791 0.221
NP_440554.1_4 Forward -105 -95 4.69992 0.181
NP_442341.1_7 Forward -88 -74 1.47456 0.288
NP_439962.1_4 Reverse -54 -73 -6.68705 0.283
NP_440216.1_1 Reverse -256 -270 -5.60527 0.133
NP_440216.1_9 Reverse -265 -274 5.80125 0.289
NP_440172.1_1 Forward -200 -190 1.84832 0.294
NP_441226.1_7 Reverse -29 -36 6.52862 0.253
NP_441757.1_3 Forward -71 -52 0.0977854 0.198
NP_442417.1_5 Forward -127 -113 8.75105 0.147
NP_440416.1_1 Reverse -309 -328 -14.6519 0.295
NP_443052.1_9 Reverse -54 -73 0.294447 0.2
NP_443052.1_9 Reverse -51 -70 -2.16383 0.233
NP_442154.1_1 Forward -78 -60 -7.94566 0.151
NP_441430.1_2 Forward -390 -371 28.3188 0.000201
NP_442564.1_6 Reverse -166 -185 13.8641 0.28
NP_440988.1_10 Reverse -76 -90 5.09245 0.246
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

CCAGGAAGTTTTGTCCCTGTTGCCGCCTTCAGTATTTATTGACGTTTTTGAATGTCCCAAGTTGGATTTCACTCGCTGAAAACCCGATTAATAGACGTTTTGTTGACTATCACGATTTGTTAAGACTTTGCAACGGGTGATCTGATCCTGCGTTAGCATTCCGTCATACAGTAGAAACCTATCGTCAGTTATGGAAAGTAGGCGATTATCTATCCGGGTTCCAGATCCATTACTCAATCAGTTGGAGTCTTACCTTGACCAGCAGGGTTTAACGGTGACCGAGGGAGTTTTAGCCGCCATTGCTTCCTATGTTGGGGATAACGATAGGTTGCCGCTGGTGGAGAGGGTTAGTCGGATTGAGAAACGGTTGGCGATATTGGAAGGGAAGGGTTAAACGTCC

CDS

ATGTCTTCAATCTATGACAATTGTGATTTTCCTCTACTGCCAGAGCTTAAGCATTGTCTAAAGGAAGGTTATCGTTCGGATTTTTGTGTTGGCTACTTTAACCTGCGTGGTTGGCGAGAGTTAGAGGATGAAGTCGAGCAATTTACTGCCGGGAAAGGTCAAAATTGTCGTTTACTGGTGGGGATGCAGAGGCCGCCTAACGATGAACTTAGGCGTAGTTTATCTATTACGAAGCGTGCAAATCAGCGGATGTCGAACGAACAGGCAAATAAGTTGAAAAAGATTATGGCTCATGAGTTTCGAGAGCAGTTAACCTATGGCGTTCCTACTGCAAGGGATGAAGCAAGTCTCAAACGATTAAAAGCGCAATTGCAAGCTGAAAAACTAGAAGTTAAACTATTTTTACGTCATCTACTCCATGCCAAGCTTTATCTAATCCATCGAGAAGATAAAATTACACCTCGCATTGGTTATGTGGGTAGTAGTAATCTGACTTTCTCTGGTTTGAGTGGTCAGGGTGAACTGAATGTTGAAGTCACAGACCGAGACGATACAAAGAAGTTAGAAGAGTGGTTTATTGAACGATGGGAGGATAATTTTTCTCTCGATATTTCTCAAGACTTGATTAAGGTGATTGATGAAAGTTGGGCTGGAAAGCAACTACCTCCTTTTTATATTTATCTCAAGATGGCTTATCATCTGTCGCAGGAAGCACGGGATGGTTTGAGTCGATATCAAGCTCCGAAAAATTTTGGTTTGTTGGAATTTCAAGAGCAGGCTGTACGGGTAGCGATGCAGCATATCGATAAGCGCAATGGAGTGGTGATCGGTGATGTGGTTGGTCTAGGGAAAACGTTAGTGGGAACGGCGATCGCCCATGTGTGTGAAGAGGAATATGGGACGAGTACATTAATTATTTGTCCGAAGAATCTTGAATCAATGTGGCAAGGCTATGTTGATCGCTATGGCCTGCGGGGTAAGGTTGTCCCGATTAGCCAAGTGGAACAAAGATTGCCAGAAGTGCCTGCCCGGTTTCGTTTGGTACTGATTGATGAGAGTCATAACCTACGTAACCGTGAAGGAAAACGATATCAGGCGATTAAAGAATACATAGAGCAGAGTGGCAGTCGTTGTATTCTGTTGACGGCAACCCCCTACAACAAAGGTTATTTGGATTTATCGTCTCAGTTGCGTTTATTTTTGAGGGCTGAAGCAGACATCGGCATTAAACCAGAAGCCCACATCCGTAATTTGGGTGGTGAAATGCAATTTTTACGGAAACATAATGCAACCCCAGTACGATCATTGATGGCATTTGAGCATAGTGATGAGCCGGAAGATTGGCAACAATTAATGAGTCGCTATATGGTGCGCCGGACAAGGGGTTTTATTAAAAAGACCTATGCTAAAGAAGACGAGCGAGGTTATTACTTAGAGTTTCCCAATAGTGATCGCTTTTATTTCCCGAAACGTTGCCCAAGGACTGTTAAGTTTAGTACAAGTGATGAAAAAGACCCCTATGCGAGGTTATACGGCGATCGCGTGGTGGATATTATCAATAGCCTAAATTTACCTCGTTATGGCTTAGGGAATTATTTGATTCCGTCGCCCGGTAATCAAAAGAAAAAACATAAGAAATCCCTCGGTCAGATGAGCTTGGCAACGGGATTTGAGCATTTGGATGTCACCGAGGCAGAGCGAAAAATTCTGGCAAATCTTTCCCATGCTGGTCAGCGGTTAATGGGCTTCTGTCGCACCAATTTATTTAAACGTCTAGAAAGCAGTGGTGCAGCTTTTATTCAGTCTATCGATCGCCATATTTTAAGGAATTATGTCTATCTCCATGCGATTGCCAATAATTTACCGATTCCAATTGGCACCCAGGATGCGGCTTTGTTGGATGGGACAACGGACGAAGATCAGGATTCTTTGTTAGGTCAGGATTGGGAAACGGCAACGGATACAGAGGACAGCTTTGATGAGGATCGGCTAACCCCCGGTGCAGAATTCAAACAACGGGCAGTTGCAATTTATGAGCTTTACCAAAATCAGTACCAGCGGCGATTTAAGTGGATTCGTCCTGATTTATTTACGCCGGAACTGGCTGATAATCTAGAACAGGATGCGAAATCTTTAATCAATATCCTGAAAATTTCAGGCCGTTGGAATGCGGATGAAGATGGCAAACTGCAATCTTTAATTCGTTTACTAACTGAAGAACATCCAGACGAGAAAATTTTGATTTTTACGCAATTTGCGGATACAGCGAGATATTTGGCTCAGGCTTTAGAAACGGCAGGGATTACCAATATTGGTTTGGCAACGGGAAATTCTCAGATAGACCCAACGATACTTGCCCAGCGTTTTAGTCCGAGGAGTAATGGTAAGGCGATCTCGCAGAGAGCCGTTGCCGCTGAGGATCAGTTAAGGATATTGGTGGCGACGGATGTGCTTAGTGAGGGTCAAAATCTACAGGACGCAGGGATTATTCTGAATTACGATTTGCCTTGGGCGATTATTCGTTTGATTCAGCGGGCGGGTCGTGTGGATCGTATTGGCCAGGAAGCAGATGAAATTTTCTGTTATTCGTTTCTGCCAGCGGAGGGGGTAGAGCAATTAATTAATCTACGGGGTCGGTTACGCGATCGCCTGAAGGAAAATCAGGAAGTAGTGGGTACTGATGAAGCATTTTTTGAGGACGATGAAGAGCGGGAAGTTCTGCTAAATCTTTACAATGAAAAATCGAATATTCTTGATGAGGATGACGACGAGGGAGAAGTGGATTTAACGTCGGAAGCTCTGCAAATTTGGCAGACGGCCATTGATGCAAATCCTAAGCTAAAACGTATTATTGAAGATCTGCCGGATGTAGTGTTTTCTACTCGTCACCATGGGCCGAGTGTTTTGGAACCAGAGGGGGTTTTGCTTTATCTCAGAACTGCTGAGGGTACGGATGCGCTGGCATGGGTGGATAAGCAGGGCCATAGTGTGACCCAATCTCAAATGCGAATTTTACGAATGGCGGGTTGTAATTTAAACACCCCAGCTCTAGACCGTCATCCTGAACATCATAATTTAGTACAAAAGGCGGCTCAGATTGTGACTGATCAGACGAAAAAAGTTGCTGGCACAATGGGCAGTCGGCGAGGAGCAAGGGCAAGAACCTACGATCATCTTATGTCCTATTGCCAGTATGTGCAGGAAAAGACACCAATTTTAGCCCAGGGTCAGGACTGGGAAAATTTAGTCAAAGCCATTGAAATGATACATAACTATCCCCTTAAGCAAAATGCGATCGCCTCCCTAAACCGTGAACTAAAGGCGGGTATTTCTGATGAAGATTTAGCGCAAAAAGTAACTTATCTTATGGAGCATGATGCGTTGTGTGTGGTGACTGCTGATGGAGAATTTGAGGGGGCAAAGGTGATTTGCTCGCTGGGATTATTTCAACGTTAA

Protein

No sequence available